ID: 917440867

View in Genome Browser
Species Human (GRCh38)
Location 1:175067733-175067755
Sequence TAGCAGAGTCCCTGCTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917440865_917440867 15 Left 917440865 1:175067695-175067717 CCTAGTTAGAATAAGAGAAGGAA 0: 1
1: 1
2: 1
3: 31
4: 366
Right 917440867 1:175067733-175067755 TAGCAGAGTCCCTGCTAGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917440867 Original CRISPR TAGCAGAGTCCCTGCTAGGA AGG Intergenic
903787418 1:25870511-25870533 CAGCAGAGGCCTGGCTAGGAAGG - Intronic
903858489 1:26351246-26351268 GGGCAGAGTCCCAGCGAGGAGGG - Intronic
904785776 1:32981663-32981685 TAGCACAGTGCCTGGTAGGAAGG - Intergenic
906667860 1:47634187-47634209 AATCAGAGTCCCTGCTCTGAGGG + Intergenic
906732927 1:48098711-48098733 AAGCAGAGTCCCTGCTCTCAAGG - Intergenic
908457605 1:64319548-64319570 TGGCAGAGCCCCTGCTGGAAGGG - Intergenic
908972300 1:69851527-69851549 TAGAAGAGTCCCTGCTTCTACGG - Intronic
909615686 1:77605899-77605921 TAGCACATTCCCAGCTATGATGG + Intronic
912138589 1:106693339-106693361 TAGCAGTGTTCCTGCAAAGAGGG - Intergenic
912262086 1:108120694-108120716 TAGCAGAGCCTTTGCTAGGCGGG - Intergenic
915895111 1:159806080-159806102 AAGCAGAGTCCCTGCTACTATGG + Intronic
916069768 1:161163035-161163057 TAGCAGAGCCCCTCCTCGGCGGG - Exonic
917440867 1:175067733-175067755 TAGCAGAGTCCCTGCTAGGAAGG + Intergenic
918837835 1:189490675-189490697 TAGCAGACTCACTTATAGGATGG - Intergenic
920714300 1:208325111-208325133 TGGCAGAGTTCCTGCTAAAATGG - Intergenic
924218363 1:241848332-241848354 GAGGAGAGTCCCTTCTCGGAAGG + Exonic
1069774327 10:70918024-70918046 CAGCAGAGTCAGGGCTAGGACGG - Intergenic
1069796135 10:71053135-71053157 TAGGAGAGGCCCTGGGAGGAAGG + Intergenic
1070373833 10:75810097-75810119 GAGCAGAGTCTCTGGCAGGAAGG + Intronic
1070388688 10:75950044-75950066 TAGAAGAGTCCTTGCCAAGACGG + Intronic
1070771698 10:79086024-79086046 AAGGAGAGTCCCAGCTAGAAGGG - Intronic
1070776171 10:79111177-79111199 CAGTAAAGCCCCTGCTAGGATGG - Intronic
1075064632 10:119281244-119281266 GTGCAGAGTCCCTGAGAGGAAGG - Intronic
1075957305 10:126535097-126535119 TATCAGAATCCCTGCTACCAGGG - Intronic
1077541191 11:3147246-3147268 TGGCAGAGGCCCTGGGAGGAGGG + Intronic
1079385514 11:19975812-19975834 TAGCAAAGTCACTGCTAAGGTGG + Intronic
1082800989 11:57414779-57414801 TGGGAGAGTCCCTGCCTGGAAGG - Intronic
1083048165 11:59755067-59755089 TAGCCGACTCCTTGCTAGGCGGG - Exonic
1083741676 11:64714533-64714555 TGCCTGAGTCCCTGCTTGGATGG - Intronic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1084557819 11:69885385-69885407 GAGCAGAGTCCTTGCTAAGTAGG - Intergenic
1088822901 11:113471619-113471641 AAGCAGAGTACCTGGTAGGATGG + Intronic
1088899814 11:114106929-114106951 TAGCCCAGTCCCTGCTAGATGGG + Intronic
1089201169 11:116725610-116725632 GGGCAGAGTCCTTGCTAGGGAGG + Intergenic
1090070169 11:123537154-123537176 TAGCAGAGTGCCTGCTGTCATGG + Intronic
1091397078 12:160545-160567 CAGCAGAGTCCCGGCTTGGCTGG + Intronic
1091399972 12:175647-175669 AAGCAGAGGCCCTGGGAGGAGGG - Exonic
1097197200 12:57249577-57249599 TTGCCGAGTCTCTGCTGGGAAGG + Exonic
1097546740 12:61012071-61012093 TGCCAGAGTTCCTTCTAGGATGG + Intergenic
1099006002 12:77235380-77235402 CAGCAGCGTCCCTGACAGGAAGG - Intergenic
1100809625 12:98325310-98325332 CAGCAGAGGCCCTGCTACTAGGG + Intergenic
1103590236 12:121987019-121987041 AAGCAGGGTCCCAGCTGGGATGG + Intronic
1104390838 12:128389521-128389543 AAGCAGAGTTCCTGCTAGCATGG - Intronic
1113763664 13:112867525-112867547 CTGCAGAGACCCTGCCAGGAAGG - Intronic
1115640567 14:35333162-35333184 TCACAGAGTCCCTCCCAGGAAGG - Intergenic
1117969103 14:61234860-61234882 TGGCAGATTCCCTGATGGGATGG - Intronic
1118779089 14:68994319-68994341 TCACTGAGTCCCTGCTTGGAAGG - Intergenic
1120957422 14:90094941-90094963 TAGAAAAGTCCCTGATAGGCTGG - Intronic
1121525316 14:94615422-94615444 TAGCAGCACCCCTGCAAGGAGGG - Intronic
1121525893 14:94619083-94619105 AAGCAGGGTCCCTCCTATGAGGG + Intronic
1121737052 14:96225912-96225934 TGGCACAGGCCCTGCTAGGGTGG - Intronic
1121987906 14:98526426-98526448 TAGCACAGTCCCTCCCATGAAGG + Intergenic
1124023836 15:25946459-25946481 TAGGAGCGCCCCTTCTAGGAGGG + Intergenic
1128088026 15:64899079-64899101 CAGCAGAGCCCCAGCTGGGAAGG + Intronic
1130082230 15:80743705-80743727 TAGTAGCGTCCCTGCTACTAGGG - Intronic
1130093229 15:80838286-80838308 CAGCAGGGTCCCTGCCAGGAAGG - Intronic
1135829807 16:25763139-25763161 TAGCAGGCTGCCTGCTAAGAAGG + Intronic
1139425424 16:66876836-66876858 TATCACACTCCCTGCTAAGATGG + Intergenic
1140280900 16:73554779-73554801 GAGCAGAGTCCCTGGGAGGCTGG - Intergenic
1141459578 16:84170072-84170094 TAGCAGGGTCTCAGCTGGGAGGG - Exonic
1141459619 16:84170228-84170250 TAGCAGGGTCTCAGCTGGGAGGG - Exonic
1142292865 16:89200884-89200906 AGGCAGAGTCTCTGCTTGGAGGG - Intronic
1144379821 17:14683578-14683600 TTGCAGAGTCCTGGCTAGGCTGG - Intergenic
1145001300 17:19306742-19306764 TACCAGCTTCCCTGCCAGGATGG + Intronic
1147419615 17:40315971-40315993 CATCAGAGTCCCTGGTGGGAGGG + Intronic
1148536375 17:48442475-48442497 TAGCAGAGTCCCAGGCAGGATGG - Intergenic
1151481037 17:74370198-74370220 TTTCAGAGCCCCTGCTAGGCCGG + Intronic
1154312428 18:13277579-13277601 TAGCAGTGACACTGCTGGGATGG - Intronic
1156511241 18:37638456-37638478 CAGCTCAGTCCCTCCTAGGATGG - Intergenic
1158440306 18:57469215-57469237 TCGCAGCTTCCCTCCTAGGAAGG - Intronic
1160069145 18:75609945-75609967 CAGCAGGGTCCCAGCTGGGAGGG + Intergenic
1160915345 19:1493748-1493770 TAACACAGTCCCAGCAAGGAGGG - Intronic
1162705442 19:12551517-12551539 TTGCAGAGTTCCTGATTGGATGG + Exonic
1163793014 19:19319323-19319345 ATGCAGAGGCCCTGGTAGGATGG - Intronic
1164428297 19:28164634-28164656 TAGCAGAATCCCTGCATGGTTGG + Intergenic
1164778002 19:30869355-30869377 TAGAGGAGTCCCTGCTGGGAGGG + Intergenic
926311314 2:11678049-11678071 TAGCAGAGTGCCTGATGGGCTGG - Intronic
928122686 2:28594617-28594639 GAGCAGAGTCCCAGAGAGGATGG + Intronic
928199639 2:29239444-29239466 GTGCTGAGTTCCTGCTAGGATGG + Intronic
930836552 2:55799907-55799929 AAGCATAGTACCTGATAGGAAGG - Intergenic
933797939 2:85936437-85936459 AAGAAGGGTCCCTGTTAGGAAGG + Intergenic
935329929 2:101969478-101969500 AAACAGAGTCCCTACTACGAGGG - Intergenic
939240813 2:139557664-139557686 TAGCAGAAACCCTGCTATGCAGG - Intergenic
939620584 2:144414235-144414257 TAGCAGAGTACAAGCTAGGATGG - Intronic
941099773 2:161282637-161282659 CAGCAGTGTCACTGCCAGGAAGG - Intergenic
941408053 2:165116854-165116876 TAGTAGAGTACCTCCTAGGTTGG + Intronic
944423611 2:199557005-199557027 CAGCAGAGACCCTGCAGGGATGG - Intergenic
944949650 2:204732968-204732990 TAGCAGAGTGCCTGCCATGATGG + Intronic
1171234961 20:23517454-23517476 TAGGAAAGACCCAGCTAGGAAGG - Intergenic
1171249295 20:23636460-23636482 CAGCTGAGTCCCTGCTGGGGTGG - Intronic
1171255770 20:23688216-23688238 TGGCTGAGTCCCTGCTGGGGTGG - Intronic
1171272199 20:23826012-23826034 CAGCTGAGTCCCTGCTGGGGTGG - Intronic
1171816397 20:29789311-29789333 TAGCAGAGCCCCTGAGAGAAGGG + Intergenic
1173728779 20:45314332-45314354 TAGCAGACAGCCGGCTAGGAGGG + Intronic
1174699023 20:52589243-52589265 TAGCAGAAGCCCTGCTAGGCAGG + Intergenic
1177933980 21:27319124-27319146 AAGCAGAGTCCCTACTTGGTGGG + Intergenic
1180618087 22:17141525-17141547 TGGCAGAGTCCCAGCCAGCAAGG - Intronic
1180855731 22:19043632-19043654 TAGCAGGGTCCCTGCTGGTGTGG - Intronic
1181298940 22:21865944-21865966 TAGCACAGTACCTGCCACGAAGG + Intronic
1183175053 22:36217410-36217432 CACCAGAGTCCCTGCTGGGGAGG + Intergenic
1184314120 22:43670081-43670103 TAGCAGAGAGCCTGGTAGAAAGG - Intronic
949877131 3:8633779-8633801 CTGCAGAGTCCCTGCGATGACGG - Exonic
950435382 3:12976271-12976293 TGGCAGAGTCCCTCCTGGGGCGG - Intronic
951757194 3:26103864-26103886 TAGCAGAATCCCAGACAGGATGG - Intergenic
952148259 3:30557650-30557672 AATCAGAGATCCTGCTAGGAAGG + Intergenic
952654590 3:35769850-35769872 TAGCAGAGTCATTGCTTGGAAGG + Intronic
953746756 3:45580406-45580428 TAGCAAAGGCTCTGCTAGGCTGG + Intronic
958611341 3:96430725-96430747 TAGCAGATTCACTGGTGGGAAGG + Intergenic
962630511 3:137270911-137270933 TAGCAGTGTTAATGCTAGGATGG - Intergenic
963369477 3:144379938-144379960 TAGCACAGTTCCTGATAGGTGGG - Intergenic
964548054 3:157856934-157856956 TAGCAGAGACCCTGGGAAGAAGG + Intergenic
967548401 3:190760019-190760041 TAGGAGAGTCACTACTAAGAAGG - Intergenic
968833091 4:2943220-2943242 CAGCAGAGTCCCTTCCAAGAGGG - Intronic
970664421 4:18320341-18320363 AAGCAGAGTCCCTTTAAGGAAGG - Intergenic
970900158 4:21149656-21149678 TCCCAGAATCCCTGTTAGGAAGG + Intronic
971309000 4:25507671-25507693 TGGCAGCGTCCCTGGTAGGCTGG + Intergenic
975660168 4:76680627-76680649 TAGGATAGTCCCTGCTATAAAGG - Intronic
976382154 4:84411909-84411931 TTGCAGAGTCCCTCATAGCATGG + Intergenic
978337552 4:107685892-107685914 TATCACATTCCCTGCTGGGAAGG + Intronic
980889427 4:138798331-138798353 TAGCACAGTCCCTCCTGTGAAGG + Intergenic
982952115 4:161712416-161712438 TAACAGAGTCACTACTGGGAGGG - Intronic
985816117 5:2129487-2129509 GAACAAAGTCCCTGCTCGGAGGG - Intergenic
989043229 5:37249707-37249729 GTGCAGGGTCCCCGCTAGGAAGG - Intergenic
997314347 5:132919879-132919901 GAGCAGAGTCCCAGCTATGCAGG + Intronic
998584788 5:143416094-143416116 GATCAGGGTCCCTGGTAGGATGG - Intronic
1000813776 5:165894302-165894324 TGGCAAAGTCCCTCCTAAGAGGG - Intergenic
1004312470 6:14557484-14557506 TGGGAGCGTCCCTGCTGGGAAGG + Intergenic
1006535752 6:34697219-34697241 TGGCAGACTCCTTGCTGGGAGGG - Intergenic
1010483891 6:76386209-76386231 TGGCAGAGCCACTGCAAGGATGG + Intergenic
1015838604 6:137450820-137450842 AGGCAGAGTCCCTTATAGGAAGG - Intergenic
1023248826 7:38235688-38235710 AAGGAGAGCCCCTGGTAGGATGG + Intergenic
1026849361 7:73715490-73715512 TAGCAGTCTCCATGCTAGGGAGG - Intronic
1029359620 7:100079118-100079140 TTGAAGGGACCCTGCTAGGAGGG - Exonic
1030301226 7:107976716-107976738 TCACAGAGTCCATGCTGGGAAGG - Intronic
1032100722 7:128974646-128974668 GAGCTGAGTTCCTGCCAGGAAGG - Intronic
1035020895 7:155799665-155799687 CAGCAGAGTGCCTGCCAGGGAGG - Intergenic
1039340086 8:36638216-36638238 TAGTACAGTTGCTGCTAGGACGG + Intergenic
1046317936 8:112531258-112531280 TAGCAGATTTCCTTCTAGCATGG - Intronic
1047517165 8:125565038-125565060 TGGCAGAGGCCCTGCTATGGAGG + Intergenic
1048006967 8:130427300-130427322 GAGCTGAGTCCCTGGGAGGAAGG - Intronic
1048605522 8:135964440-135964462 TAGCACAGTCCCTGCCCTGAAGG + Intergenic
1051806953 9:21005446-21005468 TAGCAGTGTTCCTGCTGGGGTGG - Exonic
1052038846 9:23715105-23715127 TAGTAGAGTCCCTACTTGGTGGG - Intronic
1053200178 9:36146946-36146968 CCGCAGAGTCCCCACTAGGACGG - Intronic
1053430124 9:38036620-38036642 TAGCAGAGCTCCTGCTAGGCGGG - Intronic
1056580226 9:87884683-87884705 CATCAGAGGCCCTGGTAGGAAGG - Intronic
1057508729 9:95659906-95659928 TAGCAATTTCCTTGCTAGGAAGG - Intergenic
1057852767 9:98577947-98577969 TTGCAGAGTCCCTCCAAGGCTGG - Exonic
1060448366 9:123713298-123713320 AAGCAGAGTCCCTTCAAGTAGGG + Intronic
1061780897 9:132995494-132995516 ACCCAGAGGCCCTGCTAGGACGG - Intergenic
1062050237 9:134443344-134443366 TCGCAGAGGCCCTGCGAGGAAGG + Intergenic
1062502401 9:136857153-136857175 GCGCAGAGTCCCTGCAGGGAGGG - Exonic
1203568001 Un_KI270744v1:108186-108208 CAGCAGTGTCACTGCCAGGAAGG + Intergenic
1188885672 X:35546626-35546648 GAGCAGTGGCCATGCTAGGAGGG - Intergenic
1189172724 X:38925208-38925230 AACCAGAATCCCTGCTATGATGG + Intergenic
1189480893 X:41391526-41391548 TAGCAGGGACCCTGCCAGTAAGG - Intergenic
1190426912 X:50342077-50342099 TAGCAGAGTCCCAGCTAGTCAGG + Intronic
1192549865 X:72045296-72045318 TAGCAGAGTCCCAGCAATGAGGG + Intergenic
1194342524 X:92722251-92722273 TGGCAGATTCCCTGGTGGGAAGG + Intergenic
1197969635 X:132101522-132101544 AAGCAAAGTCCCTGCTATGGAGG - Intronic
1198106205 X:133463731-133463753 AAGCATGGTCCCTGATAGGAAGG + Intergenic
1198115556 X:133541763-133541785 TAGCAGAGTCCCTAGGAGGCTGG + Intronic
1200650886 Y:5838940-5838962 TGGCAGATTCCCTGGTGGGAAGG + Intergenic