ID: 917439161

View in Genome Browser
Species Human (GRCh38)
Location 1:175051549-175051571
Sequence CTTCGATGATATCTGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917439161_917439169 19 Left 917439161 1:175051549-175051571 CCCTGGCCCAGATATCATCGAAG No data
Right 917439169 1:175051591-175051613 CCCTAGAGTTTCTAGAAGACAGG No data
917439161_917439165 -5 Left 917439161 1:175051549-175051571 CCCTGGCCCAGATATCATCGAAG No data
Right 917439165 1:175051567-175051589 CGAAGTCACCATGTCTACTGAGG No data
917439161_917439171 20 Left 917439161 1:175051549-175051571 CCCTGGCCCAGATATCATCGAAG No data
Right 917439171 1:175051592-175051614 CCTAGAGTTTCTAGAAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917439161 Original CRISPR CTTCGATGATATCTGGGCCA GGG (reversed) Intergenic
No off target data available for this crispr