ID: 917439169

View in Genome Browser
Species Human (GRCh38)
Location 1:175051591-175051613
Sequence CCCTAGAGTTTCTAGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917439163_917439169 13 Left 917439163 1:175051555-175051577 CCCAGATATCATCGAAGTCACCA No data
Right 917439169 1:175051591-175051613 CCCTAGAGTTTCTAGAAGACAGG No data
917439166_917439169 -7 Left 917439166 1:175051575-175051597 CCATGTCTACTGAGGCCCCTAGA No data
Right 917439169 1:175051591-175051613 CCCTAGAGTTTCTAGAAGACAGG No data
917439161_917439169 19 Left 917439161 1:175051549-175051571 CCCTGGCCCAGATATCATCGAAG No data
Right 917439169 1:175051591-175051613 CCCTAGAGTTTCTAGAAGACAGG No data
917439162_917439169 18 Left 917439162 1:175051550-175051572 CCTGGCCCAGATATCATCGAAGT No data
Right 917439169 1:175051591-175051613 CCCTAGAGTTTCTAGAAGACAGG No data
917439164_917439169 12 Left 917439164 1:175051556-175051578 CCAGATATCATCGAAGTCACCAT No data
Right 917439169 1:175051591-175051613 CCCTAGAGTTTCTAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917439169 Original CRISPR CCCTAGAGTTTCTAGAAGAC AGG Intergenic
No off target data available for this crispr