ID: 917456277

View in Genome Browser
Species Human (GRCh38)
Location 1:175188768-175188790
Sequence CAGGTAGTTCTCAACTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 169}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917456277_917456289 23 Left 917456277 1:175188768-175188790 CCTTAAAAGTTGAGAACTACCTG 0: 1
1: 0
2: 1
3: 8
4: 169
Right 917456289 1:175188814-175188836 GTTTGTCCTGGAGGCCACTTGGG 0: 1
1: 0
2: 0
3: 17
4: 141
917456277_917456291 27 Left 917456277 1:175188768-175188790 CCTTAAAAGTTGAGAACTACCTG 0: 1
1: 0
2: 1
3: 8
4: 169
Right 917456291 1:175188818-175188840 GTCCTGGAGGCCACTTGGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 240
917456277_917456288 22 Left 917456277 1:175188768-175188790 CCTTAAAAGTTGAGAACTACCTG 0: 1
1: 0
2: 1
3: 8
4: 169
Right 917456288 1:175188813-175188835 AGTTTGTCCTGGAGGCCACTTGG 0: 1
1: 0
2: 0
3: 21
4: 196
917456277_917456284 14 Left 917456277 1:175188768-175188790 CCTTAAAAGTTGAGAACTACCTG 0: 1
1: 0
2: 1
3: 8
4: 169
Right 917456284 1:175188805-175188827 CTGCCCCTAGTTTGTCCTGGAGG 0: 1
1: 0
2: 1
3: 5
4: 127
917456277_917456290 24 Left 917456277 1:175188768-175188790 CCTTAAAAGTTGAGAACTACCTG 0: 1
1: 0
2: 1
3: 8
4: 169
Right 917456290 1:175188815-175188837 TTTGTCCTGGAGGCCACTTGGGG 0: 1
1: 1
2: 0
3: 20
4: 194
917456277_917456279 -10 Left 917456277 1:175188768-175188790 CCTTAAAAGTTGAGAACTACCTG 0: 1
1: 0
2: 1
3: 8
4: 169
Right 917456279 1:175188781-175188803 GAACTACCTGCATCCCTTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 78
917456277_917456283 11 Left 917456277 1:175188768-175188790 CCTTAAAAGTTGAGAACTACCTG 0: 1
1: 0
2: 1
3: 8
4: 169
Right 917456283 1:175188802-175188824 GGTCTGCCCCTAGTTTGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917456277 Original CRISPR CAGGTAGTTCTCAACTTTTA AGG (reversed) Intronic
904169175 1:28579462-28579484 CAGGTAGTGCTCAACTATCTGGG - Intergenic
912580472 1:110716760-110716782 GATGTAGTTCTCTCCTTTTAAGG + Intergenic
912940663 1:114041944-114041966 AAGGTAGTTCTGTGCTTTTAAGG + Intergenic
912988153 1:114455720-114455742 CAGCTAGTTCCCAACATTAAAGG + Intronic
916895567 1:169158669-169158691 ACGGTAGTTCTCAAATTTCATGG + Intronic
917456277 1:175188768-175188790 CAGGTAGTTCTCAACTTTTAAGG - Intronic
918003280 1:180518293-180518315 CAGGCTGTTCTCAACTCTTGGGG - Intergenic
919791890 1:201296766-201296788 AAGACAGTTCTGAACTTTTAGGG - Intronic
921097221 1:211897007-211897029 CAGGCAGTTCTCAATTTGCATGG + Intergenic
921423677 1:214977799-214977821 AATATAGTTCTCAACTTGTAGGG + Intergenic
923813921 1:237352928-237352950 CAGGTATGTCGCAACTTTCATGG + Intronic
924026708 1:239841152-239841174 GAAGTCATTCTCAACTTTTATGG - Intronic
924507998 1:244704124-244704146 GAGGTAGGGCTAAACTTTTAGGG + Intronic
1065674484 10:28159251-28159273 CCAATAGTTCTCAACTTTTTTGG + Intronic
1066114111 10:32224701-32224723 TGGCTGGTTCTCAACTTTTAAGG - Intergenic
1067039095 10:42939588-42939610 CAGGTGCTCCTCAACTTTGAGGG - Intergenic
1067134451 10:43595631-43595653 CAGAGAGTTCTCAACCTTTGGGG + Intergenic
1067736909 10:48862749-48862771 CCAGCAGTTCTCAACTTTTTTGG - Intronic
1078401747 11:11034479-11034501 CAGGTAGTTTGTTACTTTTACGG - Intergenic
1086217193 11:84397811-84397833 CAGTTTCTTCTCTACTTTTAAGG + Intronic
1086781978 11:90918328-90918350 CAGGTTGTTTCCAACTTTAAGGG - Intergenic
1093804986 12:23421447-23421469 CAGGTCGCACTCAACTTTTGGGG + Intergenic
1095991779 12:48039685-48039707 CAGGATGTTCTCAAATTCTAAGG - Intergenic
1096691326 12:53323901-53323923 CTAGTACTTCTCAACTGTTAAGG + Intronic
1097864604 12:64549286-64549308 CAGGCAGTTCTCAAATTTCTGGG - Intergenic
1100342193 12:93690036-93690058 TGGGTAGTTCACAACTTTGAAGG + Intronic
1101842217 12:108336139-108336161 TTGGTAGTTCTCAAGTTTTGGGG + Intronic
1106275315 13:28199474-28199496 CAGGTAGTTCTTTTCCTTTAAGG + Intronic
1107107791 13:36665259-36665281 CAGGTATTTCTCCACCTTCACGG - Intergenic
1111341756 13:86895833-86895855 CAGGTAATTCAAAACTGTTAGGG + Intergenic
1112395530 13:99027338-99027360 CATGTAAAACTCAACTTTTAGGG - Intronic
1114466022 14:22923415-22923437 CTGGTGGTTCTTAACTTTTGTGG + Intronic
1115252325 14:31362550-31362572 CAGGTTGTTCTCAAATTTCTGGG - Intronic
1115729379 14:36251803-36251825 CAGGTAGTTCTCATCTCATGAGG - Intergenic
1117338451 14:54774602-54774624 CAGGCTGGTCTCAACTTTTCAGG - Intronic
1120891861 14:89498618-89498640 CAGGTAGTTCTCAATATCCAGGG - Intronic
1123954810 15:25324294-25324316 AAGGAAGTTCTCAGCCTTTAGGG + Intergenic
1126160497 15:45608590-45608612 CCTGTGGTTCTCAACTTTTCAGG - Exonic
1127301561 15:57659725-57659747 CAGTTTGTTCTCAGATTTTAGGG + Intronic
1129966043 15:79736632-79736654 GAGAAAGTTCTCTACTTTTAAGG - Intergenic
1135031763 16:19044402-19044424 CAGGTTGTTCTCAAACTTAAGGG + Intronic
1135825049 16:25719718-25719740 CAGGCAGCCCTTAACTTTTATGG + Intronic
1137534494 16:49307965-49307987 CAGGTAGTTCACAAGTGGTAGGG + Intergenic
1138837968 16:60460991-60461013 CAGATTGCTCTTAACTTTTAGGG - Intergenic
1139142523 16:64285034-64285056 CAGGCTGTTCTCAACCTTTTAGG - Intergenic
1140206374 16:72937005-72937027 CAGATAGTTCCCAGCTTTTTGGG + Intronic
1143380501 17:6493176-6493198 CAGTTACTTCTCAACCTCTAAGG + Intronic
1147367942 17:39971644-39971666 CAGGTAATTCTCATCTTGTGGGG - Intronic
1147785644 17:42976743-42976765 CAGTCAGTTTTCAACCTTTAAGG + Intronic
1149852707 17:60049763-60049785 CAGATATTTCACATCTTTTATGG - Intronic
1152164703 17:78695039-78695061 CAGGTTGTTCTCAACTGTAGGGG - Intronic
1155997216 18:32342823-32342845 CAGGTAGAGGTCTACTTTTATGG + Intronic
1156980122 18:43276997-43277019 CAGGAAGTTCTTAAATTTTCAGG - Intronic
1159816767 18:73084071-73084093 CCAGTACTTTTCAACTTTTAAGG + Intergenic
1163994709 19:21032829-21032851 AAGGTACCTCTCAACTTTAAAGG - Intronic
1166855067 19:45779264-45779286 CAGGTAGTTCTCATCCTGGAAGG + Exonic
927277601 2:21274894-21274916 CAGGAAGTTCGCAGCCTTTAAGG + Intergenic
928395110 2:30937654-30937676 GAGAAAGTTCTCTACTTTTAAGG + Intronic
928470825 2:31573943-31573965 CAGTTAGTTCTGAACTTGAATGG + Intronic
928949696 2:36803793-36803815 AAGGTGCTTCTTAACTTTTATGG + Intronic
929279471 2:40062151-40062173 CAGCTAGTTTTCAATTTGTAAGG + Intergenic
929699114 2:44146738-44146760 CAGGGAGTTCTCAGCTTTATGGG - Intergenic
931220509 2:60284585-60284607 TGGGTAGTTCTCAAGATTTAAGG + Intergenic
931595911 2:63943357-63943379 CAGGAAGTTCTCTACTTCTATGG + Intronic
933566924 2:83961823-83961845 CAGGTTGTTCTAGTCTTTTAGGG - Intergenic
934078134 2:88445339-88445361 CAGGTAGTTGTCAAATTTATGGG - Intergenic
936162526 2:110095317-110095339 CAAATATTTCTCAACTTTGAGGG - Intronic
936813348 2:116429380-116429402 CAAGTAGTTCACATCATTTATGG - Intergenic
937674424 2:124573988-124574010 AAAGTATTTCTAAACTTTTATGG - Intronic
941191382 2:162387394-162387416 CAGGTACTTCTAAATTTTGATGG + Intronic
942611425 2:177745915-177745937 CAGGTGGTTATCAACCTCTATGG - Intronic
943051534 2:182919325-182919347 CAGGTAGTACACAACTTTACAGG - Intronic
944998627 2:205323407-205323429 CATGTAGAGCTCAACTTCTAAGG + Intronic
945191095 2:207188184-207188206 CCAGTAGATATCAACTTTTAAGG - Intergenic
947289312 2:228554426-228554448 GAGGAAGTTCTCTGCTTTTAAGG - Intergenic
1168939005 20:1693294-1693316 CAGGCAGTTCTCACTTTTCATGG - Intergenic
1169242998 20:4000560-4000582 TACATAGTTCTTAACTTTTAAGG - Intronic
1172221895 20:33279967-33279989 CAGGTAGTTCCCAACTCTCTGGG + Intronic
1174314045 20:49683230-49683252 CAGATAGTTTGCAACTTCTAAGG - Intronic
1175009419 20:55720133-55720155 CAGGTTGTACTCCAATTTTAGGG - Intergenic
1175075400 20:56368087-56368109 CAGGTAGAACTCTTCTTTTAAGG + Exonic
1175090152 20:56496144-56496166 CAGGAAGTTCTCTGATTTTAGGG - Intronic
1177240705 21:18453188-18453210 CTGGTAGTTTTCAACTTAGAGGG - Intronic
1178613726 21:34111363-34111385 CAGAAAGTTCTAAACTTTAAAGG + Intronic
1178773178 21:35524728-35524750 CAGCTGCTTCTCAACTTTTGTGG - Intronic
1183759082 22:39799278-39799300 CAGGTAGTTCTCAGGCTCTAAGG + Intronic
949410166 3:3754906-3754928 AATTTAGTTCTCAACTTTTTGGG - Intronic
952311862 3:32197801-32197823 CAAGCAGTTCTCATTTTTTAGGG + Intergenic
953207044 3:40840354-40840376 CAGGGAGGTCTCAATTTTAATGG + Intergenic
953324330 3:42000093-42000115 CAGCTAAATCTCAGCTTTTATGG - Intergenic
954337888 3:49930310-49930332 ACGGTAGTTCTCAACTCTGACGG + Intergenic
954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG + Intronic
955849664 3:63206213-63206235 CAAGTGGTTCTTAAATTTTAGGG - Intergenic
959269538 3:104189652-104189674 CAAATAATTCTTAACTTTTATGG + Intergenic
959357461 3:105350835-105350857 AAAGTAGTTCTCATCTTCTAGGG - Intergenic
960506787 3:118503641-118503663 TAGGTATTTGTCAACTTTTCAGG - Intergenic
964228083 3:154430098-154430120 CAGGTAGGTTTCAGCTTTGAAGG + Intergenic
967662564 3:192130968-192130990 CAGGAAAATCTCAACTTTCATGG + Intergenic
970008265 4:11430190-11430212 CAGTTAGGTCTCAGCTTTCAGGG - Intergenic
971292144 4:25353154-25353176 CAGGTTGTTTTTACCTTTTAAGG + Intronic
971762085 4:30779814-30779836 CAAGTAGCTCTCAATTTTTTAGG + Intronic
971893481 4:32558232-32558254 CTGGTAGTTTGTAACTTTTAAGG + Intergenic
972602828 4:40587720-40587742 CAGGTAATTCTTACCTTTGAGGG - Intronic
975048577 4:69831541-69831563 CAGAGAGTTCTCAACCTTTGGGG + Intronic
975841266 4:78476425-78476447 CATGTATTTGTCATCTTTTATGG + Intronic
978114167 4:104999565-104999587 CAGATTGCTCTCAACTTTCATGG + Intergenic
978266875 4:106838017-106838039 CAGATAGTTCAACACTTTTAGGG - Intergenic
980028835 4:127800718-127800740 CAGGTAGATCTGAATTGTTATGG - Intronic
980160650 4:129157879-129157901 CAGATACGTCTCAACTTATAAGG + Intergenic
980648795 4:135682639-135682661 GAGAAAGTTCTCAGCTTTTAAGG + Intergenic
983442125 4:167799963-167799985 CAGGGAGTTCTAAACTTTCTAGG + Intergenic
985877685 5:2612831-2612853 CAGTAAGTTCTCATCTTTTAAGG + Intergenic
989232563 5:39102723-39102745 CAGGTACTTCTCATCTTTGGGGG - Intergenic
989326411 5:40201196-40201218 AGGGTTGTTCTCAACTTCTAAGG - Intergenic
990134838 5:52632434-52632456 GAAGTAGTTCTCTACTTTTAAGG + Intergenic
990549874 5:56864206-56864228 CAGATATTTATCAACATTTATGG + Intronic
990907535 5:60819993-60820015 GAGACAGTTCTCTACTTTTAAGG - Intronic
991597649 5:68321857-68321879 CAGATAGTACTCAACTCATAGGG - Intergenic
992601573 5:78406137-78406159 AGGGGAGTTCTCAAATTTTAAGG + Intronic
995246795 5:109944423-109944445 CAGGTAGTTCTCCACTCCTCTGG + Intergenic
996431302 5:123381190-123381212 CATTTATTTCTCACCTTTTAGGG - Intronic
996596189 5:125205646-125205668 TAGATGCTTCTCAACTTTTAAGG - Intergenic
997127506 5:131242994-131243016 CAGGAAGTTCTCAACAGTTCTGG - Intergenic
998173626 5:139886795-139886817 AAGACAATTCTCAACTTTTAGGG + Intronic
1003880592 6:10476536-10476558 CACGTAGTTCTCCTATTTTAGGG - Intergenic
1004503711 6:16230602-16230624 CAGAGAGTTCCCAACCTTTAGGG + Intergenic
1005056892 6:21737875-21737897 TAAGTAGTTCTCAACTTGTTAGG + Intergenic
1008039508 6:46781818-46781840 GATGTAGTTCTCAAATTCTAAGG - Intergenic
1010175598 6:73024427-73024449 CAGGTAGATCTCAAAGTTTGGGG + Intronic
1010664079 6:78606540-78606562 GACATAGTTCTTAACTTTTAAGG - Intergenic
1011408501 6:87041180-87041202 CATGCCGTTCTCAAATTTTAGGG - Intergenic
1013223674 6:108103402-108103424 CAAATTGTTCTTAACTTTTAGGG + Intronic
1014767869 6:125427913-125427935 CAGGCAGCTCTCATATTTTAAGG - Intergenic
1015344056 6:132134757-132134779 GAGCTACTACTCAACTTTTATGG + Intergenic
1015427419 6:133088092-133088114 GAGGAAGTTCTCAGCTTTTAAGG - Intergenic
1016144496 6:140651425-140651447 CAGGTATTTCTTTACTTTAAAGG - Intergenic
1017284715 6:152661363-152661385 AAGGTAATTCTCTATTTTTAAGG + Intergenic
1017797745 6:157862779-157862801 CAGGTAGTTCTTAGTTCTTATGG + Intronic
1019127595 6:169851238-169851260 CCAGTAGTTCTCCATTTTTATGG + Intergenic
1027628579 7:80574887-80574909 CAGGCAGTTCTCAAGTTTTAGGG + Intronic
1030536932 7:110779636-110779658 CTAGTACTTCCCAACTTTTACGG + Intronic
1031293855 7:119976850-119976872 GAGGAAGTTCTCTGCTTTTAAGG - Intergenic
1032853374 7:135814008-135814030 GAGAAAGTTCTCCACTTTTAAGG - Intergenic
1033363821 7:140656475-140656497 CAGAGAGTTCTCAACCTTTGGGG - Intronic
1034065459 7:148132404-148132426 TAGGTACTTCTCAATTTTTAAGG + Intronic
1034831311 7:154310344-154310366 CAGGTAGTTCACAATCTTTTGGG + Intronic
1034913512 7:155017721-155017743 CAGGGATTTTTCACCTTTTAGGG + Intergenic
1036939456 8:13037522-13037544 CAGGTTGTTCTCAAACTTTTGGG + Intergenic
1037342884 8:17865787-17865809 GAGGTAGTTCTGAACATCTATGG + Intronic
1038067524 8:23978385-23978407 CATGTAATTCTCAAATGTTAGGG + Intergenic
1039062809 8:33585202-33585224 CAGCTGGTTCTCTACTTTGAAGG + Intergenic
1039137619 8:34343527-34343549 CAGGTTGTTTCCAACATTTAAGG + Intergenic
1041527971 8:58829631-58829653 CAGGTAGTTCTCAAAGATTGAGG - Intronic
1041996916 8:64073571-64073593 CAGGAAATTCTCACCTTTTTGGG + Intergenic
1042352921 8:67796166-67796188 TAAGTAGTTCTCAAACTTTAGGG + Intergenic
1046481432 8:114823510-114823532 CAGGTTGTTCTCCAATTTTTTGG - Intergenic
1047678090 8:127224838-127224860 CAGTTAGTTCTCAACTTCAAAGG - Intergenic
1049976255 9:863015-863037 CAGGGAGCTCTCCACTTTTAAGG - Intronic
1051448909 9:17173127-17173149 TAGGTAGTACTCAACATTTCTGG - Intronic
1051564890 9:18486270-18486292 CAGAAAGTTCTTAACTTTTTAGG - Intronic
1052298559 9:26927468-26927490 AGGGTAGTTACCAACTTTTAAGG + Intronic
1052370570 9:27659901-27659923 CAGAAAGTTCTCCACTTTTCAGG - Intergenic
1052701501 9:31942624-31942646 CAGAAAATTCTCAGCTTTTATGG - Intergenic
1054820968 9:69520164-69520186 AAGGCAATTGTCAACTTTTAAGG + Intronic
1055341631 9:75290650-75290672 CAGGTACTTCCCAACGTTTTGGG - Intergenic
1057014711 9:91641688-91641710 CAGGTACTGCTCAGCATTTAGGG + Intronic
1060018381 9:120107108-120107130 CGGCTACTTCTCAAATTTTAAGG - Intergenic
1060573126 9:124662045-124662067 AAGGTATTTCTCAAGTATTATGG - Intronic
1060713334 9:125892689-125892711 CAGGCAGTTCTGCATTTTTAAGG - Intronic
1188211299 X:27428508-27428530 TAGGAAGTTCTCAAATATTAAGG + Intergenic
1188581529 X:31719628-31719650 CAAGTAGTCTGCAACTTTTAGGG + Intronic
1188731727 X:33655589-33655611 TCAGTAGTTCTTAACTTTTAGGG + Intergenic
1189525648 X:41818084-41818106 CAGGTAGTCCTCACCTTGCATGG - Intronic
1189883127 X:45512378-45512400 CAGGTACTACTTAAATTTTAAGG + Intergenic
1194444474 X:93971093-93971115 CAGGTAGTACTTAACCTTTTGGG - Intergenic
1195523169 X:105853833-105853855 CATGTATTTCTAAACTTTTAGGG - Intronic
1198448712 X:136744569-136744591 CATGTGGTTCTTAACTTTTTTGG - Intronic
1198941277 X:141958954-141958976 CTGATATTTCTCAACATTTAGGG - Intergenic
1202095945 Y:21248310-21248332 CAGAGAGTTCTCAACCTTTGGGG + Intergenic