ID: 917435469

View in Genome Browser
Species Human (GRCh38)
Location 1:175016948-175016970
Sequence TAGGGGGTATGGCGGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917435469 Original CRISPR TAGGGGGTATGGCGGGCAGG GGG (reversed) Intronic
900847491 1:5115432-5115454 TAGGGGGAATCCCGGGCAGCGGG - Intergenic
901489342 1:9588846-9588868 TAGGCGGGCAGGCGGGCAGGCGG - Intergenic
901489345 1:9588854-9588876 TAGGCGGGTAGGCGGGCAGGCGG - Intergenic
901877385 1:12174721-12174743 GAGGGGGTAGGGAGGGCAGCTGG - Intronic
902352175 1:15864864-15864886 AAGGGGGTAGGGTGGGGAGGTGG + Intronic
903633853 1:24799168-24799190 TAGATGGGATGGCGGCCAGGCGG - Intronic
903866060 1:26398702-26398724 ATGGGGGTGTGGGGGGCAGGGGG + Intergenic
904834003 1:33323357-33323379 AAGTGGGAATGGCGGGTAGGGGG + Intergenic
905599230 1:39234978-39235000 TAGGTGGGATGGCGGCCGGGCGG + Intronic
905776190 1:40668832-40668854 TGGAGGGGCTGGCGGGCAGGAGG - Intergenic
906187400 1:43871913-43871935 GAGGGGGTATGTGGGGGAGGGGG + Intronic
906476407 1:46172185-46172207 CAGGGGAGATGGCAGGCAGGTGG - Intronic
906491130 1:46269653-46269675 TGGTGGGTATGGCAGGCAGTAGG - Intronic
911103633 1:94113216-94113238 GAGGGTGTATGGTGGGGAGGGGG - Intronic
911791996 1:102029067-102029089 TGGGGGGTTTGGGGGGCTGGGGG + Intergenic
914985897 1:152457024-152457046 GAGAGGGTATGGCAGGAAGGAGG + Intergenic
915420059 1:155773329-155773351 TTGGGGGGATGGTGGGCAGATGG - Intronic
916368933 1:164067147-164067169 GTGGGGGTATAGCGGGGAGGTGG - Intergenic
916535409 1:165698737-165698759 TGTGGGGTATGGCGGGGTGGTGG - Exonic
917435469 1:175016948-175016970 TAGGGGGTATGGCGGGCAGGGGG - Intronic
920032170 1:203044100-203044122 TGTGGGGGCTGGCGGGCAGGTGG - Intronic
920550188 1:206854097-206854119 TAGGGGGTTTGGGGGGAAGGGGG + Intergenic
921238451 1:213152712-213152734 TAGGTGGGATGGCGGCCGGGCGG + Intronic
922030606 1:221793996-221794018 TAGAGGCTAAGGCAGGCAGGAGG - Intergenic
922213100 1:223500308-223500330 TGGGGGGAATGATGGGCAGGGGG + Intergenic
923127730 1:231047188-231047210 AAGGGGTTATGGAGGGAAGGAGG - Intergenic
923793091 1:237127857-237127879 TAGGTGGGATGGCGGCCGGGCGG + Intronic
924716094 1:246575600-246575622 TAGTGGGTATGTAGGGCAGGGGG + Intronic
1063998337 10:11641945-11641967 TTGGGGGTATGGCAGGCAATAGG - Intergenic
1065061956 10:21911093-21911115 AAGGCGGGAAGGCGGGCAGGCGG + Intronic
1068051862 10:51960494-51960516 TGGGGGGTGTGGTGGGGAGGGGG - Intronic
1069755959 10:70774600-70774622 CCGGGGATATGGTGGGCAGGAGG - Intronic
1071044925 10:81361933-81361955 TAGGGGGTAGGGCGGGGGTGAGG - Intergenic
1073099207 10:100998223-100998245 TAGGGGGTGGGGCGAGGAGGAGG - Intronic
1075126810 10:119707016-119707038 TAGGGGGAGGGGCGGGAAGGAGG + Intergenic
1075425865 10:122341432-122341454 GAGGGGCTGGGGCGGGCAGGAGG + Intergenic
1077015979 11:399372-399394 TGGGGCAGATGGCGGGCAGGTGG - Intronic
1077271889 11:1685343-1685365 CAGAGGGGAAGGCGGGCAGGTGG - Intergenic
1077837011 11:5934529-5934551 TAGGTGGGATGGCGGCCGGGCGG - Intronic
1080190851 11:29546911-29546933 AAGTGGGGATGGCAGGCAGGTGG - Intergenic
1082005542 11:47417045-47417067 AAGGTGGAATGGGGGGCAGGTGG - Intergenic
1083720659 11:64602058-64602080 CAGAGGATGTGGCGGGCAGGTGG - Exonic
1084481843 11:69426101-69426123 TAGGGGGAACTGCGGGTAGGGGG + Intergenic
1084736407 11:71108432-71108454 TAGGGCATCTGGAGGGCAGGTGG - Intronic
1086194397 11:84119989-84120011 TTGGAGGTATGGCTGGAAGGAGG + Intronic
1088059335 11:105627288-105627310 TAGGGGGGATGGCAGGTAGGTGG + Intronic
1089327436 11:117666948-117666970 TTGGGGGTAGGGCTGTCAGGTGG + Intronic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089919133 11:122191079-122191101 TTGGGGGTTTGCCGGGGAGGTGG - Intergenic
1092355265 12:7789350-7789372 TAGGGGGTGTGCCCGCCAGGAGG + Intronic
1093553471 12:20443357-20443379 AAGGGGATATGGCTGACAGGAGG + Intronic
1097251309 12:57633527-57633549 TGGGGGGCAGGGCGGGGAGGAGG - Intergenic
1098038688 12:66333232-66333254 CAGGGGGTGTGGTGGGCAGGAGG + Intronic
1098300884 12:69053160-69053182 TGGGAGGTGTGGAGGGCAGGGGG + Intergenic
1098689488 12:73468610-73468632 TATGGGGCATGGGGGGCAGGGGG + Intergenic
1098945950 12:76589799-76589821 TAGGAGGGATGGTAGGCAGGAGG - Intergenic
1100960144 12:99953957-99953979 TAGGGGGTTTGTGGGGGAGGCGG + Intronic
1101371052 12:104130913-104130935 TTGGGGGTGGGGAGGGCAGGCGG + Intronic
1102426456 12:112847974-112847996 AAGGGGGTGGGGCGGGGAGGTGG - Intronic
1102817218 12:115876308-115876330 TTGGGGGGATGGGGGGCAAGCGG + Intergenic
1104010288 12:124925470-124925492 GAAGGGATATGGAGGGCAGGAGG - Intergenic
1104548159 12:129731390-129731412 AAGAGGGTATGGGGGACAGGGGG + Intronic
1105527148 13:21186886-21186908 TAGGTGGGATGGCGGCCGGGCGG + Intergenic
1105726196 13:23164780-23164802 TAGGGAGCAGGGCTGGCAGGAGG - Intergenic
1110000545 13:70193908-70193930 TTGGGGGTATGGGGGGCAAAAGG - Intergenic
1111330620 13:86759454-86759476 TAGAGTGTGTGGGGGGCAGGAGG + Intergenic
1112186906 13:97136602-97136624 TAGGGGGTTTGGCAGGCAATGGG - Intergenic
1113949225 13:114061960-114061982 CAGGGGACATGGTGGGCAGGGGG + Intronic
1113994819 14:16056928-16056950 TAGGGGGTCTCGAGGGTAGGGGG + Intergenic
1117433404 14:55693660-55693682 TTCGGGATATGGTGGGCAGGAGG + Intronic
1119254657 14:73185078-73185100 TAGGTGGGATGGCGGCCGGGCGG + Intronic
1120792967 14:88602159-88602181 TAGCGGTTAGGGCGGGGAGGAGG - Intronic
1121852749 14:97237042-97237064 CATGGGGTATGGTGGGCAGCAGG - Intergenic
1122804642 14:104250301-104250323 TAGGGGGTGGGGCCTGCAGGGGG + Intergenic
1123872741 15:24593222-24593244 TAGAGAGTTTGGTGGGCAGGGGG + Intergenic
1125080314 15:35664997-35665019 TAGGGTGTATGTAGGGCAGGAGG - Intergenic
1125459731 15:39894692-39894714 TAGGTGGGATGGCGGCCGGGCGG + Intronic
1125681222 15:41531409-41531431 TAGAGGGAAAGGTGGGCAGGTGG - Intronic
1125699193 15:41666038-41666060 TAGCAGGTATGGTGGCCAGGAGG - Intronic
1128537150 15:68500154-68500176 AAGGGAGTATGGGGGGAAGGGGG - Intergenic
1131155618 15:90073407-90073429 TTGGGGGTTGGGAGGGCAGGCGG + Intronic
1132338724 15:101064877-101064899 TGGGGGGGGTGGCAGGCAGGGGG + Intronic
1133752156 16:8733304-8733326 TAGGTGGGATGGCGGCCGGGCGG + Intronic
1135563175 16:23492344-23492366 GAGGTGGTGGGGCGGGCAGGGGG + Intronic
1135639767 16:24109579-24109601 TAGGTGGGATGGCGGCCGGGCGG + Intronic
1136383162 16:29906459-29906481 TAGGGAGGATGGTGGGGAGGAGG + Exonic
1139140229 16:64253561-64253583 TAGTGGATATGGTGGGCAGGTGG - Intergenic
1139852937 16:69961732-69961754 TTGGGGGTATGGCGAGTAAGGGG + Intronic
1139881908 16:70184640-70184662 TTGGGGGTATGGCGAGTAAGGGG + Intronic
1140370603 16:74410866-74410888 TTGGGGGTATGGCGAGTAAGGGG - Intronic
1140994018 16:80243058-80243080 TAGGTGGGATGGCGGCCGGGCGG - Intergenic
1141026458 16:80553511-80553533 TATGGGGAATGGGGGGCAGGTGG - Intergenic
1141888523 16:86910402-86910424 TATGGGGTCTGGTTGGCAGGAGG - Intergenic
1142077622 16:88129312-88129334 GGCGGGGTCTGGCGGGCAGGAGG + Intergenic
1142227538 16:88884893-88884915 CAGGGGGAATGCCAGGCAGGGGG + Intronic
1142533546 17:598484-598506 TAGGTGGGATGGCGGCCGGGCGG - Intronic
1142705323 17:1690092-1690114 TAGGTGGGATGGCGGCCGGGCGG + Intergenic
1145318655 17:21750007-21750029 CAAGGGGGATGGTGGGCAGGAGG + Intergenic
1145779843 17:27555220-27555242 TGGGGGGTATGAGGGGTAGGTGG + Intronic
1146434653 17:32833183-32833205 CATGGGGTATAGCGAGCAGGAGG - Intronic
1146458243 17:33023831-33023853 TAGTGGGCATGGTAGGCAGGGGG - Intronic
1146809067 17:35889054-35889076 AAGGTAGTTTGGCGGGCAGGGGG + Intergenic
1147444668 17:40467532-40467554 AAGGGGGTGTGAGGGGCAGGGGG - Intergenic
1148204797 17:45773548-45773570 TGGGGGGGATGGGGGGCAGGGGG - Intergenic
1151374684 17:73679112-73679134 AAGGGGGTTTGCAGGGCAGGAGG - Intergenic
1151514416 17:74583128-74583150 TAAGGGGGAGGGCGGGCATGGGG - Intronic
1151704433 17:75759091-75759113 TAGGTGGCATGGCGGGATGGAGG + Intronic
1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG + Intergenic
1153633997 18:7098372-7098394 TAGGTGGGATGGCGGCCGGGCGG - Intronic
1155967488 18:32049591-32049613 TCGGGGGGGTGGCGGGGAGGAGG + Intronic
1156469851 18:37370387-37370409 GAAGGGGTATGGCAGGCTGGAGG + Intronic
1156622718 18:38872283-38872305 CAGGGGGTCTGGGGGTCAGGGGG - Intergenic
1158424344 18:57325561-57325583 TAGGGGTTATGGAGGAGAGGTGG - Intergenic
1160969154 19:1759771-1759793 GAGGGGGTATGAGGGGCTGGAGG + Intronic
1162032297 19:7922762-7922784 TGAGGGGCATGGCGGGCAGGAGG + Exonic
1162054127 19:8052686-8052708 AAGGGAGGAGGGCGGGCAGGGGG + Intronic
1163315663 19:16538929-16538951 GAGGGAGCATGGGGGGCAGGTGG - Intronic
1163750881 19:19076808-19076830 TAGGGGGTATATCAGGGAGGGGG - Intronic
1163824487 19:19515437-19515459 TAGGGCGCACGGGGGGCAGGAGG + Exonic
1164017417 19:21265071-21265093 TCGGGGGGATGGTGGGCAGCCGG - Intronic
1164682399 19:30144683-30144705 TTGAGGGTATGGCCTGCAGGAGG + Intergenic
1164788670 19:30957889-30957911 GAGGGGGAATGGCGGGGAGGAGG + Intergenic
1166329593 19:42070246-42070268 CAGGGAGGAGGGCGGGCAGGAGG + Intronic
1167038736 19:47009642-47009664 TAGGTGGGATGGCGGCCGGGCGG - Intergenic
1167591516 19:50406859-50406881 TGGGAGGTGAGGCGGGCAGGAGG - Intronic
1168287875 19:55343359-55343381 TAGGGGGTAGTCCAGGCAGGAGG + Intronic
1168651518 19:58095496-58095518 TAGAGGGGAGGGCCGGCAGGAGG - Intronic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
926215577 2:10903224-10903246 TAGGTGGGATGGCGGCCAGGCGG + Intergenic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
928368381 2:30721229-30721251 TAGGGAGCCTGGGGGGCAGGTGG + Intergenic
928394910 2:30936165-30936187 TGGGGGGAATGGAGGGCGGGAGG - Intronic
930130963 2:47850148-47850170 GAGTGGGTATGGTGGGCTGGGGG + Intronic
930985664 2:57584768-57584790 TAGTGGGGATGGCGAGGAGGTGG - Intergenic
931038454 2:58269074-58269096 GGGGGGGTAGGGCGGGCGGGGGG - Intergenic
931576340 2:63722252-63722274 TAGGTGGGATGGCGGCCGGGCGG - Intronic
932343527 2:70981369-70981391 TAGGGGGTAAAGCAGGTAGGGGG + Intronic
933750172 2:85598268-85598290 TAGGAGGCATGGGGGGAAGGTGG - Intergenic
935282920 2:101534557-101534579 AGGGGGGTAGGGAGGGCAGGTGG + Intergenic
936280086 2:111131232-111131254 TGGGGGGGATGGGGGGCGGGCGG + Intronic
936518423 2:113197084-113197106 TAGGGGGAAAAGAGGGCAGGTGG + Intronic
937067438 2:119028542-119028564 TAGCAGGAATGGCCGGCAGGGGG + Intergenic
937106732 2:119322850-119322872 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
937937227 2:127256015-127256037 GAGGCGGTATGTGGGGCAGGTGG + Intergenic
938099127 2:128486275-128486297 TATGGGGGAGGTCGGGCAGGCGG - Intergenic
938393162 2:130921021-130921043 TAGTGGGTAGGGCAGGGAGGAGG - Intronic
938536648 2:132253827-132253849 TAGGGGGTCTCGAGGGTAGGGGG - Intronic
939618394 2:144386919-144386941 GAGGGGGTGGGGGGGGCAGGGGG - Intergenic
939981330 2:148785325-148785347 TCGGGGGTGGGGCGGGCAGTGGG - Intronic
940194087 2:151073838-151073860 TTGGGGGTGTGGGGGGCAAGGGG - Intergenic
942076363 2:172360190-172360212 CAGGGTGTATGAAGGGCAGGGGG - Intergenic
944839137 2:203608646-203608668 GAGGGAGTATGGAGGGGAGGGGG - Intergenic
946146566 2:217735496-217735518 AGGGGAGAATGGCGGGCAGGAGG - Intronic
946174836 2:217916285-217916307 TGGGGGGTCTGGAGGGGAGGAGG - Intronic
946192033 2:218012636-218012658 TATGGGGTATGGGGGGTGGGGGG - Intergenic
947428994 2:230009232-230009254 TAGGAGGTAGGATGGGCAGGGGG + Intronic
949011935 2:241685554-241685576 TATGGGGTGTGGGGAGCAGGAGG + Intronic
1169141127 20:3228069-3228091 TGGGGAGGCTGGCGGGCAGGAGG - Intronic
1169424743 20:5487069-5487091 GAGGGGGAATGGCAGGGAGGAGG - Intergenic
1171035920 20:21712997-21713019 TGGAGGGAATGGAGGGCAGGAGG + Intronic
1172348482 20:34223151-34223173 TAGATGGGATGGCGGCCAGGAGG - Intronic
1172728821 20:37069361-37069383 TAGGTGGGATGGCGGCCGGGCGG - Intronic
1174673014 20:52325251-52325273 TGGGGAGTAGGGAGGGCAGGTGG + Intergenic
1175482394 20:59320822-59320844 TGGGGGTTGTGGAGGGCAGGGGG + Intronic
1176088747 20:63309726-63309748 TAGCGGGAGTGGGGGGCAGGTGG - Intronic
1177794588 21:25760500-25760522 TAGGGGGGACTGCAGGCAGGTGG - Intronic
1180162476 21:46004373-46004395 CAGGAGGGAGGGCGGGCAGGAGG - Exonic
1180187211 21:46145759-46145781 TTGGGGGGAGGGCGGGGAGGGGG - Intronic
1180312273 22:11250481-11250503 TAGGGGGTCTCGAGGGTAGGGGG - Intergenic
1181126401 22:20704285-20704307 CAGGGCGAAAGGCGGGCAGGTGG - Intergenic
1183556227 22:38529440-38529462 TAGGGAGTATGGCAAGGAGGAGG + Intronic
1183601205 22:38841516-38841538 CAGGGGCTATGGCAGGCACGAGG + Intronic
952230454 3:31424228-31424250 GAGGGGATATGGGGGGCAGTTGG + Intergenic
952243582 3:31561556-31561578 TTGGGGGTTTGGTGGGGAGGTGG - Intronic
953279206 3:41536435-41536457 TGGGGGGTGTGGAGGGCAGTTGG - Intronic
953428730 3:42818995-42819017 TGGGGGAAATGGGGGGCAGGTGG + Intronic
953867412 3:46596249-46596271 TGGGGTCTGTGGCGGGCAGGGGG + Intronic
955606123 3:60706240-60706262 TTGGGGGTTTGGGGGGCAAGGGG + Intronic
956694491 3:71906924-71906946 TAGGGGGAAAGGGGGGAAGGAGG + Intergenic
959575074 3:107925376-107925398 TAGGGGGTATGGTGGGCCAAAGG + Intergenic
968647958 4:1749348-1749370 GAGGGGGCATGGTGGGGAGGGGG - Intergenic
968742119 4:2336556-2336578 TAGGGAGTGGGGGGGGCAGGGGG - Intronic
969148665 4:5147172-5147194 TTGGGGGTACGGGGGACAGGGGG + Intronic
970215093 4:13750573-13750595 TGGGGGTTATGGCAGGCTGGGGG + Intergenic
973673241 4:53238833-53238855 TAGGTGGGATGGCGGCCGGGCGG + Intronic
974000460 4:56506328-56506350 TAAGGGCTAGGGTGGGCAGGGGG - Intronic
975916018 4:79326005-79326027 GAGGGCGGATGGCGGGAAGGCGG + Exonic
977205054 4:94157797-94157819 TAGGTGGGATGGCGGCCGGGTGG - Intergenic
978459425 4:108934331-108934353 TTGGGGGGATGGGGGGCTGGGGG + Intronic
981524162 4:145694239-145694261 TAGATGGGATGGCGGCCAGGCGG + Intronic
982528827 4:156511869-156511891 TTTGGGGTGTGGCGGGCAAGGGG + Intergenic
982814778 4:159871252-159871274 GAGAGGGTATGGAGAGCAGGAGG + Intergenic
985025702 4:185737318-185737340 CAGGGGGTGTGGAGAGCAGGTGG + Intronic
986360380 5:6972339-6972361 TAGGCCGTATGGCAGGCATGGGG + Intergenic
986739852 5:10696329-10696351 TAGGGGGTGTGGCGGGGGGGAGG + Intronic
987268068 5:16277332-16277354 TAGGTGGGATGGCGGCCGGGCGG + Intergenic
987920584 5:24274884-24274906 TAGGGGGCTGGGGGGGCAGGTGG + Intergenic
990249492 5:53898646-53898668 TCGGGGGTAGGGGGGGCAGCGGG - Intronic
990903331 5:60777104-60777126 TAGGGGGGTTGGGGGGGAGGTGG + Intronic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
996509015 5:124298352-124298374 CAGGGGGAATTGCAGGCAGGTGG + Intergenic
998093293 5:139383178-139383200 TGGGGGCTAGGGGGGGCAGGGGG - Intronic
998414876 5:141938791-141938813 TAGGGGCCAGAGCGGGCAGGAGG + Exonic
1000281987 5:159790071-159790093 TGGGGAGGAAGGCGGGCAGGTGG + Intergenic
1001109447 5:168883667-168883689 TTGGGGGGATGGGGGGCAGGGGG - Intronic
1001654830 5:173341259-173341281 CAGGGGAAATGGCAGGCAGGTGG + Intergenic
1004413145 6:15400289-15400311 TAAGGGGGAGGGCGGGCTGGAGG + Intronic
1008124238 6:47650564-47650586 AATGGGGTATGGAGGGGAGGAGG + Intergenic
1010280772 6:74020265-74020287 TAGAGGGCATGGGGGGCATGGGG + Intergenic
1010280785 6:74020475-74020497 TGGGGGGCATGGGGGGCATGGGG - Intergenic
1010513084 6:76744177-76744199 TAGGTGGGATGGCGGCCGGGCGG - Intergenic
1011914750 6:92489273-92489295 GTGGGGGCATGGGGGGCAGGTGG + Intergenic
1014709501 6:124789938-124789960 TTGGGGGTAGAGAGGGCAGGGGG + Intronic
1016155949 6:140808778-140808800 TAGGGGGAATGGCAGGCCAGAGG + Intergenic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1018038902 6:159904603-159904625 TAGGGGCCATGGCAGGAAGGAGG - Intergenic
1019642993 7:2114779-2114801 TTTGGGGTTTGCCGGGCAGGTGG - Intronic
1020005869 7:4783534-4783556 TTGGGAGTGTGGGGGGCAGGTGG + Intronic
1020256362 7:6504751-6504773 CAGGGGGTGTAGGGGGCAGGCGG - Intronic
1023040952 7:36172894-36172916 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
1023863211 7:44227414-44227436 GAGGGGGTGTGGGGGACAGGAGG + Intronic
1023863233 7:44227470-44227492 AAGGGGGTATGGGGGGCAGGGGG + Intronic
1025803735 7:64809930-64809952 TAGGTGGGATGGCGGCCGGGCGG + Intronic
1029159384 7:98540931-98540953 CAGGGAGTAGGGAGGGCAGGAGG + Intergenic
1029201430 7:98841863-98841885 CGGGGGGCATGGCGGGCAGAGGG - Intergenic
1029438608 7:100575547-100575569 CAGGGGGCATGCAGGGCAGGGGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1030507490 7:110443356-110443378 TAGGAGGGATGGCTGGAAGGTGG - Intergenic
1030705927 7:112692874-112692896 TGGGGAGTATGGGGGGGAGGTGG - Intergenic
1033591142 7:142809357-142809379 AAGGGAGTTTGGGGGGCAGGTGG - Intergenic
1034427411 7:151021333-151021355 TATGGGGTTGGGCGGGCAGTGGG + Intronic
1034612184 7:152380815-152380837 TAGCACGAATGGCGGGCAGGTGG + Intronic
1035282676 7:157787472-157787494 CAGTGGGCAGGGCGGGCAGGGGG + Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035695785 8:1594854-1594876 CAGGGGGCATGGCTGGCAGGAGG - Intronic
1036483037 8:9154359-9154381 TAGGTGGGATGGCGGCCGGGCGG + Intronic
1036637781 8:10563806-10563828 TAGGGGGTCGGGCGTGCAGAGGG - Intergenic
1044866254 8:96574030-96574052 GAGGGGGTGTGGAGGGGAGGGGG - Intronic
1045215512 8:100145421-100145443 GAGGAGCTATGGCGGGCGGGTGG + Exonic
1045496323 8:102712491-102712513 TAGTGGGGATGGTGGGCGGGGGG - Intergenic
1047190896 8:122678184-122678206 CAGGGCCTATGGCGGGCAAGTGG - Intergenic
1047266524 8:123314572-123314594 TAGGTGGGATGGCGGCCGGGCGG - Intergenic
1048975442 8:139670136-139670158 TAGGGGGAATGGCTGGTGGGTGG + Intronic
1048975964 8:139673195-139673217 TGGGGGGAATGGAGGGCCGGGGG + Intronic
1049217765 8:141415674-141415696 TAGGGGGCGTGGCGGGGAGAGGG + Intronic
1049393304 8:142382978-142383000 TGGGGGGAAAGGAGGGCAGGGGG + Intronic
1049578875 8:143401811-143401833 TGGGGGGGATGCCGGGAAGGGGG - Intergenic
1049582364 8:143418444-143418466 TAGGGGGTATGGGGGTGAGTGGG - Intergenic
1051459344 9:17294817-17294839 AAGGGGGGAGGGCGGGGAGGAGG + Intronic
1051459355 9:17294836-17294858 GAGGGGGGAGGGCGGGGAGGAGG + Intronic
1053503597 9:38621584-38621606 TAGCGGGTCGGGCGGGCCGGGGG + Intergenic
1053612512 9:39729192-39729214 TTGGGGGTCGGGGGGGCAGGGGG + Intergenic
1053870544 9:42487163-42487185 TTGGGGGTCGGGGGGGCAGGGGG + Intergenic
1054555135 9:66647725-66647747 TTGGGGGTCGGGGGGGCAGGGGG - Intergenic
1055134006 9:72806736-72806758 TAGGTGGGATGGCGGCCGGGCGG + Intronic
1055201451 9:73667385-73667407 TAGGAGGTAGGGTGGGGAGGGGG + Intergenic
1057555887 9:96087239-96087261 AAGGGGGCATGGCAGGCAAGGGG + Intergenic
1057749945 9:97784341-97784363 TAGTGGGAATGGCTGGAAGGCGG - Intergenic
1059309317 9:113377316-113377338 GCGGCGGTGTGGCGGGCAGGGGG - Intergenic
1060213344 9:121723762-121723784 CAGGGGGTAGGGCGGAGAGGAGG + Intronic
1061594794 9:131621810-131621832 TGGGGGGTAGGGCGGGCGGCGGG + Exonic
1062293072 9:135806189-135806211 TTGGGTGTATGGTGGGCACGCGG - Intergenic
1062326812 9:136016493-136016515 CAGGGAGCATGGAGGGCAGGCGG - Intronic
1062404541 9:136389020-136389042 TAAGGGGTATGGGGTGGAGGAGG + Intronic
1062607359 9:137354182-137354204 TGGGGCGTGTGGCTGGCAGGCGG - Intronic
1203752949 Un_GL000218v1:97259-97281 TTGGGCGCATCGCGGGCAGGAGG - Intergenic
1185473225 X:397634-397656 TGGAGGGTGTGGGGGGCAGGAGG - Intergenic
1185618073 X:1435327-1435349 CTGGGCCTATGGCGGGCAGGGGG + Intronic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1187964156 X:24594230-24594252 TGGGGGGGAAGGTGGGCAGGAGG + Intronic
1189178692 X:38982855-38982877 TAGGGGGTGTGGATGGAAGGAGG + Intergenic
1190288169 X:48974150-48974172 TAGGGGGTAGGAAGGGGAGGAGG + Exonic
1192127849 X:68518614-68518636 TAGGGGACAGGGAGGGCAGGTGG + Intronic
1192213666 X:69143217-69143239 TGGGGGGCATGGCGGGGAGGGGG + Intergenic
1192587209 X:72328566-72328588 TGGGGGCGATGGCGGGGAGGGGG - Intergenic
1193403687 X:81076915-81076937 CATGGGGTGTGGAGGGCAGGGGG + Intergenic
1193736168 X:85159504-85159526 TTGGGGGTAGGGCAGTCAGGTGG - Intergenic
1194872614 X:99151903-99151925 AAGGGGGTGTGGATGGCAGGGGG + Intergenic
1196765295 X:119236817-119236839 TAGGCGGGTAGGCGGGCAGGCGG + Intronic
1197199578 X:123736276-123736298 TAGGGGGGATGGGGGCCAGGGGG + Intergenic
1198155291 X:133954156-133954178 TAAGGGAGATGGTGGGCAGGAGG + Intronic
1198945273 X:142005203-142005225 AAAGGGGTATGGCGGGGAGGCGG - Intergenic
1199496524 X:148458539-148458561 TAAGGGGGATGGCTTGCAGGTGG - Intergenic
1199586373 X:149420651-149420673 TAGGTGGGATGGCGGCCGGGCGG - Intergenic
1200036301 X:153334052-153334074 AAGGGGGCGTGGCGGGAAGGGGG - Intergenic
1200060587 X:153482030-153482052 TAGGGGGTAAGGCCTGGAGGAGG + Intronic
1200249843 X:154547046-154547068 CAGCGGGTATGGCAGGCAGCCGG - Exonic