ID: 917456562

View in Genome Browser
Species Human (GRCh38)
Location 1:175191057-175191079
Sequence TTGTAATAGCAGTAGCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917456562 Original CRISPR TTGTAATAGCAGTAGCTACA GGG (reversed) Intronic
901625246 1:10620613-10620635 TTGTATTATCAGTAGAGACAGGG - Intronic
901950438 1:12741072-12741094 TTGTATTATGAGTAGATACAGGG + Intergenic
903658457 1:24963017-24963039 TTATAATAGCAGCAACTCCAAGG + Intronic
904243941 1:29172462-29172484 TTGTAATTTCAGTAGAGACAGGG + Intronic
904530278 1:31164144-31164166 TTCAAATAGCAGTAGCTGCAGGG + Intergenic
906316442 1:44789131-44789153 TTGTAATCCCAGCAGGTACATGG + Intergenic
906392793 1:45433249-45433271 TTGTAATTTCAGTAGAGACAGGG + Intronic
906758991 1:48354766-48354788 TTGGAATAGCAGTAGCTGGCAGG + Intronic
906832414 1:49047150-49047172 TTGGAACAGCAGTGGTTACATGG + Intronic
907621524 1:55985854-55985876 TTGTATTTGCAGTAGAGACAGGG + Intergenic
908758059 1:67487090-67487112 TAGGAATAGTAGTAGCTTCACGG - Intergenic
909486869 1:76184364-76184386 TTGTAATTTCAGTAGAGACAGGG - Intronic
910791682 1:91057213-91057235 TTGTATTTTCAGTAGATACAGGG + Intergenic
911942062 1:104059105-104059127 TTCTAATAGCAGTAACCACATGG - Intergenic
911962918 1:104330221-104330243 TTGTATTATCAGTAGAAACAGGG + Intergenic
912213950 1:107585897-107585919 TTATAATAGCAGAAGCTCCCTGG + Intronic
914733021 1:150389220-150389242 TTGTAATTTCTGTAGCAACAGGG + Intronic
915499408 1:156304641-156304663 TTGTATTTTTAGTAGCTACAGGG - Intergenic
916283366 1:163077323-163077345 TTGTAAGAGTAGTAGTTACAAGG + Intergenic
917456562 1:175191057-175191079 TTGTAATAGCAGTAGCTACAGGG - Intronic
917890456 1:179432596-179432618 TTGTATTTGTAGTAGATACAAGG + Intronic
917996909 1:180449578-180449600 TTGTATTTTCAGTAGCGACAAGG + Intronic
918112970 1:181473915-181473937 TTATAATAGCACTTGCCACATGG + Intronic
921507988 1:215996906-215996928 TTGGAATAGAGGAAGCTACACGG - Intronic
922459488 1:225803959-225803981 TTGTATTTGTAGTAGCGACAGGG + Intergenic
922599463 1:226838591-226838613 TTGTTATATCATTGGCTACAGGG + Intergenic
923247037 1:232142706-232142728 TTTTAATAGCATTAGTTACTTGG - Intergenic
923777015 1:236988219-236988241 TTGTATTATCAGTAGAGACAGGG - Intergenic
924212458 1:241784779-241784801 TTGTATTCGCAGTAGAGACAGGG - Intronic
1063903759 10:10762366-10762388 TTGTGCTAGCAGAAGCTAAATGG + Intergenic
1064240343 10:13621747-13621769 TTGTAATAGCAAAAGCTTAACGG - Intronic
1064629065 10:17290905-17290927 TTGTATTTGCAGTAGAGACAGGG - Intergenic
1064956480 10:20916580-20916602 TTGTAATTTTAGTAGCGACAAGG + Intronic
1065935896 10:30520176-30520198 TTGTAATTTTAGTAGCGACAGGG - Intergenic
1067151631 10:43739891-43739913 CTGTATCGGCAGTAGCTACAAGG - Intergenic
1068307741 10:55235732-55235754 TTGTAATTGTAGTAGAGACAGGG - Intronic
1070254254 10:74800517-74800539 TTGTAATTTCAGTAGAGACAGGG + Intergenic
1073528993 10:104214226-104214248 TTGTTACAACAGTAGCAACATGG - Intronic
1073677862 10:105669584-105669606 TTGTTATAACAGTAGCTAAAAGG - Intergenic
1073937635 10:108652966-108652988 TTTTAATGGGAGAAGCTACAAGG - Intergenic
1076251666 10:128989122-128989144 TTGTAATTTTAGTAGCGACAGGG - Intergenic
1078203666 11:9208853-9208875 TGGTAATAGCTGCAGCAACAAGG + Intronic
1078275530 11:9841704-9841726 TTGTATTTTCAGTAGCAACAGGG + Intronic
1078411504 11:11123980-11124002 TTGTATTTGCAGTAGAAACAGGG + Intergenic
1078448455 11:11422535-11422557 TTGTAATTTGATTAGCTACATGG + Intronic
1078900692 11:15639696-15639718 CTGTAATAGCAGTGGCTCCAAGG - Intergenic
1078904655 11:15672498-15672520 TTGTCCAAGCAGTAGCTCCAAGG + Intergenic
1079525965 11:21388200-21388222 TTGTAATACCTGTAGCCACAGGG + Intronic
1082730305 11:56788503-56788525 TAGTAATAACAGTCGCTAGATGG + Intergenic
1083567821 11:63735160-63735182 TTGTAATTGTAGTAGAGACAGGG + Intronic
1084109685 11:67005847-67005869 TTGTATTTTCAGTAGCAACAGGG - Intergenic
1085552087 11:77383496-77383518 TTGTATTTGCAGTAGAGACAGGG + Intronic
1085671527 11:78469007-78469029 TTGGAATAGCAGTGACTAAAGGG - Intronic
1086461900 11:87014240-87014262 TTGAAATATCAGTAGACACAAGG + Intergenic
1086815177 11:91361527-91361549 TGGTATTAGCAATAGCTTCAGGG - Intergenic
1087490023 11:98813684-98813706 TTGTAATTGCAGTAGAGACGGGG - Intergenic
1090103013 11:123821481-123821503 TTGTAATTGAATTGGCTACAGGG + Intergenic
1090388610 11:126372586-126372608 TTGTATTTTCAGTAGATACAGGG + Intronic
1094417166 12:30229535-30229557 TTTTAATGGCAGTAATTACAAGG + Intergenic
1095220480 12:39607993-39608015 TTGTAATTTTAGTAGCGACAAGG - Intronic
1095380273 12:41582543-41582565 CTGTAAAAGCAATAGCTAAATGG - Intergenic
1096479545 12:51929380-51929402 TTGTATTTGCAGTAGAGACAGGG - Intergenic
1098152963 12:67566946-67566968 TTGTATTATCAGTAGAGACAGGG - Intergenic
1098711884 12:73773230-73773252 ATGTTATAACAGTAGCTACAAGG + Intergenic
1099328866 12:81255645-81255667 TTGTATTTTCAGTAGCTACAGGG - Exonic
1100123915 12:91400386-91400408 TTGTGATAGCAGGAGATAGAAGG - Intergenic
1101257594 12:102993909-102993931 TGGTGAAAGCAGTAGATACAAGG - Intergenic
1104168557 12:126257723-126257745 TTGTAATATTAGTAGAGACAGGG + Intergenic
1104301270 12:127567237-127567259 TTGTATTTTCAGTAGCCACAGGG - Intergenic
1104855208 12:131898672-131898694 TTGTATTTGCAGTAGAGACACGG + Intronic
1107255551 13:38422050-38422072 ATGTCATAGCAGTAGCTAAAAGG - Intergenic
1107471306 13:40693895-40693917 TTGTATTTTCAGTAGCGACAGGG - Intergenic
1107655659 13:42590035-42590057 TTGTAACAGCAGTAACCACACGG + Intronic
1107833447 13:44394835-44394857 TGATGATAGCAGTAGCTACCAGG + Intronic
1109199557 13:59414980-59415002 TTTTAAAAGCAGTAACTAAAAGG - Intergenic
1109398806 13:61797297-61797319 TTGAAACAGCAGAAGCTAAAAGG - Intergenic
1109845005 13:67977182-67977204 TTATAAGAGCAGAAGATACACGG + Intergenic
1110494855 13:76155893-76155915 TTGTAATAGGTGTAGATAGATGG - Intergenic
1111525199 13:89459404-89459426 TTATAATAGCAAAAGCCACATGG - Intergenic
1113077675 13:106484051-106484073 TTGTAATAGTAGTACCTGCTTGG + Intergenic
1114208972 14:20599690-20599712 TTGTATTTGCAGTAGAGACAAGG + Intronic
1116704082 14:48274735-48274757 TTGTATTTTCAGTAGATACAAGG - Intergenic
1118570529 14:67190394-67190416 TTGTAATATTAGTAGAGACAGGG + Intronic
1120140617 14:80926293-80926315 TTGTGCTAGCAGTAGCTAGCTGG - Intronic
1120607990 14:86603673-86603695 ATGTAATAGTACTACCTACATGG - Intergenic
1122610874 14:102982594-102982616 TTGTATTAGTAGTAGAGACAGGG - Intronic
1122670827 14:103370842-103370864 TTGTATTTTCAGTAGATACAGGG + Intergenic
1125253826 15:37739234-37739256 TTGTAATAGCAATATAGACAAGG + Intergenic
1129020649 15:72514530-72514552 TTGTATTTTCAGTAGCGACAGGG - Intronic
1129599742 15:76991814-76991836 TTCAAGAAGCAGTAGCTACAAGG - Intergenic
1129811302 15:78512572-78512594 TTGTATTATCAGTAGAGACAGGG + Intronic
1130852907 15:87815392-87815414 TTGTAATAGTAGAAGCTGAATGG + Intergenic
1133412178 16:5578122-5578144 TTGTAATTTTAGTAGCGACAGGG + Intergenic
1133543561 16:6782177-6782199 TTGTATTTTCAGTAGATACAGGG + Intronic
1133715794 16:8447476-8447498 TTGTAATTTCAGTAGAGACAGGG + Intergenic
1134745619 16:16585939-16585961 TTGTATTTTCAGTAGCGACAGGG + Intergenic
1135165966 16:20139417-20139439 TTGTAATAGCAATAGGTCCATGG + Intergenic
1135278605 16:21134858-21134880 TTGTATTTTCAGTAGATACAGGG + Intronic
1136183680 16:28572439-28572461 TTGTATTTTCAGTAGATACAGGG + Intronic
1137684631 16:50378062-50378084 TTGTATTTTCAGTAGCGACAGGG + Intergenic
1139415885 16:66809797-66809819 ACGTAGGAGCAGTAGCTACAGGG + Intronic
1139422497 16:66857163-66857185 TTGCAACAGCAGCAGCTATAGGG - Intronic
1140322755 16:73969744-73969766 TTTAAATATCAGTAGCCACACGG + Intergenic
1140444789 16:75016867-75016889 TTGTAATAGGTCTTGCTACATGG + Intronic
1141105271 16:81228326-81228348 TTGTATTTTTAGTAGCTACAGGG + Intergenic
1142339986 16:89515439-89515461 TTGTATTTTCAGTAGATACAGGG + Intronic
1143248093 17:5502460-5502482 TTGTATTTGCAGTAGAGACAGGG + Intronic
1143808149 17:9447251-9447273 TTGTCATAGTAATAGCTAAAGGG - Intronic
1147052769 17:37808874-37808896 TTGTATTTGCAGTAGAGACAAGG + Intergenic
1147532422 17:41292291-41292313 TTGTATTTGCAGTAGAGACAGGG - Intergenic
1147665437 17:42144282-42144304 TTGTATTATTAGTAGCTACGGGG - Intronic
1148660932 17:49332098-49332120 TTGTATTATCAGTAGAGACAGGG - Intronic
1148879419 17:50714305-50714327 TTGTATTTGCAGTAGAGACAGGG + Intergenic
1149844207 17:59994582-59994604 TTATATTTTCAGTAGCTACAGGG + Intergenic
1153389154 18:4534657-4534679 CTGTAATGGCAGTGGCCACAGGG - Intergenic
1156984408 18:43332200-43332222 TTGTATTAGCAGTAGAGACGGGG - Intergenic
1157207561 18:45713835-45713857 TTGTAATATCATTAGCTAAAAGG - Intergenic
1158077409 18:53546552-53546574 TTGTAAGGGCAGGAGTTACATGG - Intergenic
1158212412 18:55066141-55066163 TTGTATTAGTAGTAGTGACAGGG - Intergenic
1159431132 18:68355439-68355461 TGGTAATTGCAGTACTTACATGG - Intergenic
1159559870 18:69982636-69982658 TAGTAATTCCAGTGGCTACAGGG - Intergenic
1159673047 18:71246859-71246881 TTGTATTTGCAGTAGAGACAGGG - Intergenic
1161954440 19:7485341-7485363 TTGTATTATCAGTAGAGACAGGG + Intronic
1161994301 19:7703111-7703133 TTGTATTTTCAGTAGATACAGGG - Intergenic
1162057434 19:8073120-8073142 TTGGCACAGCTGTAGCTACAGGG + Exonic
1163964743 19:20734652-20734674 TTATTATAGCGGTAGCTAAAAGG + Intronic
1164024383 19:21337859-21337881 CTGTTATACCAGTAGCTAAAAGG - Intergenic
1164138437 19:22435665-22435687 ATGTTATAACAGTAGCTAAAAGG + Intronic
1165499659 19:36178287-36178309 TTGTATTTTTAGTAGCTACAGGG - Intergenic
1165501403 19:36192566-36192588 TTGTATTTTCAGTAGATACAGGG - Intronic
1166957623 19:46475432-46475454 TTGTATTAGTAGTAGACACAGGG - Intergenic
1167083682 19:47294602-47294624 TTGTATTAGTAGTAGAGACAGGG + Intronic
1167818135 19:51902232-51902254 TTGTTATAGCAGCACCAACAAGG + Intronic
1168608318 19:57777601-57777623 ATGTAACAGCAGAAGCAACAAGG - Intronic
925465096 2:4100212-4100234 TTGTATTATCAGTAGAGACAGGG + Intergenic
926420800 2:12695532-12695554 TTGTAATATTAGTAACCACAGGG + Intergenic
926506558 2:13722724-13722746 TTTTACTAGCAGTAGGTACTGGG + Intergenic
926511696 2:13789298-13789320 TTGTATTTGAAGTAACTACAAGG + Intergenic
928521808 2:32096260-32096282 TTGTAATTTTAGTAGATACAAGG - Intronic
930762716 2:55052952-55052974 TTTTAGTAGTAGTAGGTACAGGG - Intronic
932707708 2:74039406-74039428 CTGTGAAAGCAGTATCTACAGGG - Intronic
932735968 2:74254991-74255013 TTGTATTTTCAGTAGATACAGGG + Intronic
933100901 2:78255809-78255831 TTATACTAGCAATAGCTAAAAGG + Intergenic
933881560 2:86674811-86674833 TTGTATTTGTAGTAGCGACAGGG - Intronic
937430590 2:121834810-121834832 TTGTAATTTTAGTAGATACAGGG + Intergenic
938316781 2:130335080-130335102 TTCTGATAGCAGTAGAAACATGG + Intergenic
938750474 2:134323910-134323932 CTGTAATGGGAGTAGTTACATGG - Intronic
939101976 2:137905834-137905856 TTGTAATTTCAGTAGAGACAGGG + Intergenic
942688928 2:178564582-178564604 TTGTAATAACAATGGCTTCAGGG + Exonic
942757826 2:179362858-179362880 TAGCAATAGCAGTAGCCACAGGG - Intergenic
942791680 2:179768120-179768142 TTGTAATTTTAGTAGATACAGGG + Intronic
943326732 2:186508153-186508175 TTGTAATATAAGCAGCTACTTGG - Intronic
944383181 2:199135490-199135512 TTGTAATTTTAGTAGATACAGGG + Intergenic
946644544 2:221818736-221818758 TTTTAATAGCCGTAGTTACCTGG - Intergenic
946977573 2:225170254-225170276 TTCTAAGAGCAGTGGCTCCAAGG + Intergenic
1168780586 20:486064-486086 TTGAAATGACAGTAGTTACATGG - Intronic
1172370191 20:34383536-34383558 TTGTATTATCAGTAGAGACAGGG + Intronic
1172566098 20:35931776-35931798 TTGTAATTTCAGTAGAGACAGGG - Intronic
1172856742 20:38010187-38010209 TGGAAATGGCATTAGCTACAGGG + Intronic
1174330855 20:49816245-49816267 TTGTAATTTCAGTAGAGACAGGG - Intronic
1174446025 20:50591920-50591942 TTGTAATTTTAGTAGATACAGGG - Intronic
1174813145 20:53664563-53664585 TGGTAATAGAAGAAGCAACAAGG + Intergenic
1177107416 21:16977444-16977466 TTGTAATTTCAGTATCTAAAGGG - Intergenic
1177198420 21:17927603-17927625 TTTTAATAGCAGCAGCTGTAGGG + Intronic
1177362390 21:20089765-20089787 TTTTGATACCTGTAGCTACATGG - Intergenic
1178492192 21:33059816-33059838 TTTTAATAGCAGTTTCTAGAAGG - Intergenic
1180652159 22:17386821-17386843 TTGTAATTGTAGTAGAGACAGGG + Intronic
1183613707 22:38928449-38928471 TTGTATTTTCAGTAGCGACAGGG - Intergenic
1184921222 22:47607090-47607112 TTGTAATAGCATTGCCTACAAGG - Intergenic
949557966 3:5174973-5174995 TTGTATTTTCAGTAGCGACAGGG + Intronic
951032188 3:17895175-17895197 TTGGGGTGGCAGTAGCTACAGGG - Intronic
951176814 3:19611378-19611400 TTCTAATAGCAGTAATGACAGGG + Intergenic
954340299 3:49948200-49948222 TTGTGATGGCTGTAGCTAAATGG + Intronic
954810774 3:53246093-53246115 TTGTATTTGTAGTAGATACAGGG - Intronic
955779785 3:62472363-62472385 TTTTAAAAACAGTAGCTCCAAGG + Intronic
956059687 3:65336911-65336933 TTGTAATTTTAGTAGATACACGG + Intergenic
956690125 3:71869504-71869526 TTGTAATAGCAATAGTCAAAAGG + Intergenic
956833367 3:73075118-73075140 TTGCAACAGCAGCAGCCACAGGG + Intergenic
957312709 3:78541138-78541160 TTGCAAATGCAGTAGCTAAATGG - Intergenic
957602237 3:82352584-82352606 TAATAATTGCAGTAGATACATGG - Intergenic
957650072 3:82989632-82989654 TTGGAAAAGCTGTATCTACAAGG + Intergenic
957857699 3:85899136-85899158 TTGTAATATTAGTAGAGACAGGG + Intronic
958818585 3:98946719-98946741 TTGTAAGAACAGTACCAACAGGG - Intergenic
961860379 3:129912585-129912607 TTGTATTTTCAGTAGATACAGGG + Intergenic
963132029 3:141867087-141867109 TTGTATTTTCAGTAGATACAGGG + Intergenic
963490032 3:145988221-145988243 TTGTATTTTCAGTAGCAACATGG + Intergenic
963626648 3:147681713-147681735 TTGAAAAAGCTGTACCTACATGG + Intergenic
966204805 3:177395044-177395066 TTGTATTTTCAGTAGATACAGGG + Intergenic
966735666 3:183185090-183185112 TTGTAATATCAGTAGAGACAGGG + Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
968842258 4:3016080-3016102 TTGTATTATTAGTAGCGACAGGG + Intronic
969246458 4:5936387-5936409 TTGTATTTGCAGTAGAGACAGGG - Intronic
970022711 4:11587097-11587119 TTGTAATTTTAGTAGATACAGGG - Intergenic
972094161 4:35327534-35327556 TTGTATTTTCAGTAGATACATGG - Intergenic
974250030 4:59374432-59374454 ATGAAATAGCTATAGCTACATGG - Intergenic
975089991 4:70390031-70390053 TAGTAGAAGCAGTAGTTACAAGG - Exonic
978814866 4:112892649-112892671 TTCTAATAGCAGTACATCCAAGG - Intronic
986141643 5:5036419-5036441 TTGTATTTTCAGTAGATACAAGG - Intergenic
989531558 5:42513608-42513630 TTGTATTTTCAGTAGCGACAAGG - Intronic
989796465 5:45480229-45480251 TTGTATTAGAATTAGCTTCATGG - Intronic
990209642 5:53468750-53468772 TTGTATTTGTAGTAGATACAGGG + Intergenic
994376532 5:99021339-99021361 TTGTAATAAACTTAGCTACAGGG - Intergenic
995199867 5:109413857-109413879 TGGTAAGAGCAGTAGTGACAGGG + Intergenic
996626617 5:125577722-125577744 TTGTAGTAGAAGTAGCTTCCAGG - Intergenic
997541930 5:134670097-134670119 TTGTATTTTCAGTAGATACAGGG + Intronic
997911683 5:137880418-137880440 TTGTATTGGCAGTAGCTGCAGGG - Intronic
999345218 5:150812358-150812380 TTGTATTTGCAGTAGAGACAGGG - Intergenic
1000686831 5:164260479-164260501 TTGTAATAGTAGTAAGCACAAGG + Intergenic
1001027518 5:168236603-168236625 TGGTAATGGCAGTAGACACAGGG - Intronic
1002262308 5:178002486-178002508 TTGTATTTTCAGTAGATACAGGG + Intergenic
1002550176 5:179982702-179982724 CTGGAATAGCAGGAACTACAGGG + Intronic
1007734178 6:43970411-43970433 TTTTAATTTAAGTAGCTACATGG + Intergenic
1008705503 6:54153673-54153695 TTGTATTATCAGTAGAAACAGGG - Intronic
1008794961 6:55292025-55292047 TTTTGATAGTAGTAGCTAGAAGG - Intergenic
1009382127 6:63044824-63044846 TTGTAATTTCAGTAGATACGGGG - Intergenic
1009975368 6:70666185-70666207 TTGTATTATCAGTAGAGACAGGG + Intergenic
1012630427 6:101459927-101459949 TTGTATTTGCAGTAGAGACAGGG + Intronic
1013031580 6:106338875-106338897 TTGAAATTACAGTAGTTACAAGG + Intergenic
1013106679 6:107031771-107031793 TTGTATTAGTAGTAGAGACAGGG + Intronic
1013614073 6:111825224-111825246 TTGAAAGTACAGTAGCTACATGG - Intronic
1014797641 6:125745584-125745606 TTGTTACAGCAGAAGCTTCAAGG - Intergenic
1015513360 6:134061021-134061043 TTGTAATAGCAGGAGCAAAAGGG + Intergenic
1016945769 6:149531189-149531211 TTGTAATTGTAGTAGAGACAGGG - Intronic
1017237626 6:152133139-152133161 TTGTAAGAGCAGTGGCTGAAAGG + Intronic
1017633017 6:156417366-156417388 CTGGAATAGCAGTAGATAAAAGG + Intergenic
1019693401 7:2430758-2430780 TTGTAATTTCAGTAGAGACAGGG + Intronic
1020501493 7:8927542-8927564 TGGAAATAGCAGTAACTACTGGG - Intergenic
1020638362 7:10724485-10724507 TTGTAACAGCAGTAGCCCCAAGG + Intergenic
1022260466 7:28699484-28699506 TTGCAAAAGCAGTACCTAAAAGG + Intronic
1023413398 7:39909852-39909874 TTCTAGTAGCAGCAGCTACCTGG - Intergenic
1024466753 7:49719508-49719530 TTTTAATGACAGTAGCTAAAAGG - Intergenic
1025100477 7:56130677-56130699 TTGTATTTTCAGTAGATACAGGG + Intergenic
1026939725 7:74280459-74280481 TTGTATTTGCAGTAGAGACAGGG - Intergenic
1028935800 7:96462773-96462795 TTGTATTTGTAGTAGATACAAGG - Intergenic
1029263280 7:99318952-99318974 TTGTATTTTCAGTAGATACAGGG + Intergenic
1030554633 7:111008076-111008098 TTGTAGTAGTAGAAGATACATGG - Intronic
1030826543 7:114166528-114166550 TTGTATTTTCAGTAGCGACAAGG - Intronic
1031907138 7:127472883-127472905 TTGTAAGGGTAGTAGCTATATGG - Intergenic
1033072108 7:138212962-138212984 TTGTATTTGTAGTAGATACAGGG - Intergenic
1034925103 7:155114835-155114857 TTGTATTTTTAGTAGCTACAGGG + Intergenic
1036111887 8:5912268-5912290 TTCTAGCAGCAGTAGATACATGG - Intergenic
1037002853 8:13741730-13741752 TTGAAACAGCAGTAGCTATTTGG + Intergenic
1037335650 8:17789202-17789224 TTGTAATTTTAGTAGATACAGGG + Intronic
1038946818 8:32370683-32370705 TTGTATTTTCAGTAGCGACAGGG - Intronic
1039187953 8:34938288-34938310 TAGTAATAGTAGTAGAGACAAGG + Intergenic
1039713487 8:40083338-40083360 TTATATTAGAAGTAACTACAAGG - Intergenic
1040620527 8:49086817-49086839 TTCTAACAGCAATAACTACATGG - Intergenic
1041055828 8:53985137-53985159 TTATAATCGCAGCAGCTACTCGG - Intronic
1042033102 8:64499143-64499165 TTGTATTTTCAGTAGATACATGG - Intergenic
1042736177 8:71992071-71992093 ATGTAATAGCAGTGGTTGCAGGG - Intronic
1043467563 8:80527347-80527369 TTGTATTTTTAGTAGCTACAGGG + Intergenic
1043842139 8:85119664-85119686 TTGTAATTTCAGTAGAGACAGGG + Intronic
1046645842 8:116784418-116784440 TTGTGATAGGAGCAGGTACAGGG + Intronic
1052254820 9:26443905-26443927 GTGTAAAAGCAGTAGCATCACGG - Intergenic
1052261033 9:26516482-26516504 TTTTAGAAGCAGTAGCAACAAGG + Intergenic
1052267710 9:26593332-26593354 TTGTAATTTTAGTAGATACAGGG + Intergenic
1053068061 9:35082394-35082416 TTGTATTTGCAGTAGAGACAGGG - Intergenic
1054798113 9:69321444-69321466 TTGTATTTGTAGTAGCAACAGGG - Intergenic
1057188558 9:93072879-93072901 TTATAAGAGGAGAAGCTACATGG + Intronic
1058871200 9:109202980-109203002 TTGTAATTGTAGTAGAGACAGGG - Intronic
1059370765 9:113831889-113831911 TAGTGATATTAGTAGCTACATGG + Intergenic
1060057108 9:120424245-120424267 TTGTGATTGAAGTAGCTATAAGG - Intronic
1060573597 9:124667203-124667225 TTGTATTTTCAGTAGATACAGGG + Intronic
1061660739 9:132128471-132128493 TTTTAACAGCAGTAATTACATGG + Intergenic
1186785655 X:12954261-12954283 TTGTATTTGTAGTAGCGACAGGG - Intergenic
1187457825 X:19458364-19458386 TTTTAATAGCAGTTGCTACTAGG - Intronic
1191838543 X:65491532-65491554 TTGTATTTGCAGTAGAGACAGGG - Intronic
1193098062 X:77576037-77576059 TGGTAATAGCAGTAACTCAAAGG + Intronic
1194023588 X:88723944-88723966 CTGTACTGGCAGTAGCTACTTGG + Intergenic
1194298610 X:92158040-92158062 TTGTAATTTCAGTAGAGACAGGG - Intronic
1194322839 X:92473596-92473618 TAGCAATAGCAGTACTTACAGGG - Intronic
1196820420 X:119696258-119696280 TTGTATTTGCAGTAGAGACAGGG + Intergenic
1197769220 X:130079283-130079305 TTGTATTTTCAGTAGATACAGGG - Intronic
1197829989 X:130631247-130631269 TTGACATGGCAGTGGCTACAAGG + Intronic
1198750903 X:139935391-139935413 TTGTATTTTCAGTAGATACAGGG - Intronic
1199050628 X:143232657-143232679 CTGTAGTGGCAGTGGCTACAGGG + Intergenic
1199444786 X:147910087-147910109 TTGTCATATCAGTCCCTACAGGG - Intergenic
1199826820 X:151508545-151508567 TTGTAACAGCAGTAACTGCTTGG + Intergenic
1199905418 X:152223825-152223847 TTGTAATATGAGAAGCAACATGG - Intronic
1202599075 Y:26574162-26574184 TTGTATTATCAGTAGAGACAGGG + Intergenic