ID: 917439165

View in Genome Browser
Species Human (GRCh38)
Location 1:175051567-175051589
Sequence CGAAGTCACCATGTCTACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917439161_917439165 -5 Left 917439161 1:175051549-175051571 CCCTGGCCCAGATATCATCGAAG No data
Right 917439165 1:175051567-175051589 CGAAGTCACCATGTCTACTGAGG No data
917439162_917439165 -6 Left 917439162 1:175051550-175051572 CCTGGCCCAGATATCATCGAAGT No data
Right 917439165 1:175051567-175051589 CGAAGTCACCATGTCTACTGAGG No data
917439158_917439165 14 Left 917439158 1:175051530-175051552 CCACCGTTACTCTCTGTGACCCT No data
Right 917439165 1:175051567-175051589 CGAAGTCACCATGTCTACTGAGG No data
917439155_917439165 21 Left 917439155 1:175051523-175051545 CCCCATTCCACCGTTACTCTCTG No data
Right 917439165 1:175051567-175051589 CGAAGTCACCATGTCTACTGAGG No data
917439157_917439165 19 Left 917439157 1:175051525-175051547 CCATTCCACCGTTACTCTCTGTG No data
Right 917439165 1:175051567-175051589 CGAAGTCACCATGTCTACTGAGG No data
917439156_917439165 20 Left 917439156 1:175051524-175051546 CCCATTCCACCGTTACTCTCTGT No data
Right 917439165 1:175051567-175051589 CGAAGTCACCATGTCTACTGAGG No data
917439160_917439165 11 Left 917439160 1:175051533-175051555 CCGTTACTCTCTGTGACCCTGGC No data
Right 917439165 1:175051567-175051589 CGAAGTCACCATGTCTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917439165 Original CRISPR CGAAGTCACCATGTCTACTG AGG Intergenic
No off target data available for this crispr