ID: 917454508

View in Genome Browser
Species Human (GRCh38)
Location 1:175174477-175174499
Sequence CTCATTTCTCAGATGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 0, 2: 12, 3: 99, 4: 578}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917454508_917454511 -6 Left 917454508 1:175174477-175174499 CCTTTCCTCATCTGAGAAATGAG 0: 1
1: 0
2: 12
3: 99
4: 578
Right 917454511 1:175174494-175174516 AATGAGGTTATTACTCATCCTGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917454508 Original CRISPR CTCATTTCTCAGATGAGGAA AGG (reversed) Intronic
901094138 1:6664771-6664793 CTCATTTTACAGAAGAGAAAAGG + Intronic
901566441 1:10119714-10119736 TTCATTTTACAGGTGAGGAAGGG - Intronic
902228464 1:15012110-15012132 CTCATTTGTAAAACGAGGAATGG - Intronic
902419324 1:16265566-16265588 CTCATTTTACAGATGAATAATGG + Intronic
902667723 1:17951343-17951365 TCCATTTTACAGATGAGGAAAGG - Intergenic
903422203 1:23226042-23226064 CTCATTTCGCAGATGAGCAGGGG - Intergenic
903812955 1:26045244-26045266 CTCAGCTCTGAGATGAGGTAAGG + Intronic
903882650 1:26522059-26522081 CTCATCCCTCATCTGAGGAATGG - Intergenic
904455942 1:30648105-30648127 CCCATTTCCCAGATGGAGAACGG + Intergenic
904809070 1:33151530-33151552 CTGACTTCTCAGAGGGGGAAGGG - Intronic
905860366 1:41346552-41346574 CTCATTTCACAGATGAAAAGAGG + Intergenic
906061188 1:42949770-42949792 CTCATTTCTCATCTGTGAAAAGG - Intronic
906530600 1:46521583-46521605 CTCAGTTGCCTGATGAGGAATGG - Intergenic
906541459 1:46589674-46589696 CTCATAGAGCAGATGAGGAAGGG + Intronic
906840872 1:49137897-49137919 CTAATTCCTCAGTTGAGGGAGGG + Intronic
907126142 1:52052864-52052886 CCCATTTTGCAGATGAGGAACGG + Intronic
907574047 1:55509900-55509922 CCCATTTTACAGGTGAGGAAAGG + Intergenic
907579241 1:55556981-55557003 CTCATTTCTCAGTGTGGGAAGGG - Intergenic
907940018 1:59078504-59078526 CTCATTTTACAAATGAGGAATGG - Intergenic
908048103 1:60194545-60194567 CTCACTTTCCAGATGAAGAATGG + Intergenic
908206987 1:61860521-61860543 CTCATCTGTAAGATGAGGATTGG + Intronic
908439348 1:64137962-64137984 CTCATTTCACAGATGAAGAAGGG - Intronic
908536205 1:65080039-65080061 CTCATTTTACAGTTGAAGAAAGG - Intergenic
908647997 1:66300479-66300501 CTCATTTCACATGTGAGGGAGGG + Intronic
908897897 1:68921702-68921724 CTCAGCTCTCAAATGTGGAAAGG + Intergenic
909478300 1:76107356-76107378 CTCATTTCACTGAGAAGGAATGG + Intronic
909868814 1:80711893-80711915 ATAATTACTCAGATGTGGAATGG - Intergenic
910567301 1:88658714-88658736 CATATGTCTCAGATGAGGAAAGG + Intergenic
911011567 1:93286748-93286770 CTCATATCAGAGAAGAGGAAAGG + Intergenic
911247757 1:95537560-95537582 GTTAATTCTCAAATGAGGAACGG + Intergenic
912200177 1:107448358-107448380 CCCATTTAACAGATGATGAATGG + Intronic
912482034 1:109990247-109990269 CCCATTTTACAGATGAGAAAAGG - Intronic
912523893 1:110266575-110266597 CTCATTTTGCTAATGAGGAAAGG + Intronic
912699910 1:111869706-111869728 CTGCTTTCACAGATGAGGAAGGG + Intronic
913002386 1:114593847-114593869 TTCATTTTACAGATGAGAAAAGG - Intronic
913699663 1:121362214-121362236 CTCCTTTCACAGATGATAAAAGG - Intronic
914137881 1:144917822-144917844 CTCCTTTCACAGATGATAAAAGG + Intronic
914674027 1:149893912-149893934 CTCATTTGTAACATGAGGATTGG - Intronic
916351830 1:163859044-163859066 CCCATTTCACAGATAAGAAAAGG + Intergenic
916397345 1:164405496-164405518 TTTATTTCTGAGATGAGGTAAGG + Intergenic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
916833020 1:168512507-168512529 TCCATTTTACAGATGAGGAAGGG + Intergenic
917454508 1:175174477-175174499 CTCATTTCTCAGATGAGGAAAGG - Intronic
918345249 1:183602150-183602172 CTCATTTTTCTTATGTGGAAAGG + Intergenic
918971747 1:191428523-191428545 TTCATTTCTCAGAAGCAGAAAGG + Intergenic
919009124 1:191936890-191936912 TGCATTTCTCTGATGAGCAATGG - Intergenic
920154260 1:203935592-203935614 CTCATTTCTCAGATCTGCAAGGG - Intergenic
920487071 1:206380923-206380945 CTCCTTTCACAGATGATAAAAGG - Intronic
920977892 1:210803055-210803077 CTCATTTCACAGATCTGGGATGG + Intronic
921803336 1:219426918-219426940 CTTATTTCACAAATGAAGAAAGG + Intergenic
922579084 1:226683744-226683766 CCATTTTCTCAGATGAAGAAAGG - Intronic
922888134 1:229036317-229036339 CACACTTCCCAGATGAGGACTGG - Intergenic
923279442 1:232428726-232428748 CTCATTTCACAAATGTGAAATGG - Intronic
924931999 1:248740222-248740244 CTCTGTTCTCAGTTCAGGAAGGG + Intronic
1063031185 10:2237058-2237080 TTCATCCCTCAGAGGAGGAAAGG - Intergenic
1063430928 10:5987574-5987596 TCCATTTTACAGATGAGGAAAGG - Intergenic
1064714089 10:18157597-18157619 CCCGTTTCACAGATGAGAAATGG + Intronic
1065054084 10:21825848-21825870 CTCAGTTCAAAGATGAGCAAAGG - Intronic
1065196986 10:23276203-23276225 CTCTTTTCTCTGAGGAGGGAAGG + Intronic
1065737979 10:28771623-28771645 CTCACATCTCAGATGATGGACGG - Intergenic
1066366449 10:34781452-34781474 CTCCTTTCACAGATGAGGCTTGG + Intronic
1066474143 10:35728242-35728264 CACATTTCTGACATGGGGAATGG + Intergenic
1067189659 10:44058790-44058812 TTCAGATCTCAGATGGGGAAGGG + Intergenic
1067451903 10:46386883-46386905 CTCACTTCCCAGATGAGTCAGGG + Intronic
1067585335 10:47472872-47472894 CTCACTTCCCAGATGAGTCAGGG - Intronic
1067900316 10:50233413-50233435 CTCATTTATCAGCTAAGGAAAGG + Intronic
1068660968 10:59622958-59622980 CTCACTTGTCAGATGAGGAACGG + Intergenic
1069191542 10:65497057-65497079 CTCATTTTTCAAGTGAGTAAAGG - Intergenic
1069434020 10:68364011-68364033 CTCATTTCTAAGATGAGATAAGG + Exonic
1069503062 10:68971592-68971614 CTCATCACACAAATGAGGAAAGG + Intronic
1069832927 10:71291918-71291940 CCCATCTCACAGATGGGGAAAGG + Intronic
1070658574 10:78288713-78288735 CCCATTTTACAGATGGGGAAGGG - Intergenic
1070780755 10:79136195-79136217 CTCATTTTACAGATAAGAAAAGG - Intronic
1070789924 10:79182920-79182942 CTCACTGCTCAGATGGTGAAGGG - Intronic
1071071149 10:81696025-81696047 CTGATTTCTCACATGGTGAAAGG + Intergenic
1071261490 10:83923449-83923471 TTCATTTCACAGATACGGAATGG - Intergenic
1071262866 10:83936763-83936785 CTCATTACACAGATGAGGGAAGG + Intergenic
1071383782 10:85099231-85099253 CTCCCTTCACAGATGAGGATAGG + Intergenic
1071735893 10:88300175-88300197 CTCATCTATGTGATGAGGAAGGG + Intronic
1071928211 10:90435987-90436009 CTCATTTTTTCGATGAGGAAGGG + Intergenic
1072956699 10:99893065-99893087 GTCATTTCTTATATTAGGAATGG - Intronic
1073322941 10:102626611-102626633 CTCATTTTACAGATGACAAAGGG - Intronic
1073468027 10:103705540-103705562 CCCATTTTACAGATGAGAAATGG + Intronic
1073688659 10:105783762-105783784 CTCATTTCTCAAATAAGAAAGGG + Intergenic
1074072288 10:110084614-110084636 CTCATTTCTCATATGGAGAAAGG - Intronic
1074156307 10:110802930-110802952 CTCAGTTTACAGATCAGGAAAGG + Intronic
1074333335 10:112542727-112542749 CTCATCTTTAAAATGAGGAAAGG - Intronic
1074749391 10:116569327-116569349 CTCCCTTCTCAGTTGAAGAATGG + Intergenic
1075551271 10:123394500-123394522 CTCGTTCCCCAGATGAGGCAGGG - Intergenic
1075945004 10:126425231-126425253 TTCTTTTCTCTGGTGAGGAATGG + Exonic
1076357047 10:129860861-129860883 CTCAATTTTCAGATGATGAATGG + Intronic
1076615088 10:131749773-131749795 CTGATTGCTCTGATGAGGAGGGG - Intergenic
1076880996 10:133239201-133239223 CTAATTTCTAAGTTAAGGAATGG - Intronic
1077359361 11:2133896-2133918 CTCCTTCCTCAGATGAAAAATGG + Intronic
1077455656 11:2677925-2677947 TTCATTTCATAGATGAGAAATGG + Intronic
1078402979 11:11044494-11044516 CTCATTTTACAGTTGAGGGAAGG - Intergenic
1078427383 11:11262896-11262918 CCCATTTTATAGATGAGGAAAGG - Intergenic
1078543840 11:12232000-12232022 CTCATTTTTCAGACAAGCAAAGG - Intronic
1079425051 11:20332492-20332514 CCCATTTTACAGAAGAGGAAGGG - Intergenic
1079655065 11:22976464-22976486 CCCATTTCTCACATTTGGAATGG + Intergenic
1080207710 11:29750085-29750107 CCCATTTCTGAGATCAGGTAAGG - Intergenic
1080224477 11:29945057-29945079 TACATTTCTCAGATTAGGTAAGG + Intergenic
1080965069 11:37204936-37204958 TGCATTTCTCAGATGATCAATGG + Intergenic
1081658968 11:44876220-44876242 CTCATTCCCCAGATGAACAAAGG + Intronic
1081659695 11:44880417-44880439 CTCATTTTACAGATGAGGAGAGG - Intronic
1082112487 11:48292664-48292686 CCCCTTTCTTTGATGAGGAAAGG - Intergenic
1082669637 11:56018467-56018489 CCCATATTTTAGATGAGGAAAGG + Intergenic
1082959056 11:58901717-58901739 CCCATTTCACAGATTAGGACAGG - Intronic
1082974570 11:59059301-59059323 CCCATTTCACAGATTAGGACAGG - Intergenic
1082978988 11:59103098-59103120 CCCATTTCACAGATCAGGACAGG - Intergenic
1083607519 11:63987525-63987547 CCCATTTTACAGTTGAGGAAAGG + Intronic
1083831364 11:65236031-65236053 CTTATTTTACAGATGAGGACAGG + Intergenic
1084521688 11:69666974-69666996 CTCATTTTACAGAGGAGGGAGGG - Exonic
1084553587 11:69863314-69863336 CCCATTTCACAGATAAGAAAGGG + Intergenic
1085906626 11:80772184-80772206 CTCATTGCTGAGATGAGGAAAGG - Intergenic
1088349421 11:108868231-108868253 TCCATTTTTCAGATGAGGAAAGG + Intronic
1089340396 11:117753472-117753494 CTCAATTTTCAAATGAGAAAAGG + Intronic
1089523977 11:119084774-119084796 CTCATGTCACAGCTGGGGAATGG + Intergenic
1091341913 11:134822706-134822728 CTCACTTTATAGATGAGGAAAGG + Intergenic
1091380424 12:54636-54658 CCCAGTTCACAGATGAGGATAGG + Intergenic
1091627795 12:2136342-2136364 CCCATTTTAAAGATGAGGAAGGG + Intronic
1091660476 12:2379595-2379617 CTCATTTTACTGGTGAGGAAGGG + Intronic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092757712 12:11779211-11779233 ATCATTTCTAAAATGATGAAAGG - Intronic
1092962001 12:13605237-13605259 CTAATTTCCCAGATGAGCTAGGG + Intronic
1092962005 12:13605266-13605288 CTAATTTCCCAGATGAGCTAGGG + Intronic
1093435923 12:19134927-19134949 TTTCTTTCTCAGATGAAGAAAGG + Intronic
1093883226 12:24429484-24429506 AACATTTCTCAGATGTGGATGGG + Intergenic
1094051036 12:26220918-26220940 ATCATTTCTCAGGTGAAGAATGG + Intronic
1094504570 12:31050785-31050807 CTCATGACACAGATGAAGAAAGG - Intergenic
1094635522 12:32223596-32223618 CTCATTTCTGACATGAAGAAAGG - Intronic
1095248673 12:39953033-39953055 CTAATTTCTCATCTGAGAAAGGG - Intronic
1095373716 12:41501194-41501216 CTTATTTCTCATAAGAGGCATGG + Intronic
1096427548 12:51516936-51516958 CTCATCTCTAAGATGGGAAAAGG + Intergenic
1096536079 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG + Intronic
1096603168 12:52745013-52745035 CTCATTTCTCAGACAGGGATTGG - Intergenic
1097682301 12:62660058-62660080 ATAATTTCTGTGATGAGGAAAGG - Intronic
1097780683 12:63700385-63700407 CTTATTTTACAGATGAGAAAAGG - Intergenic
1097963696 12:65557108-65557130 CTCATTTCTTAAACTAGGAATGG + Intergenic
1097973462 12:65659930-65659952 CTACTTTCTGAGATAAGGAAAGG + Intergenic
1098580701 12:72095483-72095505 CTCATCTCTAAGGTGAGGAGGGG - Intronic
1099146463 12:79051664-79051686 TTCATTACCCAGATGAGAAAAGG - Intronic
1099548241 12:84011683-84011705 CTCCTTTCTTAGACTAGGAAAGG + Intergenic
1099691708 12:85962567-85962589 CACATTTGTCAAATAAGGAATGG + Exonic
1100226839 12:92566095-92566117 CTCATTTTACAGACGAGAAACGG - Intergenic
1101652907 12:106693976-106693998 CCCATTTCACAGAAGGGGAACGG + Intronic
1101878374 12:108610051-108610073 CCCATTTCCTAGGTGAGGAAGGG + Intergenic
1102917623 12:116766443-116766465 CCCATTTTACAGATGAGGAAAGG + Intronic
1103149131 12:118621836-118621858 CCCATTTTACAGATGAGGAAAGG - Intergenic
1103242023 12:119421637-119421659 CCCATTTCACAGATGGGGATTGG + Intronic
1105831006 13:24162740-24162762 CCCATTTGACAGATGAGAAAAGG + Intronic
1106590088 13:31091494-31091516 CTCACTTCACAGATGAGGGTTGG - Intergenic
1107431381 13:40343594-40343616 CTCATTTTGGGGATGAGGAAAGG + Intergenic
1107875167 13:44783867-44783889 CTAATTTATTAGATGAGGAAAGG - Intergenic
1108168846 13:47720611-47720633 CCCATTTTACAGAGGAGGAAAGG - Intergenic
1108420982 13:50249226-50249248 TTGATTTTACAGATGAGGAATGG + Intronic
1108446293 13:50512139-50512161 CTCTTTTCTCAGCTGAAGACTGG - Intronic
1108505970 13:51112714-51112736 ATCAATTCACAGATGAAGAAGGG + Intergenic
1108666285 13:52634831-52634853 CTCATTTTACAGTTGGGGAAAGG - Intergenic
1108984452 13:56567343-56567365 TTCATTTCTCAGATGATTTAGGG + Intergenic
1109844552 13:67969763-67969785 CTCATTCCCCAGACCAGGAAAGG + Intergenic
1110182750 13:72636819-72636841 CTCATTTTACACATGAGGACTGG + Intergenic
1110293099 13:73830203-73830225 CTCATTTGTTAGATGATAAATGG + Intronic
1110310534 13:74044254-74044276 CCCATTTTACAGATGAGGAATGG - Intronic
1110681645 13:78320531-78320553 CACATTTCTCTCATGTGGAATGG - Intergenic
1112220273 13:97482440-97482462 CTCATTTCTTTAATGAGAAAGGG - Intergenic
1112740103 13:102463213-102463235 CTCATTTATAAAATGAGCAAAGG + Intergenic
1112812497 13:103234524-103234546 CTCATTTCTCCCATTTGGAATGG + Intergenic
1112815584 13:103268911-103268933 CTCATTTCTCCCATTTGGAATGG + Intergenic
1113062101 13:106333082-106333104 CACATTTCCAAGATGAGGAGTGG + Intergenic
1113156251 13:107326278-107326300 CTCATTTATCAGAAGGAGAATGG - Intronic
1113552102 13:111200543-111200565 CTCCCTTCCCAGGTGAGGAACGG + Intronic
1113684763 13:112275277-112275299 CCCGTTTCTCAGAGGAGGGACGG - Intergenic
1115036432 14:28862681-28862703 CTAATTTCTGAAATAAGGAATGG - Intergenic
1115109595 14:29805645-29805667 TGCATTTTTCAGATGTGGAAAGG + Intronic
1115161679 14:30403449-30403471 CTCATTTTAAAGAAGAGGAAAGG - Intergenic
1116449003 14:45043797-45043819 CTTATTTTTCAGATGAGTTAAGG + Intronic
1116540242 14:46093428-46093450 GTCCTTTCTAAGAGGAGGAAAGG - Intergenic
1116626217 14:47267517-47267539 CTAATTTCTCAGGTCACGAATGG + Intronic
1117331239 14:54713932-54713954 CTCATTTTATAGATGAGGAAAGG - Intronic
1118894064 14:69931257-69931279 CTCATGGCTGAGACGAGGAAAGG - Intronic
1119178647 14:72588573-72588595 CTCATTACTCAGAAGGGGGAAGG - Intergenic
1119612300 14:76073868-76073890 CTCTCTTATCAGATGAGAAACGG - Intronic
1119630691 14:76229357-76229379 CTCACATATCAGATGAGGAATGG - Intronic
1119747228 14:77052977-77052999 ACCACTTCTCAGAAGAGGAATGG - Intergenic
1119921191 14:78447822-78447844 CCCATTTCACAGATGAAGAAAGG - Intronic
1120513643 14:85445095-85445117 CTCATTTCTCAGAGTAGGTGAGG - Intergenic
1120845673 14:89122816-89122838 CCCATTTTTCAGAGGAGGACAGG + Intergenic
1121379917 14:93455962-93455984 CTCATTGTTGAGATGAGGCAAGG + Intronic
1121548435 14:94780030-94780052 CCCATTTTACAGATGAGAAAAGG - Intergenic
1121563982 14:94894980-94895002 CTCAACTCATAGATGAGGAAGGG - Intergenic
1122105243 14:99448197-99448219 CTCATTTTTCAAATGGGGAATGG - Intronic
1122171926 14:99883718-99883740 CTCATTTAGCAAATGAAGAAGGG - Intronic
1122829054 14:104386810-104386832 CCCATTTTCCAGAGGAGGAAGGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124956396 15:34363307-34363329 CTCAGTCCTCAGATGAAGAAGGG + Intronic
1125170228 15:36758446-36758468 CTCATTCATAAGATGAGGAAAGG + Intronic
1125415273 15:39445896-39445918 TTCATTTTATAGATGAGGAAAGG - Intergenic
1126105550 15:45144756-45144778 CTCCTTTTACAGAAGAGGAAAGG - Intronic
1127572848 15:60261249-60261271 CTCATACTGCAGATGAGGAAAGG - Intergenic
1128869127 15:71138981-71139003 CCCATTTTACAGATGAAGAAAGG + Intronic
1129236748 15:74228318-74228340 CTCATTTTACAGATGAGGAAAGG - Intergenic
1129573792 15:76718812-76718834 TTCATTTCTCTGATGATTAATGG - Intronic
1130154890 15:81341764-81341786 CTCTTTTCACAGCTGAGCAAAGG + Intronic
1130759782 15:86806619-86806641 CCCATTTTACAGATTAGGAAGGG - Intronic
1130801047 15:87263629-87263651 TTCATCACTCAAATGAGGAAGGG - Intergenic
1131421073 15:92305842-92305864 CTCATTTTCCGGATGAGGAAGGG - Intergenic
1131692924 15:94845752-94845774 TTCATTTTCTAGATGAGGAAAGG + Intergenic
1131698006 15:94901277-94901299 CTCATTTTGCAGATGAGAGAAGG + Intergenic
1132057659 15:98664342-98664364 TCCATTTTACAGATGAGGAAAGG - Intronic
1132096062 15:98985749-98985771 CCCATTTTGCAGATGAGGAAAGG - Intronic
1132163519 15:99564879-99564901 CCCATTTTACAGATGAGGAAAGG - Intergenic
1132355308 15:101167406-101167428 CTCAGTTTACAGATGAGGACTGG - Intergenic
1133604819 16:7376406-7376428 CCCATTTCACAGATGAGCACTGG + Intronic
1133921754 16:10159627-10159649 CCCATTTTACAGATGAGGAAAGG + Intronic
1134095597 16:11416441-11416463 CCCATTCTGCAGATGAGGAATGG - Intronic
1134186671 16:12090173-12090195 CTCATTTCACAAATGAGGACAGG - Exonic
1134222389 16:12365259-12365281 TTCACTTCGCAGATGAAGAATGG - Intronic
1134381745 16:13733714-13733736 CTCATTTTTCAGGTGATGAACGG + Intergenic
1134749026 16:16611116-16611138 CCATTTTTTCAGATGAGGAAAGG - Intergenic
1134776408 16:16857417-16857439 CTTGTTTTTCAGATGAGGCAGGG + Intergenic
1134996439 16:18742520-18742542 CCATTTTTTCAGATGAGGAAAGG + Intergenic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1135991733 16:27222686-27222708 GTCCCTTGTCAGATGAGGAATGG + Intergenic
1136629611 16:31482164-31482186 CTCATTTCTCAGCACAGGACTGG - Intergenic
1137250297 16:46736385-46736407 CCCATGTCTGAGGTGAGGAAGGG + Intronic
1137544951 16:49396298-49396320 CTCATATCTCAGAACAGGTACGG + Intronic
1137586531 16:49667145-49667167 CTTATTTTTTGGATGAGGAAGGG - Intronic
1137605936 16:49786776-49786798 CTCATCTGTCAAATGAGGATGGG + Intronic
1137614210 16:49837326-49837348 TTCATTTGCCAGTTGAGGAAAGG - Intronic
1138457439 16:57129450-57129472 CTGCTTACTGAGATGAGGAACGG + Intronic
1139078658 16:63486611-63486633 TTTATTTCTCAAATAAGGAATGG + Intergenic
1140458133 16:75116316-75116338 CCCATTTTACAGATGAGAAATGG + Intronic
1140909317 16:79437599-79437621 CTCATTTTACAGCTGAGGAAAGG + Intergenic
1141135767 16:81464170-81464192 CGCATTTCACAGGTGAGAAAAGG + Intronic
1141143715 16:81514508-81514530 CCCATTTTGCAGATGAAGAATGG - Intronic
1141169890 16:81684659-81684681 CCCATTTCACAGATGAGAAACGG - Intronic
1141521774 16:84585104-84585126 CTCATTTGTAAAATGAAGAATGG - Intronic
1141522521 16:84590483-84590505 CCCATTTCACAGATGGGAAATGG + Intronic
1141533255 16:84661305-84661327 CCCATTTCCCAGATGGGGCAAGG + Intronic
1141552760 16:84817196-84817218 TTCATTTCACAGATGGGGCATGG + Intergenic
1141881885 16:86865722-86865744 CTAATTCCACAGATGAGGAAAGG - Intergenic
1142421832 16:89975631-89975653 CTACTTTCTCAGATGGGCAATGG + Intergenic
1143349507 17:6277112-6277134 TCCATTTTACAGATGAGGAAAGG - Intergenic
1143874859 17:9983976-9983998 CTCATTTTACATAGGAGGAAAGG - Intronic
1143923750 17:10351480-10351502 ATCATTTCCCAAATGAGAAAGGG + Intronic
1144260050 17:13509772-13509794 TTCATTTCACAGATGTTGAAAGG + Intronic
1144394229 17:14827969-14827991 CTCCTTTAACAGAAGAGGAAAGG - Intergenic
1144754530 17:17671168-17671190 CCCATTTTACAGATGAGGAGAGG - Intergenic
1145063665 17:19747842-19747864 TGCATTTTACAGATGAGGAAAGG + Intronic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1146176900 17:30670938-30670960 CTCATTTTATAAATGAGGAAAGG - Intergenic
1146636331 17:34508253-34508275 CTCTTTTCTTTTATGAGGAATGG - Intergenic
1146923604 17:36729543-36729565 CCCATTTCACAGATGGGAAAGGG - Intergenic
1146924548 17:36735332-36735354 CCAATTTCTCAGGGGAGGAATGG - Intergenic
1148127109 17:45242560-45242582 GCCATTTCACAGATGAGGAGGGG + Intronic
1148474078 17:47915766-47915788 CTGATTGCTCAACTGAGGAAAGG - Intronic
1149489611 17:57074113-57074135 CTCAGTTCACAGATGAGACAAGG + Intergenic
1149530525 17:57391403-57391425 CTGGTTTCTCAGATGAGGTTGGG - Intronic
1149649690 17:58269071-58269093 CTCATTTCTGTGATGAGGAGAGG - Intergenic
1150012411 17:61517302-61517324 CCCATTTTACAGATGAGAAATGG + Intergenic
1150226102 17:63525256-63525278 TTCATTTCATAGATGTGGAAGGG + Intronic
1150333015 17:64309540-64309562 CTCATTTCATTGATGAAGAAAGG + Intergenic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1151088022 17:71403543-71403565 CTGATTTCTAAGATGAGTCAAGG - Intergenic
1151486467 17:74404149-74404171 CTATTTTCTCAGATGTGGGAGGG - Intergenic
1152049889 17:77965139-77965161 CCCATTTTACAGATGAGCAAAGG + Intergenic
1153982809 18:10326239-10326261 CTCACTTCTCATATTAGGAGAGG - Intergenic
1154260262 18:12825431-12825453 TCCATTTTACAGATGAGGAAGGG + Intronic
1155417774 18:25618812-25618834 CCCATTTTACAGATGAGAAAAGG + Intergenic
1155723902 18:29054747-29054769 TTCATTTCTCATAAGTGGAATGG - Intergenic
1156349962 18:36295650-36295672 CTAATTTCTGAGTCGAGGAAAGG + Intergenic
1157676663 18:49573644-49573666 CTCATTACTCATATGAGAACTGG - Intronic
1158231448 18:55260338-55260360 CTCATTGTGTAGATGAGGAAAGG - Intronic
1158325643 18:56311535-56311557 CCCATTTCACAGATGAAGAAAGG + Intergenic
1158427580 18:57353273-57353295 CCCATTTCTGAAATGAGGGAAGG - Intronic
1158545966 18:58397094-58397116 GTAATTTCTCGGATGAGAAATGG - Intronic
1160104851 18:75964306-75964328 CTCATTTCTCCCTTGAGAAAAGG - Intergenic
1160105726 18:75973991-75974013 CCCATTTTACAGATGAGGAAAGG - Intergenic
1161337495 19:3722246-3722268 CCCATTTTTCGGATGAGGGAAGG - Intronic
1161497920 19:4597706-4597728 TTTGTTGCTCAGATGAGGAAGGG + Intergenic
1161764944 19:6202149-6202171 CCCATTTTTCAGATCAGGAAAGG + Intergenic
1162209587 19:9080732-9080754 CTCATTTCACAGGGGAGGGAGGG + Intergenic
1162272563 19:9628277-9628299 TTCTTTTCTCAGGGGAGGAAAGG + Intronic
1162981919 19:14245972-14245994 CTCATTTTATAAATGAGGAAAGG + Intergenic
1164016796 19:21261048-21261070 CTCACTTCCCAGATGATGGACGG + Intronic
1164744916 19:30604758-30604780 CTTATTTTTCACATGAAGAACGG + Intronic
1165226243 19:34357314-34357336 CCCATTTCTCAGATGGGCCAAGG - Intergenic
1165602699 19:37070605-37070627 GGCATTTCACAGAAGAGGAAGGG + Intronic
1166164660 19:40978872-40978894 CTCATTTTACAGATGAGAAACGG + Intergenic
1166939511 19:46354215-46354237 CTCATTTCACGGATATGGAAAGG - Intronic
1167170540 19:47828351-47828373 CTCATCCCTCACATGAGGAGGGG - Intronic
1167309989 19:48731532-48731554 CTCATTTATCAAATGAAGACAGG + Intronic
1167646640 19:50709466-50709488 CTCCTTTCTCAGCTGTGAAATGG - Intronic
1167718027 19:51156741-51156763 CTCACTTCTCAGATTAGAAATGG - Intergenic
1167765871 19:51481895-51481917 CCCACTTCTCAGATTAGAAATGG + Intronic
1168496993 19:56861598-56861620 CCTATTTTACAGATGAGGAAGGG + Intergenic
925141088 2:1550329-1550351 CGCATTTCACAGCTAAGGAATGG + Intergenic
926272689 2:11378577-11378599 CTCAGTCCTCTGATGAGGGAGGG + Intergenic
926535709 2:14108813-14108835 CTCATTTTTCAGAGGACAAATGG + Intergenic
929040846 2:37743042-37743064 CCCATTTTACAGATGAGGATAGG - Intergenic
929588013 2:43128088-43128110 CCCATTTGACAGATGAGGAAAGG + Intergenic
929802119 2:45112980-45113002 CTGGCTTCTCACATGAGGAAGGG + Intergenic
930698710 2:54438188-54438210 ATCATTTTACAGATGAGCAAAGG + Intergenic
930867076 2:56132647-56132669 CTCATGTTACAGATGAGAAACGG + Intergenic
931189876 2:59989972-59989994 CTCATTTCCCTAATGAAGAAAGG + Intergenic
931434739 2:62236473-62236495 CTCATCTGTTACATGAGGAAGGG - Intergenic
931502299 2:62882573-62882595 CTAATTTCTCTGTAGAGGAAAGG + Intronic
931745149 2:65285433-65285455 CCCATTTCACAGAAAAGGAACGG - Intergenic
931915092 2:66945573-66945595 CCCTTATCACAGATGAGGAATGG + Intergenic
932192942 2:69756376-69756398 TTCATTTTACAGTTGAGGAAAGG - Intronic
932478141 2:72021725-72021747 CTCCTTTCTTTGATTAGGAAAGG + Intergenic
933270998 2:80232718-80232740 TTCAGGTCTCACATGAGGAATGG + Intronic
933665982 2:84965416-84965438 CTCATTGTTCAAATGAGAAATGG - Intergenic
933772409 2:85752919-85752941 CTCGTTTTACAGGTGAGGAAAGG + Intronic
933829366 2:86194710-86194732 CTCATTTCTGAGATTAGGGCAGG - Intronic
935558743 2:104539087-104539109 CTAATTTCTCACCTTAGGAAAGG - Intergenic
937249945 2:120517279-120517301 CCCATTTCACAGATGGGGGAAGG + Intergenic
937324786 2:120984077-120984099 CTGATTTCTCTGATGAAGAAAGG - Intronic
937345636 2:121123716-121123738 CCCATTTCACAGATGAGAGAGGG + Intergenic
937430448 2:121833487-121833509 TTCATTGCACAGATGAGGCACGG + Intergenic
937815288 2:126244315-126244337 CCCATTTCTAAGGTGAGGATGGG - Intergenic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
937906718 2:127056074-127056096 CCCATTTAACAGGTGAGGAAAGG - Intronic
938656959 2:133444160-133444182 CTCTTTTCTCACCTGAAGAATGG - Intronic
939413773 2:141865765-141865787 TTAATTTCTCAGATGATGACTGG + Intronic
939600731 2:144186902-144186924 GTCATTTTGCAGCTGAGGAAAGG - Intronic
939639080 2:144617601-144617623 CCCTTTTTACAGATGAGGAAAGG + Intergenic
939809869 2:146818024-146818046 CACTTTTCTCAGAAGAGGTATGG + Intergenic
940977872 2:159966626-159966648 CTCATTTCTCAAATTAACAATGG + Intronic
941382601 2:164814207-164814229 CCGATTTATCAGATGGGGAAGGG - Intronic
941525422 2:166600799-166600821 TTCATTTCTCTGATGACCAATGG - Intergenic
941902490 2:170691715-170691737 CTCATTAAACAGATGATGAATGG - Intergenic
943028679 2:182660168-182660190 CTCATTTCTTAGATAAGGCTGGG - Intergenic
943031808 2:182694476-182694498 ATCATTTCTCAGATGAGAGTAGG - Intergenic
943417422 2:187625859-187625881 CTCATTTTTCAGATAGGAAATGG + Intergenic
943562706 2:189482984-189483006 CTCACTTCACTGATGAGGAAAGG - Intergenic
943765827 2:191661111-191661133 CACATTCCACAGATGAGAAAAGG - Intergenic
944808958 2:203309213-203309235 CCAATTTCTCACATGTGGAATGG + Intergenic
944870693 2:203908862-203908884 CCCATTTCACAGATGAAGACTGG - Intergenic
944872532 2:203928950-203928972 CTCATCTCTCAGACCAAGAAGGG - Intergenic
945976162 2:216272624-216272646 CATATTTAACAGATGAGGAAAGG - Intronic
946055389 2:216896462-216896484 CCCATTTTACAGATAAGGAAAGG + Intergenic
946253081 2:218425388-218425410 GTTATTTCTGAGATGAGGCAAGG + Intronic
946455805 2:219825115-219825137 TTCATTTTTCAAAGGAGGAATGG + Intergenic
948131664 2:235605328-235605350 CCCATTTTACCGATGAGGAAAGG + Intronic
948424610 2:237879035-237879057 CTCATTTTTCAGCTTAGAAAAGG - Intronic
948674886 2:239591425-239591447 CCCATTTATCGGATGAAGAAAGG - Intergenic
1168840321 20:905901-905923 ACCATTTTACAGATGAGGAAAGG + Intronic
1169125727 20:3125488-3125510 CTCACTTCTCAGATGATGGGCGG - Intronic
1169150249 20:3283798-3283820 CTCATTTCTTAGGGGAGCAAAGG + Intronic
1169248658 20:4044007-4044029 CGCATTTTAGAGATGAGGAAGGG - Intergenic
1169607279 20:7336643-7336665 CTCATTTCACAGGTAATGAAAGG + Intergenic
1169872430 20:10262385-10262407 GTCATTTGTCACAGGAGGAAGGG - Intronic
1170073992 20:12399099-12399121 CCCATTTGACAGATGAAGAAAGG - Intergenic
1170118773 20:12890212-12890234 TTCATTTCCCTGATGAGTAATGG - Intergenic
1170441693 20:16385868-16385890 CCCATTTCACACATGAGAAATGG + Intronic
1170516708 20:17137597-17137619 CTCATTTCAGAGATGAGGACAGG - Intergenic
1171138216 20:22717437-22717459 CTAATTTCTAATATCAGGAATGG - Intergenic
1171149432 20:22814227-22814249 CTCATTTTACAGGTGAGGACAGG + Intergenic
1172002169 20:31787793-31787815 CGCATTTCTCAGGTGAGCCAAGG + Intronic
1172818872 20:37713953-37713975 TCCATTTTGCAGATGAGGAAAGG + Intronic
1172882133 20:38208960-38208982 TCCATTTCACAGATGGGGAAAGG + Intergenic
1173036378 20:39414972-39414994 TTCATTTCTCAGATAAGGATTGG - Intergenic
1174104682 20:48153785-48153807 CACATAGCTCTGATGAGGAAAGG - Intergenic
1174222683 20:48969837-48969859 CCCATTTTTCAGATGAGGCTTGG - Intronic
1174300711 20:49580211-49580233 CGCATTTTACAGATGAGGAATGG + Intergenic
1174511004 20:51052500-51052522 CCCTTTTTACAGATGAGGAAAGG + Intergenic
1174693123 20:52529413-52529435 CTCATCTGTCAGATGAGCAGTGG + Intergenic
1175015298 20:55783617-55783639 TTGTTTTTTCAGATGAGGAAAGG - Intergenic
1175316136 20:58048012-58048034 CTCTTTTTGCAGAAGAGGAAAGG + Intergenic
1175538917 20:59736140-59736162 CTCAGTCCTCAGATGATGGATGG - Intronic
1175585527 20:60136441-60136463 CCCATTTTGCAGATGAAGAATGG + Intergenic
1175588978 20:60172056-60172078 CTCACTTCACACATGAGAAATGG - Intergenic
1175881214 20:62260352-62260374 GGCATTTCTTAGATGGGGAAAGG - Intronic
1177918097 21:27116042-27116064 CTCATTTTATAGAAGAGGAAAGG - Intergenic
1179535378 21:42048153-42048175 CTAAATTCTCAGATGCGCAATGG - Intergenic
1179719602 21:43307665-43307687 CTCATGTCTTAGTTGAGGAAGGG + Intergenic
1179909759 21:44441566-44441588 CCCATTTCACAGAGGAGTAAAGG + Intronic
1179928034 21:44549196-44549218 GTCTTTTCTCAAATAAGGAAAGG + Intronic
1181034034 22:20161447-20161469 CCCATTTCCCAGGTGAGGACAGG + Intergenic
1181328515 22:22070259-22070281 CTCATTGCTCAGGTGAGAACTGG + Intergenic
1181468823 22:23125673-23125695 CCCATTTTACAGATGAGGAAAGG + Intronic
1181869256 22:25885236-25885258 CCCATCTCACAGATGAGGCAAGG + Intronic
1181980904 22:26765629-26765651 CCCATTTTGCAGATGAGGATTGG + Intergenic
1182241433 22:28919424-28919446 CTCATTGAATAGATGAGGAAAGG + Intronic
1182622234 22:31624434-31624456 GTAATTTAGCAGATGAGGAAAGG - Intronic
1182722625 22:32415583-32415605 CCCATTTTACAGATGAGGAAAGG - Intronic
1182834263 22:33328900-33328922 CACATTTCACAGATAAGGAAAGG - Intronic
1182882266 22:33743730-33743752 CCCATTTTACAGATGATGAAAGG + Intronic
1183099927 22:35577722-35577744 CTCATTTGTCAAATGAGGATAGG + Intergenic
1183208593 22:36435852-36435874 CTAATTTGACAGACGAGGAAAGG - Intergenic
1183305610 22:37081540-37081562 CTCGTTTCACAGACAAGGAAGGG + Intronic
1183528556 22:38339042-38339064 TTCATGTTACAGATGAGGAAAGG + Intronic
1183602995 22:38850839-38850861 CCCATTTTACAGATGAGGAAAGG - Intergenic
1183712140 22:39511276-39511298 CTTCATTCTCAGATGAGCAATGG + Exonic
1183950459 22:41349659-41349681 CCCATTTCCCAGATGAGCACTGG - Intronic
1184301609 22:43564046-43564068 CCCATTTCTCAGATGGAGGACGG - Intronic
1184349895 22:43936656-43936678 CTGATTTCTCAGCTGAAAAATGG + Intronic
1184388308 22:44188637-44188659 CCCATTTCACAGATGAGGAAAGG + Intronic
1184404798 22:44293695-44293717 CCCATTTTACAGATGAGGAAGGG - Intronic
1184813649 22:46854261-46854283 CCCATTTTACAAATGAGGAAAGG - Intronic
1185270593 22:49927893-49927915 CTTCATTCCCAGATGAGGAACGG - Intergenic
1203293112 22_KI270736v1_random:14620-14642 CCCATTTTACAGATGAGGATAGG - Intergenic
950018133 3:9768502-9768524 CCCATTTATCAGATGAAGAATGG + Intronic
950494887 3:13327841-13327863 CCCATTTTTCAGAGGAGGAAAGG - Intronic
950708931 3:14801658-14801680 CTCATCTTACAGATGAGGAGAGG + Intergenic
950812879 3:15666408-15666430 ACCATTTAACAGATGAGGAAAGG - Intergenic
951037739 3:17952042-17952064 CTAATTTCTCACATTTGGAATGG + Intronic
951698511 3:25470495-25470517 AGCATTTTCCAGATGAGGAAGGG + Intronic
951901083 3:27658271-27658293 CTCCTTTTCCAGATGAGGAAAGG + Intergenic
951973464 3:28475444-28475466 CTCATTGCTTTGATGAGGAAAGG - Intronic
952186359 3:30973707-30973729 CTCACTTCTCAGGTGAGATATGG - Intergenic
952993073 3:38849181-38849203 CTCTTTTCTCATCAGAGGAAGGG + Intronic
953242476 3:41161862-41161884 CTCAATTCTGGGATGAGGTAGGG + Intergenic
953357879 3:42269754-42269776 CTCTTGTCTCAGAAAAGGAATGG + Intergenic
953682861 3:45052639-45052661 CTCATCTCCCAGGGGAGGAAGGG - Intergenic
954519693 3:51213695-51213717 CTCATTTCTCATATTTGGGATGG + Intronic
954581973 3:51707797-51707819 CTCTTTCCTCAGAACAGGAAAGG - Intronic
954908838 3:54086529-54086551 CTCATTTCTCACATTTGAAAAGG + Intergenic
955636500 3:61035915-61035937 TTCATTTCTCTGATGTGAAAGGG + Intronic
955655055 3:61236603-61236625 CTCACTTTACAGATGTGGAAAGG + Intronic
955758346 3:62250221-62250243 CCCATTTTACAGATGAGGAAAGG + Intronic
956011113 3:64832501-64832523 CTCATTACTGAAATGAGGGAAGG + Intergenic
956215340 3:66843023-66843045 CTCATTTCTTTGACTAGGAAAGG - Intergenic
956702710 3:71972798-71972820 CTCATTTGACAGTTGACGAAAGG + Intergenic
958139773 3:89547438-89547460 TTCATTTTCCAGATGAGGAATGG - Intergenic
958816457 3:98921688-98921710 CTTATTTCACAGATGAGGAATGG + Intergenic
959202857 3:103271089-103271111 CCCATTTCTCCCATTAGGAATGG - Intergenic
959992019 3:112640507-112640529 CTCAGCTCTCAGATCAGGACAGG - Exonic
960424520 3:117489811-117489833 CTCATTTTTAAAATGAGAAATGG + Intergenic
960477582 3:118147521-118147543 TTCATTTCTATGATGAGTAATGG + Intergenic
961616268 3:128183829-128183851 CTCCTTACACAGATAAGGAATGG - Intronic
962025532 3:131543130-131543152 TTCATTTCTCAAATGAGGGGTGG + Intronic
962104748 3:132379177-132379199 CTCATATCACAGACGTGGAAGGG - Intergenic
962127807 3:132640696-132640718 CCCATTTTGCAGATGAAGAAAGG - Intronic
962282931 3:134065894-134065916 CCCACTTCACAGATGAGGAAAGG + Intronic
963061246 3:141228999-141229021 CTCATTTATCATATGAATAACGG + Intronic
963278304 3:143355448-143355470 CCCATTTTTCAGATGAGCGATGG + Intronic
963719841 3:148849792-148849814 CTCATTTTCCAGCTGAGGCATGG + Intronic
964230345 3:154459291-154459313 CTCGTTTCTCAGATTAATAAAGG - Intergenic
964290822 3:155178379-155178401 CTCTTTTCTGGAATGAGGAAAGG + Intronic
964303989 3:155321117-155321139 CCCATTTTACAGATAAGGAAGGG + Intergenic
964525688 3:157613566-157613588 ATCATTGCGCAGACGAGGAAAGG + Intronic
964667698 3:159192020-159192042 GTCACTTCTCTGAGGAGGAAAGG - Intronic
965329035 3:167346636-167346658 CTAACTTCTCAAATTAGGAATGG + Intronic
965366656 3:167809056-167809078 CTCATTTCTCTTATGTGGACAGG - Intronic
965522880 3:169685935-169685957 CTCATTTTACTGATTAGGAAAGG + Intergenic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
966820249 3:183918455-183918477 CACATTTTGCTGATGAGGAAAGG - Intergenic
967287493 3:187887645-187887667 GTCATCTCTCACCTGAGGAAGGG - Intergenic
967493253 3:190117217-190117239 CTTGGTTCACAGATGAGGAAAGG - Intronic
967750437 3:193108821-193108843 CTCATTTCTCAGAAAATAAAAGG - Intergenic
969702626 4:8776109-8776131 CACACGTGTCAGATGAGGAACGG + Intergenic
970449161 4:16149874-16149896 TTCATTTTTCAGAGCAGGAAAGG - Intergenic
970468696 4:16353474-16353496 GTCATTGCTGAGATGAGGCATGG - Intergenic
970920333 4:21386695-21386717 TTCATTCCTCAGGTGAGGGAGGG + Intronic
971200715 4:24507336-24507358 CTCACTTCACTGCTGAGGAAGGG + Intergenic
971307816 4:25498834-25498856 CCTATTTTACAGATGAGGAATGG - Intergenic
971451732 4:26807205-26807227 CTCACTTCTAAGTTGAGGATGGG - Intergenic
971669273 4:29534937-29534959 TTTATTTTACAGATGAGGAAAGG + Intergenic
972707962 4:41564186-41564208 CCCATTTTACAGATGAGGAAAGG + Intronic
972887225 4:43507615-43507637 CTCACATGGCAGATGAGGAAAGG - Intergenic
973061598 4:45733144-45733166 CTGATTTCTAGAATGAGGAAGGG - Intergenic
973222750 4:47747471-47747493 CTCAGTTCAGAAATGAGGAAAGG - Intronic
973347046 4:49068067-49068089 CCCCTTTCTTTGATGAGGAAAGG - Intergenic
973530600 4:51833714-51833736 CCCCTTTCACAGGTGAGGAAAGG - Intergenic
973650934 4:52996542-52996564 TTTATTTCTCAGAAGGGGAAGGG - Intronic
973716947 4:53686189-53686211 CTCCTGTCTTAGAAGAGGAATGG - Intronic
973819265 4:54648444-54648466 CCCATTTTACAGATAAGGAAAGG - Intergenic
975283263 4:72587698-72587720 ATTATTTTACAGATGAGGAAAGG + Intergenic
976596866 4:86903158-86903180 CACATTTCTTCCATGAGGAAAGG + Intronic
977175245 4:93811966-93811988 TTCAATTCTCAGATGAGAACTGG - Intergenic
977799928 4:101215438-101215460 CTCATTTCTAATATTAGAAAAGG + Intronic
977889793 4:102296581-102296603 CTCATTTAACAGATGAGCAAAGG + Intronic
979885442 4:126022319-126022341 CTTACTTCTCAAATGAGGGATGG + Intergenic
980167592 4:129247935-129247957 ATCCTTTCTCTGATGAGGGATGG + Intergenic
980370256 4:131860580-131860602 TCCATTTCTAAAATGAGGAATGG + Intergenic
982479286 4:155889602-155889624 CTCACTTCACAGATGGGAAACGG - Intronic
983322236 4:166210364-166210386 ATCTATTCTCAGATGAGGAATGG - Intergenic
986245473 5:6002948-6002970 CTCAGTTCTCAAATGGTGAACGG - Intergenic
989183271 5:38598991-38599013 TGGATTTCTCAGTTGAGGAATGG + Intronic
989291273 5:39769311-39769333 CTGATTTCCCTGCTGAGGAAGGG - Intergenic
989991690 5:50774544-50774566 CTCATTTCCCAGATGATGGGCGG + Intronic
990519892 5:56569044-56569066 TTCATTTATCAGATGGGCAAAGG + Intronic
990539126 5:56754803-56754825 CCTATTTTACAGATGAGGAAAGG + Intergenic
990718657 5:58668214-58668236 CACTTTTCTCTGAAGAGGAAAGG - Intronic
990797998 5:59565828-59565850 CTCAATTCTCATATGAGGGGAGG - Intronic
991079909 5:62587686-62587708 CTCATTGTTCAAATGAGAAATGG + Intronic
991169345 5:63603149-63603171 CTCATTATTCAGAGAAGGAAAGG + Intergenic
991294730 5:65068684-65068706 GTCATTACCCAGCTGAGGAAGGG + Intergenic
991318115 5:65335224-65335246 CTCATTTTACATTTGAGGAAAGG + Intronic
991455991 5:66805147-66805169 CTCATTTTTCAAAGGAGTAAAGG + Intronic
991709402 5:69393194-69393216 CTCATTTATCAGAATATGAACGG + Exonic
992134762 5:73733343-73733365 TTCCATTTTCAGATGAGGAAAGG + Intronic
992446230 5:76836721-76836743 CTCATTTCTCACCTGACAAACGG - Intergenic
992739016 5:79754435-79754457 CCCATTTGACAGGTGAGGAAAGG + Intronic
993490936 5:88548132-88548154 CACTTTTCACAGATGATGAAGGG + Intergenic
993585744 5:89725493-89725515 CATATTTCTCAGTTGAGGCAGGG - Intergenic
994833868 5:104822969-104822991 ATTGTTTCTCATATGAGGAAGGG + Intergenic
995012807 5:107276704-107276726 CTCACTTCTGAGATGATGATTGG - Intergenic
995613757 5:113938882-113938904 TTCCTTTGTCATATGAGGAAAGG + Intergenic
995640064 5:114245747-114245769 TTCCTTTCACAGTTGAGGAAAGG + Intergenic
995816356 5:116172784-116172806 TTACTATCTCAGATGAGGAAAGG - Intronic
997360924 5:133294366-133294388 CCCATTTTACAGAAGAGGAACGG - Intronic
998933354 5:147206007-147206029 CTCATTTGTCAGATGAGGTTTGG - Intergenic
999051528 5:148529030-148529052 TCCATTTCACAGATGAGGAAAGG + Intronic
999182472 5:149679855-149679877 CCCATTTTACTGATGAGGAAAGG + Intergenic
999301010 5:150490357-150490379 CCCATTTCACAGATGAGAAATGG - Intronic
999858427 5:155620001-155620023 CTCAGTTCTCAGCTCAGGAGTGG + Intergenic
1000157993 5:158570736-158570758 CTCATATCTCAGATGTGTGATGG + Intergenic
1000703791 5:164486426-164486448 CCCATTTAACAGATGAGCAATGG + Intergenic
1002415511 5:179118967-179118989 CTCATTTCTCAGTAAAGGAGTGG + Intronic
1003060574 6:2859326-2859348 TTCCTTTCACAAATGAGGAATGG - Intergenic
1003562460 6:7193441-7193463 CCCATTTTGCAAATGAGGAAAGG + Intronic
1003844748 6:10161435-10161457 ATCATTTTTCAGGTGATGAAGGG + Intronic
1004201995 6:13557038-13557060 CACATTTTACAGATGAGAAATGG + Intergenic
1004314665 6:14575402-14575424 CACATTTCACAGATGAAGAAAGG + Intergenic
1004426053 6:15507895-15507917 CTCATTTCTGAGCTGAGCCAAGG + Intronic
1004569871 6:16834821-16834843 CTCATTTTGCAGATGATGGAAGG + Intergenic
1004676337 6:17846317-17846339 CTCTTTTTAAAGATGAGGAAAGG - Intronic
1005988340 6:30888367-30888389 CCCATTTCTCCAATCAGGAATGG - Intronic
1006330358 6:33385859-33385881 ATCATTTCTCTGATAAGAAATGG - Intergenic
1006785524 6:36664297-36664319 CTCATTCCTGAAATGAGTAATGG + Intergenic
1007097972 6:39226034-39226056 CTCATTTTGCAGATGAGGAAAGG + Intronic
1007379238 6:41476400-41476422 CCCATTTTTCAGATGAAGAAAGG + Intergenic
1007652789 6:43433568-43433590 CTCACTTTACAGATGAGGAAGGG - Intronic
1007801785 6:44400704-44400726 CACATTTCTCACAGGAGGTAAGG - Intronic
1007808276 6:44467390-44467412 CTCCTTTCTCAGAAGAGAAGAGG + Intergenic
1010603632 6:77862315-77862337 CTCATTTCTTTGACTAGGAAAGG - Intronic
1011407310 6:87029588-87029610 CACATTTATGAGATGAGGAAGGG + Intergenic
1011831780 6:91382596-91382618 CTCATTTTTCAGATAAAGAGTGG + Intergenic
1013447336 6:110243711-110243733 TTGATTTCTCACTTGAGGAATGG + Intronic
1013859883 6:114623100-114623122 CTAATTTTACAGATGAGGATGGG + Intergenic
1014286363 6:119503442-119503464 CTCAATTCCCACATGGGGAAAGG - Intergenic
1014293359 6:119587543-119587565 CTCATTTTATAGTTGAGGAATGG + Intergenic
1015061485 6:128971961-128971983 CCCATCTCTCAGCTGAGGCAAGG - Intronic
1015799556 6:137046466-137046488 CCCTTTTTTCAGATGAGGCAAGG + Intergenic
1015901833 6:138075539-138075561 CTCATTTCTCCCATTTGGAATGG + Intergenic
1016375583 6:143417386-143417408 CTCTTTTCTCATAAAAGGAAGGG - Intergenic
1016402584 6:143696528-143696550 CCCATTCTACAGATGAGGAAGGG + Intronic
1018131284 6:160734433-160734455 CTTACTTCTCAGCTGTGGAAAGG - Intronic
1019914414 7:4123556-4123578 CTCAGTTCTCCAAAGAGGAAGGG - Intronic
1020158928 7:5752921-5752943 CTGACTCCTCAGATGAGGAAAGG - Exonic
1021922194 7:25496692-25496714 CTCTTTTCTCAAATCTGGAAGGG - Intergenic
1022939269 7:35216431-35216453 CTTATTTTACAGATGAGAAAAGG - Intronic
1022979982 7:35595316-35595338 CTCATTTTCCGGATGAGGAAAGG - Intergenic
1023153065 7:37220805-37220827 CTTCTTTCACAGATGGGGAAAGG + Intronic
1023448134 7:40253151-40253173 CCCATTTCACAGATGAAAAAAGG - Intronic
1023450509 7:40279279-40279301 CCCATTTATCAGTTTAGGAATGG - Intronic
1024548960 7:50544490-50544512 TTCATTTCTCAGATGAGGAGAGG - Intronic
1024581572 7:50805101-50805123 CCCATCTCACAGATGAGGAAAGG - Intergenic
1024598299 7:50958385-50958407 CCCATTTTACAGATGAGGAGAGG - Intergenic
1024599109 7:50963983-50964005 CCCACTTCACAGATGAGCAAAGG - Intergenic
1024970888 7:55069280-55069302 CTCATTTTGCAGCTGAGGACAGG - Intronic
1025601418 7:63002068-63002090 GTCACATCTCAGAAGAGGAAGGG - Intergenic
1026374006 7:69731898-69731920 CCCATTTTACAGATGAGGAAAGG - Intronic
1026523464 7:71135332-71135354 CTCATTTCTCAACTGGGGATGGG - Intronic
1026630200 7:72031455-72031477 CTCATTGATAAGATGTGGAAGGG - Intronic
1027579121 7:79971051-79971073 CTCATGTTTCAGATGAGTGAAGG + Intergenic
1028178831 7:87691895-87691917 CTCATTTTACAGATGAGAAAAGG - Intronic
1028745531 7:94322026-94322048 CTCAATTCTGAGATAGGGAATGG - Intergenic
1029528543 7:101110159-101110181 CTCATCTTTCAGATGAGAATAGG + Intergenic
1029691413 7:102184487-102184509 CACATTTCTCATCTGAAGAATGG - Intronic
1030349761 7:108470801-108470823 CTCATTTGTAAAATGAGGAAAGG - Intronic
1030522806 7:110619201-110619223 TTCATGTCTCAGGTAAGGAAGGG + Intergenic
1030631614 7:111901792-111901814 CTCATTTCACCTATAAGGAAAGG + Exonic
1030635793 7:111947400-111947422 CTGACTTCTCATATGAGAAAGGG + Intronic
1030864534 7:114683461-114683483 CCCATTTTACAGATGAGTAAAGG - Intronic
1030891445 7:115003903-115003925 CTCATTTTACAGATGAAAAACGG - Intronic
1030938839 7:115619550-115619572 CTCATTTCTTAACTTAGGAAAGG + Intergenic
1031062714 7:117070308-117070330 CTCCTTTTACAGATGAGAAATGG - Intronic
1032650182 7:133869404-133869426 CTCATTTTACAGATGAAGACAGG - Intronic
1032896030 7:136251742-136251764 CCCTTTTCTCAGGTGGGGAATGG + Intergenic
1034421103 7:150991380-150991402 TTCATTTGTCAGAGGCGGAAGGG + Intronic
1034676729 7:152897544-152897566 CACATTTCTCAGATCGCGAAGGG - Intergenic
1036780805 8:11645898-11645920 CTTATCTCTCAGAGGAGGAGAGG + Intergenic
1037374563 8:18213619-18213641 CTCAATGCTCTGCTGAGGAAAGG - Intronic
1037878588 8:22561616-22561638 CTCATCTTATAGATGAGGAAAGG - Intronic
1038149626 8:24930745-24930767 CCCATGTTTCAGATGAGAAAAGG - Intergenic
1038506598 8:28090246-28090268 CTCCTTGCACAGATGAGGATAGG - Intronic
1038944110 8:32337841-32337863 CTCATTTCTGAGATGATGAATGG - Intronic
1039320940 8:36430348-36430370 TTCATTTCACAGATCAAGAATGG + Intergenic
1040024670 8:42770741-42770763 CACATTTTTCTGATGAGGACAGG - Intronic
1040443705 8:47471868-47471890 CTTAGTTCTCATATTAGGAATGG + Intronic
1040607597 8:48949853-48949875 TTCCTTTCTCAAATGAGGAGGGG - Intergenic
1040652239 8:49462269-49462291 CTCATTTTACAGATGAAAAATGG + Intergenic
1041143160 8:54843942-54843964 CTCTTTTTTCTGATTAGGAAAGG + Intergenic
1041928410 8:63261623-63261645 CTCATTTTCCAGATGAGAAGAGG + Intergenic
1041987904 8:63948238-63948260 CTCATGCCCCATATGAGGAAAGG + Intergenic
1042096143 8:65217861-65217883 CTGATTTCTGAGGAGAGGAAAGG + Intergenic
1042223138 8:66493205-66493227 TTCATTTCTGAAATGAGAAAGGG + Exonic
1044087196 8:87955810-87955832 CCCATTTTTCAGAAGAGGTATGG - Intergenic
1044246982 8:89959830-89959852 CTCATTTTATAGATGAGGAAAGG - Intronic
1044412633 8:91901705-91901727 TTCAGTTCTCAGAAGAGAAAAGG + Intergenic
1045089792 8:98729945-98729967 CCCATTTTCCAGATGAGAAATGG - Intronic
1045252433 8:100493096-100493118 TCCATTTTACAGATGAGGAAAGG + Intergenic
1045375732 8:101571998-101572020 CTCATTTCACAGCTAAGGAGAGG - Intronic
1045578468 8:103451677-103451699 CTCATTTTTCAGATAAGGACAGG - Intergenic
1045654401 8:104371958-104371980 TTCATATCACAGATGAGGAAAGG - Intronic
1045665877 8:104483772-104483794 CCCATTTTACAGATGAAGAATGG + Intergenic
1045713854 8:105018546-105018568 TCCATTTTTCAGATGAGAAAAGG - Intronic
1046734512 8:117762601-117762623 CCCATTTTTCAGATGAGGTGAGG - Intergenic
1047024965 8:120814287-120814309 CCCATTTCACAGGTGAAGAAGGG + Intergenic
1047188820 8:122659744-122659766 TTCATTTCACAGAGGAGCAAGGG + Intergenic
1047415241 8:124659533-124659555 CTCATTTCTCAGGAGATTAAAGG + Intronic
1047555728 8:125928156-125928178 CTCATTTATAAAATGAGCAAAGG - Intergenic
1047745173 8:127839703-127839725 CTAATGGCTCAGCTGAGGAAGGG + Intergenic
1047750288 8:127875464-127875486 CTTATTTCATAGATGAGGAACGG - Intergenic
1047806740 8:128368953-128368975 CTCATTTTGCAGATGAAAAAAGG - Intergenic
1048257264 8:132914586-132914608 CTTCTTTGTCAAATGAGGAAAGG - Intronic
1048370922 8:133775488-133775510 CTCATTTTATAGATGAGGAAAGG - Intergenic
1049001311 8:139827104-139827126 CCCATTTCTAAAATGGGGAAGGG + Intronic
1049258560 8:141626710-141626732 TTCATTTTGCAAATGAGGAAGGG - Intergenic
1049398345 8:142412339-142412361 CTCATTTTCCAGATGGGAAAAGG - Intergenic
1051222968 9:14869593-14869615 CTCATTTAACAAATGAGGAAAGG - Intronic
1051869461 9:21720141-21720163 CTCATTTCACAAATGAGGCAAGG - Intergenic
1052735254 9:32335236-32335258 CTCATTTGTCAGAATAGGCATGG - Intergenic
1054877422 9:70111452-70111474 CTCATTTTACAGATGAGCAATGG - Intronic
1054928332 9:70610812-70610834 CTTACTTTACAGATGAGGAAAGG + Intronic
1055161867 9:73139984-73140006 CTCAGTTTCCAGATGAGAAATGG + Intergenic
1055687993 9:78798501-78798523 CCCATTTCACAGTTGAGGAAAGG + Intergenic
1055765531 9:79659105-79659127 CTTATTTCATACATGAGGAAAGG + Intronic
1056649351 9:88444653-88444675 CTCAATTCTTTGATGATGAATGG + Intronic
1057719454 9:97520206-97520228 TTCATTTTTCAGAGGAGGGAAGG + Intronic
1057719691 9:97522015-97522037 ATCATTTCACAGATGAGCCACGG + Intronic
1057899198 9:98934801-98934823 CTCATTTGTCAGATGTTGGATGG + Intergenic
1057921045 9:99097119-99097141 TTTAGTTCTCTGATGAGGAAGGG + Intergenic
1058454636 9:105127777-105127799 CTCATTTTGCACATAAGGAATGG + Intergenic
1058903802 9:109464681-109464703 CCCATTTATCAAATGTGGAACGG + Intronic
1059060173 9:111027568-111027590 CTGACTTCTTAGATGAGGACAGG - Intronic
1059367258 9:113796450-113796472 CTCATCTTTCAGATAAGGACTGG - Intergenic
1059391954 9:114004785-114004807 CCCATTTTGCAGATGAGGACAGG + Intronic
1059434871 9:114270086-114270108 CCTACTTCTCAGATGAGGAAAGG - Intronic
1059743164 9:117173045-117173067 CTCATTTATAAAATAAGGAAAGG + Intronic
1059776668 9:117482786-117482808 ATCATTTCTCAGATGACATAGGG - Intergenic
1059988858 9:119845614-119845636 CTCAGTTAGCAGCTGAGGAAAGG + Intergenic
1060230261 9:121820650-121820672 CTCCCCTTTCAGATGAGGAAAGG - Intergenic
1060517120 9:124272780-124272802 TTCATTTTACAGATGAGGAAAGG + Intronic
1060578741 9:124723791-124723813 CTCATTTCATAGATGAGAAAAGG + Intronic
1060588312 9:124800432-124800454 CCCATTTGGCAGATGAGGCATGG + Intronic
1060757426 9:126223584-126223606 CTGCTTTCACAGATGAGGGACGG - Intergenic
1060885626 9:127150110-127150132 TTCATTTTACAGAAGAGGAAAGG - Intronic
1061322579 9:129840326-129840348 CTCATCTCACAGAGGAGGAATGG - Intronic
1061367923 9:130182165-130182187 CCCATTTTACAGATGAGGAAAGG + Intronic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1061608471 9:131729710-131729732 CCCATTTGACAGTTGAGGAAAGG - Intronic
1061648267 9:132024315-132024337 CTCCTTTTACAGATGAAGAATGG + Intronic
1062019827 9:134313931-134313953 CCCATTATACAGATGAGGAAAGG + Intergenic
1062141744 9:134962932-134962954 CTAATTACGCAGAGGAGGAAAGG - Intergenic
1062597562 9:137306091-137306113 GTCATTTCACAGATGGGGAGGGG - Intergenic
1185666737 X:1771425-1771447 GTAATTTCATAGATGAGGAAAGG - Intergenic
1185668011 X:1783069-1783091 CTCATTTTACAGATGAGAAATGG - Intergenic
1185787983 X:2906797-2906819 CTTATTTCACAAATCAGGAAAGG + Exonic
1186105951 X:6206058-6206080 CTCATTTTACAGTTGAGGGAAGG + Intronic
1186672931 X:11785255-11785277 CACATTTCACAGGTTAGGAAAGG - Intergenic
1187253614 X:17621859-17621881 CTCATTTTACGGATGAGGAAAGG - Intronic
1187616823 X:21004452-21004474 CTCATGTCTCAGCTAAGGAAGGG - Intergenic
1187722899 X:22170447-22170469 TTCATTCTTCAGATGAAGAAAGG - Intronic
1188362550 X:29273644-29273666 CACATTTTTCAGCTGAGGAGGGG + Intronic
1189030993 X:37450293-37450315 CTCACTTTGCAGATGAGGAAAGG - Intronic
1189300050 X:39945925-39945947 CCCATTTTACAAATGAGGAAAGG - Intergenic
1190106940 X:47567580-47567602 CTCATTTCCCAGAGGGGAAAGGG - Intronic
1190301871 X:49061801-49061823 CCCATTTTAGAGATGAGGAAAGG - Intronic
1190321142 X:49179879-49179901 CCCATTTCTCAGAAAATGAAAGG + Intronic
1191912986 X:66171444-66171466 CTATTTTCTAAGATCAGGAAAGG - Intronic
1192131777 X:68558644-68558666 CTCATTTCTCCTATTTGGAATGG - Intergenic
1192547297 X:72024548-72024570 TTCATTTCACAGATGAGGACGGG + Intergenic
1192658811 X:73021534-73021556 CTCACTTCCCAGATGATGAGCGG + Intergenic
1192786792 X:74344080-74344102 GTCATTACTCAGAAGGGGAAAGG - Intergenic
1192930525 X:75801134-75801156 CTAATTTCTCAGGTGATGAGTGG - Intergenic
1193223889 X:78959074-78959096 GTTGTTTCTCAGATGGGGAAGGG - Intronic
1193585755 X:83319123-83319145 CTCATTTCTCCTATTTGGAATGG + Intergenic
1194409023 X:93534095-93534117 CTACTTTCTCAGATAAAGAAAGG - Intergenic
1194686978 X:96932396-96932418 CTCATTTTTCAGAAAAGGTATGG + Intronic
1195963838 X:110412532-110412554 CCCATTTTACAGATGAGAAACGG - Intronic
1196020351 X:110984695-110984717 GTCATTTTTAAAATGAGGAAGGG + Intronic
1196975129 X:121150947-121150969 CCCATTTTACAGATGAGGATGGG - Intergenic
1197326062 X:125095033-125095055 CTCATTTGTAAGATGAAAAAAGG - Intergenic
1198055180 X:132987142-132987164 CACATTTTACAGATGGGGAAAGG - Intergenic
1198249454 X:134866139-134866161 CTGATTTCACAGTTAAGGAACGG - Intergenic
1198417689 X:136436823-136436845 CTCATTTATCAAATGAGTACTGG + Intergenic
1198834960 X:140795256-140795278 CTCATTTCTCCCATTAGGAACGG - Intergenic
1199088790 X:143666370-143666392 CTGATTTATAAAATGAGGAAAGG - Intergenic
1199538017 X:148925695-148925717 CCCATTACACAGATGAGGGAAGG - Intronic
1199937707 X:152591807-152591829 CTCATGACTCAGAGAAGGAAAGG + Intergenic
1199976871 X:152899337-152899359 CTTGTTTTTCAGATGAGGAGCGG - Intergenic
1200586326 Y:5008999-5009021 CTCATTTTACAGATAAGAAAAGG + Intronic
1201287009 Y:12387767-12387789 CTTATTTCACAAATCAGGAAAGG - Intergenic
1202096849 Y:21260249-21260271 CTAAATTCTCAGATGAAGATTGG - Intergenic