ID: 917456769

View in Genome Browser
Species Human (GRCh38)
Location 1:175192682-175192704
Sequence TGTCAGACGGGGCAGCAACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 895
Summary {0: 1, 1: 0, 2: 2, 3: 229, 4: 663}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917456769_917456782 5 Left 917456769 1:175192682-175192704 CCTGGTTGCTGCCCCGTCTGACA 0: 1
1: 0
2: 2
3: 229
4: 663
Right 917456782 1:175192710-175192732 CCGGGCCCTGGAGGGAGGTGTGG 0: 1
1: 0
2: 5
3: 271
4: 6800
917456769_917456783 6 Left 917456769 1:175192682-175192704 CCTGGTTGCTGCCCCGTCTGACA 0: 1
1: 0
2: 2
3: 229
4: 663
Right 917456783 1:175192711-175192733 CGGGCCCTGGAGGGAGGTGTGGG 0: 1
1: 0
2: 3
3: 96
4: 842
917456769_917456786 17 Left 917456769 1:175192682-175192704 CCTGGTTGCTGCCCCGTCTGACA 0: 1
1: 0
2: 2
3: 229
4: 663
Right 917456786 1:175192722-175192744 GGGAGGTGTGGGTTCCTTTTTGG 0: 1
1: 0
2: 3
3: 21
4: 230
917456769_917456775 -7 Left 917456769 1:175192682-175192704 CCTGGTTGCTGCCCCGTCTGACA 0: 1
1: 0
2: 2
3: 229
4: 663
Right 917456775 1:175192698-175192720 TCTGACAGCGCCCCGGGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 173
917456769_917456778 0 Left 917456769 1:175192682-175192704 CCTGGTTGCTGCCCCGTCTGACA 0: 1
1: 0
2: 2
3: 229
4: 663
Right 917456778 1:175192705-175192727 GCGCCCCGGGCCCTGGAGGGAGG 0: 1
1: 0
2: 7
3: 43
4: 415
917456769_917456777 -3 Left 917456769 1:175192682-175192704 CCTGGTTGCTGCCCCGTCTGACA 0: 1
1: 0
2: 2
3: 229
4: 663
Right 917456777 1:175192702-175192724 ACAGCGCCCCGGGCCCTGGAGGG 0: 1
1: 0
2: 0
3: 23
4: 175
917456769_917456776 -4 Left 917456769 1:175192682-175192704 CCTGGTTGCTGCCCCGTCTGACA 0: 1
1: 0
2: 2
3: 229
4: 663
Right 917456776 1:175192701-175192723 GACAGCGCCCCGGGCCCTGGAGG 0: 1
1: 0
2: 0
3: 28
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917456769 Original CRISPR TGTCAGACGGGGCAGCAACC AGG (reversed) Exonic
900517652 1:3090654-3090676 TGTCAGACTGGGGAGTAGCCAGG - Intronic
900539588 1:3196186-3196208 TGTTAGTGGGGGCAGGAACCGGG - Intronic
901100535 1:6715550-6715572 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
901849908 1:12008560-12008582 TCTCAGACGGGGCGGCTGCCGGG + Intronic
901855789 1:12043393-12043415 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
902014842 1:13298849-13298871 TCTCAGACGGGGCGGCTGCCAGG + Intergenic
902062575 1:13658072-13658094 TCTCAGACGGGGCAGTTGCCAGG - Intergenic
903100358 1:21024057-21024079 TCTCAGACGGGGCAGCTGCCGGG - Intronic
903148042 1:21387823-21387845 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
903356384 1:22750447-22750469 TGTCAGACGGAGCAGGCTCCAGG + Intronic
903458332 1:23504068-23504090 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
903458342 1:23504108-23504130 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
903458354 1:23504148-23504170 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
903458364 1:23504188-23504210 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
903485863 1:23688987-23689009 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
903526376 1:23994503-23994525 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
903633922 1:24799448-24799470 TCTCAGACGGGGCAGCTGCCGGG - Intronic
903894748 1:26596236-26596258 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
903921625 1:26804090-26804112 TCCCAGACGGGGTGGCAACCAGG + Intergenic
903923541 1:26817909-26817931 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
903993360 1:27289258-27289280 TCTCAGACGGGGCGGCTGCCGGG + Intronic
904794943 1:33051779-33051801 TCTCAGACGGGGCAGCTGCCGGG - Intronic
904857346 1:33509424-33509446 TCTCAGACGGGGCAGCTGCTGGG + Intergenic
905427345 1:37896272-37896294 TCTCAGACGGGGCGGCTGCCGGG - Intronic
905427366 1:37896352-37896374 TCTCAGACGGGGCGGCTGCCGGG - Intronic
905431831 1:37930337-37930359 TCTCAGTCGGGGCAGCTAACTGG + Intronic
905686643 1:39913292-39913314 TCTCAGACGGGGCAGTTGCCAGG + Intergenic
905699334 1:39999842-39999864 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
906136157 1:43502044-43502066 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
906329942 1:44876464-44876486 TCTCAGACGGGGCGGCTGCCAGG - Intronic
906423976 1:45693942-45693964 TCCCAGACGGGGCAGCAGCTGGG - Exonic
906486774 1:46240940-46240962 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
907089634 1:51711609-51711631 TCTCAGACGGGGCAGCTGCTGGG + Intronic
907402456 1:54233379-54233401 TCTCAGACGGGGCAGCTGCCGGG - Intronic
907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG + Intronic
910343778 1:86215901-86215923 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
910406949 1:86899784-86899806 TCTCAGACGGGGCGGCTGCCGGG + Intronic
910673754 1:89797931-89797953 TCTCAGACGGGGCGGCTGCCGGG + Intronic
910673766 1:89797971-89797993 TCTCAGACGGGGCGGCTGCCGGG + Intronic
911534009 1:99078729-99078751 TCTCAGACGGGGCGGCTGCCTGG + Intergenic
912116289 1:106412515-106412537 TCTCAGACGGGGCGGCTGCCAGG - Intergenic
912298521 1:108490026-108490048 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
912316966 1:108675789-108675811 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
912825362 1:112898853-112898875 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
912844782 1:113069252-113069274 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
913021163 1:114790739-114790761 TCTCAGACGGGGCGGCTGCCAGG + Intergenic
913306217 1:117430406-117430428 TCTCAGACGGGGCAGCTGCCGGG + Intronic
914230939 1:145764519-145764541 TCTCAGACGGGGCGGCTGCCGGG - Intronic
914230951 1:145764559-145764581 TCTCAGACGGGGCGGCTGCCGGG - Intronic
914231513 1:145767129-145767151 TCTCAGACGGGGCGGCTGCCGGG + Intronic
914374617 1:147062083-147062105 TCCCAGACGGGGCAGCTGCCAGG - Intergenic
914775275 1:150729183-150729205 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
914780612 1:150781744-150781766 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
914787939 1:150850964-150850986 TCTCAGACGGGGCGGCTGCCGGG - Intronic
914787962 1:150851044-150851066 TCTCAGACGGGGCGGCTGCCGGG - Intronic
914959849 1:152196297-152196319 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
914959861 1:152196337-152196359 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
914987352 1:152472130-152472152 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
915221597 1:154379464-154379486 TGCCAGATGGGGCAGAAGCCTGG + Intergenic
915221615 1:154379543-154379565 TCCCAGATGGGGCAGCAGCCAGG + Intergenic
916800028 1:168207884-168207906 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
916800039 1:168207924-168207946 TCTCAGACGGGGCGGCTGCCCGG + Intergenic
917006189 1:170419052-170419074 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
917304617 1:173613390-173613412 TCCCAGACGGGGCAGCTGCCAGG - Intronic
917376094 1:174350287-174350309 TCTCAGACGGGGCAGCTGCCGGG + Intronic
917411144 1:174761438-174761460 TTTCAGACGGTGCAGCCGCCAGG + Intronic
917456769 1:175192682-175192704 TGTCAGACGGGGCAGCAACCAGG - Exonic
917553298 1:176058014-176058036 TCTCAGACGGGGCGGCTGCCGGG - Intronic
917583160 1:176396879-176396901 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
917859886 1:179135490-179135512 TCTCAGACGGGGCGGCTGCCGGG - Intronic
917889135 1:179418813-179418835 TCTCAGACGGGGCGGCTGCCGGG + Intronic
919423883 1:197405796-197405818 TCTCAGACGGGGCAGCTACCGGG - Intronic
920451513 1:206064151-206064173 TCTCAGACGGGGCGGCTGCCGGG - Intronic
920794928 1:209129197-209129219 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
921414324 1:214869959-214869981 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
922102465 1:222487798-222487820 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
922693217 1:227711168-227711190 TCTCAGACGGGGCAGTTGCCAGG + Intergenic
922993020 1:229931918-229931940 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
923137099 1:231128699-231128721 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
923174893 1:231454312-231454334 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
923710785 1:236386712-236386734 TCTCAGACAGGGCAGCTGCCGGG - Intronic
923840870 1:237669565-237669587 TCTCAGACGGGGCAGTTGCCAGG + Intronic
924692249 1:246363141-246363163 TCTCAGACGGGGCGGCTGCCGGG - Intronic
924824130 1:247522099-247522121 TCTCAGACGGGGCGGCTGCCAGG - Intronic
1064663613 10:17629355-17629377 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1065335815 10:24656013-24656035 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1065335826 10:24656053-24656075 TCTTAGACGGGGCAGCTGCCGGG - Intronic
1065594408 10:27296690-27296712 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1065738061 10:28771935-28771957 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
1066421374 10:35267636-35267658 TGTCACAAGAGGGAGCAACCAGG - Intronic
1067034162 10:42900536-42900558 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1067120065 10:43465384-43465406 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1067120076 10:43465424-43465446 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1067354481 10:45512240-45512262 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1067391249 10:45865639-45865661 TCTCAGACAGGGCAGCTGCCGGG + Intergenic
1067872040 10:49970512-49970534 TCTCAGACAGGGCAGCTGCCAGG - Intronic
1067872123 10:49970725-49970747 TCCCAGACGGGGCGGCAGCCGGG - Intronic
1069157843 10:65052393-65052415 TCCCAGACGGGGTAGCAGCCTGG - Intergenic
1069674792 10:70239434-70239456 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1069741451 10:70688064-70688086 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1070318131 10:75333734-75333756 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1070684145 10:78468880-78468902 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1071311487 10:84347733-84347755 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1072116526 10:92374994-92375016 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1072180313 10:92975365-92975387 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1072481033 10:95809820-95809842 TCCCAGACGGGGCAGCGGCCGGG + Intronic
1072481052 10:95809900-95809922 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1072648193 10:97275542-97275564 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1072730314 10:97841653-97841675 TCTCAGACGGGGCAGTTGCCAGG - Intergenic
1072730324 10:97841693-97841715 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1072772404 10:98152749-98152771 TCTCAGACGGGGCGGCTGCCAGG - Intronic
1072772415 10:98152789-98152811 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1072950004 10:99839662-99839684 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1072980174 10:100092979-100093001 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1072999674 10:100277222-100277244 TCTCAGACGGGGCGGTTACCAGG - Intronic
1073274860 10:102301541-102301563 TCTCAGACTGGGCAGCTGCCGGG + Intronic
1073386053 10:103128865-103128887 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1073450684 10:103607294-103607316 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1074152170 10:110767525-110767547 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1075050992 10:119182396-119182418 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1075061661 10:119261134-119261156 TTTCAGACGGGGCGGCTGCCGGG + Intronic
1075108520 10:119559598-119559620 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1075128815 10:119722146-119722168 TCTCAGACGGGGCAGCTGCCCGG - Intergenic
1075137216 10:119795354-119795376 TCTCAGACGGGGCGGCTGCCAGG + Intronic
1075181441 10:120215239-120215261 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1075699878 10:124462203-124462225 GGTCAGACAGGGCGGCCACCTGG + Intronic
1075778281 10:125001792-125001814 GGCCAGTCGGGGCAGCACCCAGG - Intronic
1079372020 11:19860267-19860289 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1080097938 11:28430156-28430178 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
1080860036 11:36144608-36144630 TCTCAGACGGGGCAGTTGCCAGG - Intronic
1081784835 11:45738711-45738733 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1081857091 11:46310815-46310837 TGTCAGATGAGGCAGCACCCAGG + Intronic
1082166431 11:48955683-48955705 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1083030245 11:59585433-59585455 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1083114975 11:60451443-60451465 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1083120815 11:60510402-60510424 TCCCAGACGGGGCAGCTGCCAGG - Intergenic
1083130708 11:60622174-60622196 TCTCAAACGGGGCAGCTTCCGGG - Intergenic
1083154599 11:60815269-60815291 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1083382288 11:62278719-62278741 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1083646200 11:64172654-64172676 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1083832046 11:65239417-65239439 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1083912759 11:65719841-65719863 TGTAAGACAGGGCGGCAAGCTGG + Intronic
1084048918 11:66587785-66587807 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1084206566 11:67598126-67598148 TCTCAGACCGGGCAGCTGCCGGG + Intergenic
1084338417 11:68475736-68475758 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1084624452 11:70295878-70295900 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1084745718 11:71168021-71168043 TCTCAGACGGGGCGGCTGCCAGG + Intronic
1084924812 11:72502738-72502760 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1085097797 11:73775140-73775162 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1085288350 11:75378961-75378983 TCCCAGACGGGGCGGCAGCCAGG + Intergenic
1085480866 11:76821569-76821591 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1085513386 11:77098926-77098948 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1086366077 11:86110738-86110760 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1086430530 11:86732364-86732386 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1086434843 11:86770778-86770800 TCTCAGACGGGGCGGCTGCCAGG + Intergenic
1086697258 11:89860819-89860841 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1086708901 11:89983668-89983690 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1087057373 11:93947443-93947465 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1087948541 11:104194410-104194432 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1088116284 11:106317499-106317521 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1088257121 11:107912566-107912588 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1089148447 11:116347110-116347132 TCTCAGACGGGGCGGCTGCCCGG - Intergenic
1089148458 11:116347150-116347172 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1089421128 11:118331959-118331981 TCTCAGACGGGGCAGCTGCCAGG + Intergenic
1089585653 11:119508119-119508141 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1090316853 11:125798595-125798617 TGGCAGAAGGGGAAGCAAACAGG + Intergenic
1090322900 11:125863006-125863028 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1090331978 11:125939521-125939543 TGCCAGATGGGGCAGAACCCAGG + Intergenic
1090686660 11:129129226-129129248 TCCCAGACGGGGCAGCTGCCGGG - Intronic
1090686673 11:129129266-129129288 TCCCAGACGGGGCAGCTGCCGGG - Intronic
1090686687 11:129129306-129129328 TCCCAGACGGGGCAGCTGCCGGG - Intronic
1090791167 11:130091918-130091940 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1091586183 12:1818166-1818188 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1092185518 12:6475730-6475752 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1092590965 12:9952974-9952996 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1093038506 12:14354792-14354814 TGTCAGACGGGGCGGCTGCCGGG - Intergenic
1094319669 12:29171403-29171425 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1094319732 12:29171680-29171702 TGCCAGATGGGGCAGCAGCTGGG - Intronic
1094319853 12:29172234-29172256 TCCCAGATGGGGCAGCGACCAGG - Intronic
1095068828 12:37815115-37815137 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1095281105 12:40353219-40353241 TCTCAGACGGGGCAGCTGCCAGG + Intronic
1095281116 12:40353259-40353281 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1095439461 12:42227638-42227660 TCTCAGACGGGGCAGCTGCTGGG - Intronic
1095834667 12:46624677-46624699 TGGCAGATGGGGCAGAAACAGGG - Intergenic
1096041445 12:48520624-48520646 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1096093020 12:48915836-48915858 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1096856671 12:54488479-54488501 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1097110073 12:56651818-56651840 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1097128126 12:56789829-56789851 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1097230554 12:57507897-57507919 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1098018955 12:66134721-66134743 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1099255554 12:80308243-80308265 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1099971342 12:89503838-89503860 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1100398758 12:94208772-94208794 CACCAGACGGGGCACCAACCTGG - Intronic
1100507603 12:95235812-95235834 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1100582015 12:95947414-95947436 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1101885179 12:108656099-108656121 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1101885191 12:108656139-108656161 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1101885203 12:108656179-108656201 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1102175005 12:110867928-110867950 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1102186364 12:110951093-110951115 TCTCAGACGGGGCAGTTGCCAGG + Intergenic
1102268284 12:111507383-111507405 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1102578506 12:113872324-113872346 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1103299887 12:119918932-119918954 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1104712868 12:130997400-130997422 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1104920895 12:132290225-132290247 GGGCAGACGGGGCAGGCACCTGG - Intronic
1105248481 13:18673966-18673988 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1105267634 13:18836597-18836619 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1105367694 13:19779170-19779192 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1105808416 13:23972657-23972679 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1106338376 13:28805420-28805442 TTTCAGACGGTGCCGCCACCAGG + Intergenic
1106746811 13:32716460-32716482 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1106918577 13:34540631-34540653 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1107165834 13:37280412-37280434 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
1107251104 13:38363959-38363981 TCCCAGACGGGGCAGCGGCCGGG - Intergenic
1107692473 13:42966582-42966604 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1107953353 13:45485508-45485530 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1108330224 13:49378152-49378174 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1108351319 13:49592940-49592962 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1109266400 13:60205635-60205657 TCCCAGACAGGGCAGCAGCCAGG - Intergenic
1110269299 13:73574743-73574765 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1110391419 13:74979255-74979277 TGTCAGGCGGGTAAGCAAGCAGG - Intergenic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1111418360 13:87976737-87976759 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1113453832 13:110433170-110433192 TGTCAGAGGGGACAGGAGCCTGG - Intronic
1113479015 13:110606562-110606584 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1114428227 14:22639122-22639144 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1114507904 14:23232442-23232464 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1115324870 14:32127842-32127864 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1115688955 14:35824824-35824846 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1116005370 14:39285718-39285740 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1116005384 14:39285758-39285780 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1116480337 14:45389158-45389180 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1117411711 14:55456469-55456491 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1117411723 14:55456509-55456531 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1117596820 14:57333616-57333638 TCCCAGACGGGGTCGCAACCGGG - Intergenic
1118148589 14:63165596-63165618 TCTCAGACGGGGCAGTTGCCAGG - Intergenic
1118148598 14:63165636-63165658 TCTCAGACGGGGCAGCTGCTGGG - Intergenic
1118157457 14:63255652-63255674 TGTGAGACAGGGCGGCAAGCAGG - Intronic
1118184167 14:63522743-63522765 TCTCAGACGGGGCGGCTTCCGGG - Intronic
1118209365 14:63751371-63751393 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1118238987 14:64038038-64038060 TCTCAGACGGGGCAGTTGCCAGG + Intronic
1118423533 14:65633739-65633761 TCTCAGACGGGGCGGCTGCCTGG - Intronic
1118428615 14:65692703-65692725 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1118430920 14:65717701-65717723 TCCCAGACGGGGCAGCTGCCAGG + Intronic
1119700316 14:76750427-76750449 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1119868527 14:77993759-77993781 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1120155008 14:81083841-81083863 TGACAGAAGGGGAAGCAAACAGG + Intronic
1120505810 14:85352807-85352829 TCTCAGACGGGGCGGCTGCCTGG + Intergenic
1121306797 14:92911890-92911912 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1121730852 14:96186104-96186126 TGGCAGGCAGGGCAGCAGCCAGG - Intergenic
1122497967 14:102172807-102172829 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1123429703 15:20204057-20204079 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1124245811 15:28070201-28070223 TCTCAGACGGGGCAGCTGCTGGG - Intronic
1125079163 15:35656028-35656050 TCTCAGACGGGGCGGCTGCCTGG - Intergenic
1125169465 15:36749882-36749904 TGGGAGACAGGGCACCAACCAGG + Intronic
1125659127 15:41382396-41382418 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1126517196 15:49550479-49550501 TCTCAGACGGGGCAGCTGCCAGG + Intronic
1126691869 15:51294472-51294494 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1127782967 15:62332487-62332509 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1128490235 15:68135765-68135787 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1128490245 15:68135805-68135827 TCTCAGACGGGGCAGTTGCCAGG + Intronic
1128970146 15:72100759-72100781 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1129054156 15:72807307-72807329 TCTCAGACGGGGCAGTTGCCAGG + Intergenic
1129071753 15:72957203-72957225 TGGCAGAGGTGGCAGCATCCAGG + Intergenic
1129431224 15:75503435-75503457 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1130340836 15:82998367-82998389 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1130428328 15:83822271-83822293 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1130428340 15:83822311-83822333 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1130428352 15:83822351-83822373 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1130946731 15:88553676-88553698 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1131001438 15:88941985-88942007 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1131001449 15:88942025-88942047 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1131043905 15:89297113-89297135 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1131125205 15:89853908-89853930 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1131127168 15:89867811-89867833 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1131479322 15:92768326-92768348 TCTCAGACGGGGCGGCTGCCAGG + Intronic
1132776733 16:1599213-1599235 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1135575640 16:23583612-23583634 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1135575652 16:23583652-23583674 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1135694324 16:24574209-24574231 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1135694336 16:24574249-24574271 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1135694348 16:24574289-24574311 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1135694360 16:24574331-24574353 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1135694372 16:24574371-24574393 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1135694407 16:24574491-24574513 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1136160556 16:28416645-28416667 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1136202539 16:28698669-28698691 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1136425750 16:30168891-30168913 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1136514544 16:30760262-30760284 GGTGAGAGGGGGCAGCTACCAGG - Exonic
1136577671 16:31133973-31133995 TGTGAGACTGGGCAGCATCGGGG - Intronic
1136711466 16:32240464-32240486 TGGCAGGCGGGGGAGCAAGCGGG + Intergenic
1136756444 16:32688941-32688963 TGGCAGGCGGGGGAGCAAGCGGG - Intergenic
1136811667 16:33181432-33181454 TGGCAGGCGGGGGAGCAAGCGGG + Intergenic
1136818143 16:33291512-33291534 TGGCAGGCGGGGGAGCAAGCGGG + Intronic
1136824707 16:33348041-33348063 TGGCAGGCGGGGGAGCAAGCGGG + Intergenic
1136829773 16:33446812-33446834 TGGCAGGCGGGGGAGCAAGCGGG + Intergenic
1137283859 16:47000216-47000238 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1137303896 16:47181218-47181240 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1137674435 16:50297339-50297361 TGTCAGCCGGTGGAGCAGCCGGG + Intronic
1138028240 16:53539416-53539438 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1138043397 16:53698161-53698183 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1138204241 16:55113355-55113377 TGTCTGACAGGGCAGCTGCCTGG - Intergenic
1138400569 16:56740222-56740244 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1138699341 16:58846322-58846344 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1139623226 16:68163638-68163660 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1139885438 16:70204661-70204683 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1140055329 16:71520906-71520928 TGTCACACAGGTCAGCACCCAGG + Intronic
1142318092 16:89361907-89361929 GGTCAGACGGGGCAGCAATGGGG + Intronic
1202990245 16_KI270728v1_random:4401-4423 TGGCAGGCGGGGGAGCAAGCGGG + Intergenic
1203058588 16_KI270728v1_random:949295-949317 TGGCAGGCGGGGGAGCAAGCGGG - Intergenic
1142529878 17:572342-572364 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1142533617 17:598760-598782 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1142939902 17:3372060-3372082 TCTCAGACGGGGCAGTTGCCAGG + Intergenic
1142949221 17:3464779-3464801 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1143689655 17:8550447-8550469 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1144541400 17:16145769-16145791 TCCCAGACGGGGCAGCGGCCAGG - Intronic
1145047287 17:19628092-19628114 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1145205786 17:20984479-20984501 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1145717190 17:27033912-27033934 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1145862818 17:28223865-28223887 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1145895728 17:28456289-28456311 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1145896132 17:28458942-28458964 TCTCAGACGGGGGAGCTGCCGGG - Intronic
1145896144 17:28458982-28459004 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1145920249 17:28604451-28604473 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1145920260 17:28604491-28604513 TCTCAGACGGGGCAGTTGCCGGG + Intronic
1146731292 17:35195247-35195269 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1147278411 17:39337705-39337727 TCTCAGACGGGGCAACTGCCGGG - Intronic
1148016294 17:44524710-44524732 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1148162996 17:45462273-45462295 TGTCAGTCAGGGCAGCCACTGGG + Intronic
1148404269 17:47397810-47397832 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1148992696 17:51680341-51680363 TGGCAGTCTGGACAGCAACCTGG - Intronic
1148999537 17:51742840-51742862 TGTCAGAGGGAGCAGCAAGTGGG + Intronic
1149908847 17:60551313-60551335 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1149991749 17:61387400-61387422 TGTCAGAGGGGGCAGAAAGAGGG - Intronic
1150394227 17:64808928-64808950 TGTCAGTCAGGGCAGCCACTGGG + Intergenic
1150402951 17:64874366-64874388 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1150477219 17:65484502-65484524 TCTCAGACGGGGCAGCTGCCAGG - Intergenic
1150518300 17:65837562-65837584 TCCCAGACGGGGCGGCAGCCGGG - Intronic
1150557718 17:66269109-66269131 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1152280802 17:79383927-79383949 TGTCAGAGGGGGGGGCAATCAGG + Intronic
1154089615 18:11344756-11344778 TCCCAGATGGGGCAGCAGCCGGG - Intergenic
1154265150 18:12874047-12874069 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1154289959 18:13098416-13098438 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1154990273 18:21592747-21592769 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1154990285 18:21592787-21592809 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1155956460 18:31960329-31960351 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1157203464 18:45678991-45679013 TGTTAGCCAGGGCAGCACCCAGG - Exonic
1157639832 18:49202792-49202814 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1157677440 18:49578219-49578241 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1158148560 18:54343260-54343282 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1158459362 18:57633148-57633170 TCTCAGACGGGGCAGCTGCTGGG + Intergenic
1159340442 18:67126873-67126895 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG + Intergenic
1162109612 19:8393065-8393087 TGGCACACGGGGCATCACCCGGG - Intronic
1162163848 19:8739457-8739479 TCTCAGACGGGGCGGCTGCCAGG - Intergenic
1162278975 19:9680140-9680162 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1162602091 19:11676957-11676979 TCCCAGACGGGGCAGCTGCCAGG + Intergenic
1162886809 19:13703239-13703261 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1163143039 19:15363117-15363139 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1163513882 19:17751525-17751547 TGTCTGACGGGGCAGGCGCCAGG - Intronic
1163558515 19:18005863-18005885 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1163896494 19:20064565-20064587 TCTCAGACGGGGCGGCTGCCAGG + Intergenic
1163905970 19:20150245-20150267 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1164016574 19:21260177-21260199 TCCCAGACGGGGCAGCAACCGGG + Intronic
1164017330 19:21264674-21264696 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1164017410 19:21265030-21265052 TCCCAGACAGGGCAGCAGCCAGG - Intronic
1164054110 19:21607290-21607312 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1164081833 19:21866104-21866126 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1164106106 19:22107920-22107942 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1164192026 19:22925985-22926007 TCTCAGACGGGGCAGCTGCCAGG - Intergenic
1164218642 19:23173284-23173306 TCTCAGACGGGGCAGCTGCTGGG - Intergenic
1164263918 19:23594878-23594900 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1164301140 19:23964123-23964145 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1164653221 19:29901238-29901260 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1164659285 19:29949105-29949127 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1165193088 19:34079789-34079811 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1165295418 19:34922209-34922231 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1165481898 19:36069227-36069249 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1165481912 19:36069267-36069289 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1165540817 19:36491187-36491209 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1165547851 19:36556678-36556700 TGGCAGATGGGGCAGCAGCCAGG - Intronic
1165727710 19:38124198-38124220 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1166028633 19:40108913-40108935 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1166029768 19:40117979-40118001 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1166191601 19:41180271-41180293 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1166261555 19:41644709-41644731 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1166421459 19:42639718-42639740 TCTCAGACGGGGCGGCTGCCAGG + Intronic
1166421479 19:42639798-42639820 TCTCAGACGGGGCGGCTGCCAGG + Intronic
1166421491 19:42639838-42639860 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1166640194 19:44488947-44488969 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1166863978 19:45825315-45825337 TGTCAGAGGTGGCAGCACCCTGG - Exonic
1167038798 19:47009878-47009900 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1167548075 19:50141075-50141097 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1167897532 19:52593634-52593656 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1168658296 19:58147310-58147332 TCTCAGACGGGGCGGCTGCCTGG - Intronic
1168696223 19:58405502-58405524 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1168696245 19:58405582-58405604 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1168696255 19:58405622-58405644 TCTCAGACGGGGCAGTTGCCAGG + Intronic
925407581 2:3615995-3616017 TCTCAGACGGGGCGGCTGCCCGG + Intronic
926638796 2:15212798-15212820 TGGCAGAAGGGGAAGCAAACAGG - Intronic
927141311 2:20132812-20132834 TTTCAGATGGGGCAGAAAACAGG + Intergenic
927755621 2:25705764-25705786 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
928542193 2:32294263-32294285 TCTCAGACGGGGCGGCTGCCGGG + Intronic
928542205 2:32294303-32294325 TCTCAGACGGGGCGGCTGCCGGG + Intronic
928585564 2:32754974-32754996 TCTCAGACGGGGCGGCTGCCGGG + Intronic
928596899 2:32868586-32868608 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
928625495 2:33135474-33135496 TGTGAGACGGAGCAGAAACGTGG - Intronic
928888822 2:36180116-36180138 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
929062042 2:37933012-37933034 TCTCAGACGGGGCGGCTGCCGGG + Intronic
929065069 2:37964171-37964193 TCTCAGACAGGGCAGCTGCCGGG + Intronic
929415998 2:41746877-41746899 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
929447906 2:42014879-42014901 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
929516284 2:42606336-42606358 TCTCAGACGGGGCAGCTGCCGGG + Intronic
929517927 2:42621730-42621752 TCTCAGACGGGGCGGCTGCCGGG + Intronic
929614492 2:43297338-43297360 TCTCAGACGGGGCAGCTGCCGGG - Intronic
930202301 2:48557171-48557193 TCTCAGACGGGGCAGCTGCCGGG + Intronic
930396373 2:50828425-50828447 TCTCAGACGGGGCGGCTGCCGGG + Intronic
931656310 2:64512416-64512438 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
932710838 2:74061694-74061716 TCTCAGACGGGGCAGCTGCCGGG + Intronic
934309645 2:91851832-91851854 TCTCAGACGGGGTAGCTGCCGGG - Intergenic
934703448 2:96461591-96461613 TCTCAGACGGGGCAGCTGCTGGG - Intergenic
937168756 2:119844449-119844471 TCTCAGACGGGGCAGCTGCCGGG + Intronic
937437601 2:121892864-121892886 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
937519576 2:122695872-122695894 TTTCAGAGTGGGCAGCAACTTGG - Intergenic
937919574 2:127120035-127120057 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
937947471 2:127353418-127353440 TCTCAGACGGGGCGGCTGCCGGG - Intronic
938006172 2:127788897-127788919 TCTCAGACGGGGCAGCTGCCGGG + Intronic
938829100 2:135033971-135033993 TCTCAGACGGGGCGGCTGCCGGG + Intronic
938829110 2:135034011-135034033 TCTCAGACGGGGCAGTTGCCAGG + Intronic
938836224 2:135105991-135106013 TCTCAGACGGGGCAGCTGCCGGG - Intronic
940299139 2:152160488-152160510 TCTCAGACGGGGCGGCTGCCGGG - Intronic
940635585 2:156293621-156293643 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
941005185 2:160240348-160240370 TGGCAGACGGTGAAGCAGCCAGG + Intronic
941025109 2:160449053-160449075 TCCCAGACGGGGCAGCTGCCGGG - Intronic
941197566 2:162470426-162470448 TCTCAGACGGGGCGGCTGCCGGG - Intronic
941603189 2:167564099-167564121 TCTCAGACGGGGCGGCTGCCTGG + Intergenic
941612412 2:167677831-167677853 TGGCAGAAGGGGAAGCAAACAGG + Intergenic
941793363 2:169575482-169575504 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
941814809 2:169786568-169786590 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
942012190 2:171774789-171774811 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
942021039 2:171866909-171866931 TCTCAGACGGGGCAGTTGCCAGG + Intronic
942024705 2:171900038-171900060 TCCCAGACGGGGCGGCTACCGGG - Intronic
942096164 2:172537930-172537952 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
942338875 2:174921684-174921706 TGGCAGAAGGGGAAGCAAACAGG + Intronic
942946944 2:181682660-181682682 TGCCAGTCGGGGCAGCTGCCGGG - Intergenic
943005801 2:182386684-182386706 TCCCAGACGGGGCAGCTGCCGGG - Intronic
943297188 2:186154207-186154229 TCTCACACGGGGCAGCTGCCAGG + Intergenic
943323439 2:186473008-186473030 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
943578045 2:189653656-189653678 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
944060696 2:195567942-195567964 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
944175872 2:196828883-196828905 CCTCAGATGGGACAGCAACCTGG + Intergenic
944255321 2:197618845-197618867 TCTCAGACGGGGCGGCTGCCGGG - Intronic
944733058 2:202535281-202535303 TCTCAGACGGGGCGGCTGCCGGG + Intronic
944797942 2:203207178-203207200 TCTCAGACGGGGCGGCTGCCGGG - Intronic
944815586 2:203372706-203372728 TCTCAGACGGGGCGGCTGCCGGG + Intronic
945115163 2:206401464-206401486 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
945316670 2:208377649-208377671 TCTCAGACGGGGCAGCTGCCGGG + Intronic
945530807 2:210950860-210950882 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
945975616 2:216268200-216268222 TGTCAGACCTGGAAGGAACCTGG + Intronic
946304192 2:218846699-218846721 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
946742586 2:222816355-222816377 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
947797781 2:232905784-232905806 TCTCAGACGGGGCGGCTGCCAGG - Intronic
947901402 2:233724436-233724458 TCTCAGACAGGGCAGCTGCCGGG + Intronic
1169370814 20:5027605-5027627 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1169718278 20:8644554-8644576 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1169718290 20:8644594-8644616 TCTCAGACAGGGCAGCTGCCAGG - Intronic
1170423819 20:16218528-16218550 TGGCAGACGGGACACCTACCTGG + Intergenic
1170425053 20:16227945-16227967 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1170623152 20:18010751-18010773 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1170811628 20:19678739-19678761 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1171463645 20:25312861-25312883 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1171848494 20:30291888-30291910 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1171951635 20:31427099-31427121 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1171957504 20:31471639-31471661 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1172059052 20:32176131-32176153 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1172141182 20:32723933-32723955 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1172258081 20:33536571-33536593 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1172279943 20:33701488-33701510 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1172349944 20:34230869-34230891 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1172401945 20:34658752-34658774 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1172401957 20:34658792-34658814 TCTCAGACGGGGCGGCTGCCAGG - Intronic
1172575038 20:36001593-36001615 TCTCAGACGGGGCGGCTGCCAGG + Intronic
1172728892 20:37069637-37069659 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1172735830 20:37126019-37126041 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1172910741 20:38407443-38407465 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
1173508452 20:43607406-43607428 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1174218875 20:48936446-48936468 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1174254909 20:49247314-49247336 TGTCAGACCAGGCAGCATGCTGG + Exonic
1174344852 20:49922209-49922231 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1175361438 20:58414421-58414443 CCTCAGACGGGGCAGCCGCCGGG + Intronic
1176104806 20:63380918-63380940 TGCCACAGGGGGCAGCACCCAGG - Intergenic
1176143413 20:63554835-63554857 TGGGAGCCGGGGCAGCAACCAGG + Exonic
1177134188 21:17292289-17292311 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1177178530 21:17720686-17720708 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1178034391 21:28564009-28564031 TCTCAGACGGGGCAGTTGCCAGG - Intergenic
1178396954 21:32251074-32251096 TGGCAGAAGGGGAAGCAAACAGG - Intergenic
1178782757 21:35620954-35620976 TGGCAGAAGGGGAAGCAAACAGG - Intronic
1179803347 21:43822345-43822367 TCCCAGACGGGGCAGCTGCCAGG - Intergenic
1180739311 22:18041742-18041764 TCTCAGACGGGGCAGTTGCCGGG + Intergenic
1180830045 22:18900470-18900492 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1180861276 22:19084439-19084461 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1180861290 22:19084479-19084501 TCTCAGACGGGGCGGCTCCCGGG - Intronic
1180861302 22:19084519-19084541 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1181054384 22:20253161-20253183 TGGAAGAGGGGGCAGCAGCCAGG + Intronic
1181273991 22:21677126-21677148 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1181617561 22:24065242-24065264 TCTCAGACGGGGCGGCTGCCAGG + Intronic
1181982255 22:26773578-26773600 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1182399806 22:30066778-30066800 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1182484557 22:30631727-30631749 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1182976327 22:34626251-34626273 TCTCAGACGGGGCGGCTGCCAGG + Intergenic
1183484064 22:38080040-38080062 TGTGAGATGGTGCAGTAACCAGG - Intronic
1183595218 22:38807094-38807116 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1183841521 22:40502257-40502279 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1183845225 22:40536903-40536925 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1183940928 22:41294771-41294793 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1184281946 22:43442411-43442433 AGTCAGAAGGGGCAGCCACGGGG - Intronic
1184343334 22:43898137-43898159 TGTCAGACTTGGCAGCATCCTGG - Intergenic
1184722332 22:46322266-46322288 TGTCTGTGGGGGCAGCAGCCTGG + Intronic
1203280136 22_KI270734v1_random:125741-125763 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
949853388 3:8440054-8440076 TCTCAGACGGGGCGGCTTCCGGG - Intergenic
950253749 3:11487839-11487861 TCTCAGACGGGGCAGCCTGCCGG + Intronic
950327201 3:12121900-12121922 GGTAAGACGGGGCAGCAGGCTGG + Intronic
950742388 3:15061935-15061957 TCTCAGACGGGGCGGCTGCCGGG - Intronic
951013620 3:17705444-17705466 TCTCAGACGGGGCAGCTGTCGGG + Intronic
951290491 3:20867028-20867050 TCTCAGACGGGGCGGCTGCCAGG + Intergenic
952896565 3:38081992-38082014 TCTCAGACGGGGCAGCTGCCGGG + Intronic
953230979 3:41064848-41064870 TGGCAGACAGAGCAGCAGCCTGG - Intergenic
953426009 3:42797747-42797769 TCTCAGACGGGGCAGCTGCCGGG - Intronic
953652767 3:44821360-44821382 TCTCAGACGGGGCGGCTTCCGGG + Intronic
953922807 3:46964175-46964197 TCTCAGACGGGGCGGCTGCCAGG - Intronic
953922817 3:46964215-46964237 TCTCAGACGGGGCAGCTGCCGGG - Intronic
954048347 3:47952109-47952131 TCTCAGACGGGGCAGCTGCCGGG - Intronic
954059298 3:48056003-48056025 TCTCAGACGGGGCAGCTGCCGGG - Intronic
954080639 3:48211327-48211349 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
954162744 3:48734306-48734328 TCTCAGACGGGGCGGCTGCCAGG - Intronic
954356275 3:50085085-50085107 TCTCAGACGGGGCGGCTGCCTGG + Intronic
954523337 3:51248991-51249013 TCTCAGACGGGGCGGCTGCCGGG - Intronic
954529781 3:51308820-51308842 TCTCAGACGGGGCGGCTGCCGGG + Intronic
954529793 3:51308860-51308882 TCTCAGACGGGGCGGCTGCCGGG + Intronic
955173017 3:56584248-56584270 TCTCAGACGGGGCGGCTGCCGGG + Intronic
955173040 3:56584328-56584350 TCTCAGACGGGGCGGCTGCCGGG + Intronic
955173051 3:56584368-56584390 TCTCAGACGGGGCGGCTGCCGGG + Intronic
955297338 3:57747421-57747443 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
955394911 3:58550328-58550350 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
955674554 3:61434925-61434947 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
956270326 3:67443850-67443872 TCTCAGACGGGGCAGCTGCCGGG - Intronic
957035457 3:75289505-75289527 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
957316804 3:78583534-78583556 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
958406637 3:93762603-93762625 TCCCAGACGGGGCAGCAGCTGGG + Intergenic
958808920 3:98838243-98838265 TCTCAGACGGGGCAGCTGCCGGG + Intronic
959221925 3:103531559-103531581 TGCCAGACGGGGCAGCTGGCCGG + Intergenic
959419476 3:106112171-106112193 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
959683775 3:109124172-109124194 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
960625010 3:119674010-119674032 TCCCAGACGGGGCAGCAGCCGGG - Intronic
960625019 3:119674050-119674072 TCCCAGACGGGGCAGCAGCTGGG - Intronic
960862007 3:122164491-122164513 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
960918845 3:122725364-122725386 TCCCAGACGGGGCAGCGGCCGGG + Intronic
960924417 3:122780751-122780773 TCTCAGACGGGGCGGCTGCCGGG + Intronic
960962962 3:123084866-123084888 CCTCAGACTGGGCAGCAGCCAGG - Intronic
961704426 3:128773355-128773377 TCTCAGACGGGGCGGCTGCCGGG - Intronic
961729212 3:128954404-128954426 TCTCAGACGGGGCAGCTGCCGGG - Intronic
962063194 3:131952362-131952384 TCTCAGACGGGGCGGCTGCCGGG - Intronic
962113067 3:132471442-132471464 TCTCAGACGGGGCAGCTGCCAGG + Intronic
963249106 3:143086864-143086886 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
965650053 3:170923716-170923738 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
965650076 3:170923796-170923818 TGTCAGATGGGGCGGCTGCCAGG - Intergenic
966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG + Intergenic
966255722 3:177914549-177914571 TCCCAGACAGGGCAGCAGCCAGG + Intergenic
966359567 3:179119956-179119978 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
966966927 3:185003755-185003777 TCTCAGACGGGGCGGCTGCCAGG + Intronic
966966939 3:185003795-185003817 TCTCAGACGGGGCGGCTGCCGGG + Intronic
967173431 3:186842182-186842204 TGTCAGAGGGGTCTGCAATCAGG - Intergenic
967739615 3:192990708-192990730 TGTAAGACGTGGCAGCAAAGGGG + Intergenic
968201833 3:196761933-196761955 TCTCAGACGGGGCAGCTGCCGGG + Intronic
968411649 4:395753-395775 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
969384726 4:6837105-6837127 TCCCAGACGGGGCAGCGGCCGGG + Intronic
969475655 4:7421198-7421220 AGTCAGAGGGGGCACCCACCTGG + Intronic
970785011 4:19784814-19784836 TGGCAGAAGGGGAAGCAAACAGG + Intergenic
972304702 4:37820469-37820491 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
972551781 4:40141323-40141345 TGTCAGACGGGGCGGCTTCCGGG + Intronic
972939757 4:44182012-44182034 TCTCAGACAGGGCAGCTGCCAGG - Intronic
973021213 4:45207659-45207681 TCTCAGACGGGGCGGCTGCCAGG - Intergenic
973274385 4:48292522-48292544 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
973281509 4:48364072-48364094 TCTCAGACGGGGCAGCTGCCGGG + Intronic
973593417 4:52464903-52464925 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
973664099 4:53139522-53139544 TCCCAGACGGGGCAGCTGCCGGG - Intronic
973664132 4:53139603-53139625 TCCCAGACGGGGCAGCAGCCGGG - Intronic
973675244 4:53256161-53256183 TCTCAGACGGGGCGGCTGCCGGG + Intronic
973785059 4:54325718-54325740 TCTCAGATGGGGCAGCTACTGGG + Intergenic
973785068 4:54325758-54325780 TCTCAGACGGGGCAGTTGCCAGG + Intergenic
976265081 4:83182276-83182298 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
976607392 4:86995991-86996013 TCTCAGACGGGGCGGCTGCCGGG - Intronic
977205110 4:94158033-94158055 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
977205122 4:94158073-94158095 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
977205132 4:94158113-94158135 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
978376162 4:108077401-108077423 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376187 4:108077481-108077503 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376200 4:108077521-108077543 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376213 4:108077561-108077583 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376226 4:108077601-108077623 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376239 4:108077641-108077663 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376261 4:108077721-108077743 TCCCAGATGGGGCAGCAGCCGGG - Intronic
978519047 4:109597791-109597813 TCTCAGACGGGGCAGCTGCTGGG + Intronic
978519780 4:109603742-109603764 TCCCAGACGGGGCAGCTGCCGGG - Intronic
978820253 4:112957791-112957813 TCTCAGACGGGGCGGCTGCCGGG + Intronic
980056540 4:128083898-128083920 TCTCAGACGGGGCGGCTGCCGGG + Intronic
980883628 4:138739282-138739304 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
980883639 4:138739322-138739344 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
980883651 4:138739362-138739384 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
980883663 4:138739402-138739424 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
980895155 4:138854229-138854251 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
981524100 4:145693980-145694002 TCTCAGACGGGGCAGCTGCCGGG + Intronic
981970425 4:150659516-150659538 TCTCAGACGGGGCAGCTGCCGGG - Intronic
982026158 4:151255223-151255245 TCTCAGACGGGGCGGCTGCCGGG + Intronic
982723485 4:158882224-158882246 TCTCAGACGGGGCGGCTGCCGGG - Intronic
982820929 4:159939851-159939873 TCTCAAACGGGGCAGCTGCCGGG + Intergenic
984037871 4:174692111-174692133 TCTCAGACGGGGCAGTTGCCAGG - Intronic
984638533 4:182140473-182140495 TTGCAGCCGGGGCAGCAACTGGG + Intergenic
984728130 4:183040846-183040868 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
985966335 5:3341363-3341385 TGTAAGACGGGGCAACAGCAAGG - Intergenic
987268018 5:16277133-16277155 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
988544324 5:32142363-32142385 TCTCAGACGGGGCGGCTGCCGGG - Intronic
988551982 5:32208038-32208060 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
988760671 5:34306906-34306928 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
989021521 5:37013444-37013466 TCTCAGACGGGGCGGCTGCCGGG + Intronic
989061584 5:37415707-37415729 TCTCAGACGGGGCGGCTGCCAGG + Intronic
989061596 5:37415747-37415769 TCTCAGACGGGGCGGCTGCCGGG + Intronic
989068173 5:37483831-37483853 TCTCAGACGGGGCGGCTGCCGGG + Intronic
989211591 5:38862516-38862538 TCTCAGACGGGGCAGTTGCCGGG + Intronic
989252671 5:39334411-39334433 TCTCAGACGGGGCGGCTGCCGGG - Intronic
989300163 5:39881704-39881726 TGGCAGAAGGGGAAGCAAACAGG + Intergenic
989633492 5:43511240-43511262 TCTCAGACGGGGCGGCTGCCAGG - Intronic
989634842 5:43522220-43522242 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
989655910 5:43746211-43746233 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
990297757 5:54420640-54420662 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
990459094 5:56015169-56015191 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
990709219 5:58563674-58563696 TCCCAGACGGGGCGGCAGCCAGG + Intergenic
990871021 5:60431269-60431291 TCTCAGACGGGGCAGCTGCCGGG + Intronic
991127391 5:63083940-63083962 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
991375079 5:65957853-65957875 TCTCAGACGGGGCGGCTGCCGGG + Intronic
991377047 5:65977393-65977415 TCTCAGACGGGGCGGCTGCCGGG + Intronic
991597907 5:68323830-68323852 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
991910124 5:71552096-71552118 TCTCAGACGGGGCGGCTGCCGGG + Intronic
992289619 5:75270339-75270361 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
992540724 5:77761028-77761050 TCCCAGACGGGGCGGCAGCCGGG - Intronic
992574446 5:78096730-78096752 TCTCAGACGGGGCAGTTGCCGGG - Intronic
993657881 5:90595986-90596008 TTTCAGACGGGGCGGCTGCCGGG + Intronic
995193298 5:109341439-109341461 TCTCAGACGGGGCAGCTGCCGGG - Intronic
996054115 5:118965159-118965181 TCTCAGACAGGGCAGCTGCCGGG - Intronic
996386350 5:122913618-122913640 TCTCAGACGGGGCGGCTGCCAGG + Intronic
997875011 5:137538430-137538452 TCTCAGACGGGGCGGCTGCCAGG + Intronic
997875062 5:137538664-137538686 TCCCAGACGGGGTAGCAGCCGGG + Intronic
998239491 5:140427872-140427894 TCTCAGACGGGGCGGCTGCCAGG + Intronic
998432198 5:142076539-142076561 TCTCAGACGGGGCAGCTGCCCGG + Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999455657 5:151714122-151714144 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
999532662 5:152480086-152480108 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
999986999 5:157014262-157014284 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1000630220 5:163583742-163583764 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1000985350 5:167859269-167859291 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1001077908 5:168643629-168643651 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1001394249 5:171404332-171404354 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1002013641 5:176304985-176305007 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1002115763 5:176961430-176961452 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1002377254 5:178797305-178797327 TGTAACACGGGTCAGCATCCTGG + Intergenic
1003097001 6:3150064-3150086 TGTGAAACTGGGCAGCAACATGG - Intronic
1004388062 6:15188926-15188948 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1004731776 6:18366307-18366329 TGGCTGAGGGGGCAGCAGCCTGG + Intergenic
1004874612 6:19940145-19940167 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1005644710 6:27827672-27827694 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1005901701 6:30222134-30222156 TCCCAGACGGGGCAGCTGCCAGG + Intergenic
1006004772 6:30993296-30993318 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1006128524 6:31854563-31854585 TCTCAGACGGGGCAGTTGCCGGG + Intergenic
1006149051 6:31976320-31976342 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1006232462 6:32596150-32596172 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1006452185 6:34111692-34111714 GGTCAGAATGGGCAGCAGCCAGG + Intronic
1006492244 6:34397459-34397481 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1006617565 6:35340534-35340556 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1006623561 6:35383828-35383850 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1006826831 6:36941703-36941725 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1007377842 6:41468657-41468679 GGCCAGAAGGGGCATCAACCTGG - Intergenic
1007523013 6:42466554-42466576 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1007674317 6:43581090-43581112 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1008112205 6:47505998-47506020 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1008184364 6:48371410-48371432 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1008624766 6:53305477-53305499 TCTCAGACGGGGCAGTTGCCAGG + Intronic
1008919231 6:56824765-56824787 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1010030516 6:71266711-71266733 TCTCAGACGGGGCAGTTGCCAGG + Intergenic
1010239250 6:73601302-73601324 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1010264440 6:73851247-73851269 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1010272028 6:73925896-73925918 TCCCAGACGGGGCAGCGGCCGGG + Intergenic
1011426842 6:87239625-87239647 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1011426854 6:87239665-87239687 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1011474218 6:87736105-87736127 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1011588084 6:88947443-88947465 TCTCAGACAGGGCAGCTGCCGGG - Intronic
1011588232 6:88947894-88947916 TCTCAGACAGGGCAGCTGCCGGG - Intronic
1012428690 6:99142136-99142158 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1012479400 6:99650347-99650369 TCTCAGACGGGGCGGCCGCCGGG + Intergenic
1013204564 6:107934513-107934535 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1013530785 6:111017449-111017471 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1014463669 6:121729755-121729777 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1014557136 6:122849504-122849526 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1014800335 6:125770917-125770939 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1015070633 6:129088666-129088688 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1015476652 6:133664769-133664791 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1016973607 6:149786511-149786533 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1017493793 6:154966383-154966405 TCTCAGACGGGGCGGCTGCCAGG + Intronic
1017493805 6:154966423-154966445 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1017493817 6:154966463-154966485 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1017493828 6:154966503-154966525 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1018295324 6:162339051-162339073 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1018295347 6:162339131-162339153 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1019439098 7:1038045-1038067 TCTCAGACAGGGCAGCTGCCGGG - Intronic
1019445744 7:1070147-1070169 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1019669103 7:2268340-2268362 TCTCAGACAGGGCAGCTGCCGGG - Intronic
1019715005 7:2534482-2534504 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1020761127 7:12269377-12269399 TCTAAGCCGGGGCTGCAACCTGG + Intergenic
1020831702 7:13102713-13102735 TCTCAGACGGGGCAGCTGCTGGG - Intergenic
1021647361 7:22800926-22800948 TCTCAGACGGGGCAGTTGCCAGG - Intergenic
1021647371 7:22800966-22800988 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1021672482 7:23046610-23046632 TCTCAGACGGGGCAACTGCCGGG + Intergenic
1021991858 7:26148178-26148200 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1022071921 7:26924484-26924506 TGTCTGAGAGGGCATCAACCTGG - Intronic
1024305138 7:47922670-47922692 TCCCAGACGGGGCAGCTGCCGGG - Intronic
1024625823 7:51208229-51208251 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1024989198 7:55220386-55220408 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1025000569 7:55311935-55311957 TCTCAGACGGGGCAGTTGCCGGG - Intergenic
1025000580 7:55311975-55311997 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1025775202 7:64554427-64554449 TCCCAGACGGGGCAGCGGCCGGG - Intronic
1025808276 7:64856310-64856332 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1026783447 7:73284520-73284542 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1026862090 7:73797318-73797340 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1028535741 7:91888019-91888041 TTCCAGACGGGGCAGCTGCCGGG - Intergenic
1028595661 7:92545050-92545072 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1028685617 7:93586282-93586304 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1028685629 7:93586322-93586344 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1029279452 7:99426975-99426997 TCTCAGACGGGGCGGCTGCCAGG - Intronic
1029468965 7:100742063-100742085 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1029525703 7:101092507-101092529 TCTCAGACGGGGCGGCTGCCAGG - Intergenic
1029569312 7:101359492-101359514 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1029813171 7:103069267-103069289 TTCCAGATGGGGCGGCAACCAGG - Intronic
1029960692 7:104686843-104686865 TGGCAGAAGGGGAAGCAAACAGG + Intronic
1030288304 7:107848272-107848294 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1030602765 7:111610069-111610091 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1032028660 7:128463619-128463641 TGCCAGACGGGGCGGCTGCCGGG - Intergenic
1032056653 7:128689512-128689534 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1032056665 7:128689552-128689574 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1032056677 7:128689592-128689614 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1032156888 7:129476333-129476355 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1032156900 7:129476373-129476395 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1032156912 7:129476413-129476435 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1033294048 7:140114850-140114872 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1033294060 7:140114890-140114912 TCTCAGACGGGGCGGCTTCCGGG - Intronic
1034034148 7:147802052-147802074 TCTCAGACGGGGCAGTTGCCGGG + Intronic
1034322501 7:150198603-150198625 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1034322511 7:150198643-150198665 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1035507993 8:150126-150148 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1036445835 8:8821146-8821168 TGTCAGAGGGAGCAGCTGCCAGG + Intronic
1036482968 8:9154083-9154105 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1036536757 8:9657837-9657859 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1036624969 8:10462886-10462908 TGGCAGAAGGGGAAGCAAACAGG + Intergenic
1036737185 8:11329996-11330018 TCCCAGACGGGGCAGCTGCCAGG - Intergenic
1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG + Intergenic
1037756271 8:21712243-21712265 TCTCAGACGGGGCGGCTGCCAGG + Intronic
1039488202 8:37927880-37927902 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1039533771 8:38288705-38288727 TCTCTGACAGGTCAGCAACCTGG + Exonic
1039750637 8:40475183-40475205 CTTCAGATGGGGCAGCAAACAGG - Intergenic
1040043515 8:42939719-42939741 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1040043526 8:42939759-42939781 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1040616231 8:49041491-49041513 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1041070747 8:54125324-54125346 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1041362933 8:57071517-57071539 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1041796658 8:61753279-61753301 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1041920851 8:63180171-63180193 TCTCAGACGGGGCGGCTTCCGGG + Intronic
1042048931 8:64685664-64685686 TCTCAGACGGGGCAGCTGCGGGG - Intronic
1042134014 8:65616892-65616914 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1042134028 8:65616932-65616954 TCCCAGACGGGGCAGCTGCCGGG - Intronic
1042196051 8:66232385-66232407 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1042215258 8:66424784-66424806 TATCAGTCAGGGCAGCAAACAGG + Intergenic
1042290726 8:67167493-67167515 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1042290750 8:67167573-67167595 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1042303534 8:67310856-67310878 TCTCAGACGGGGCAGCTGCCAGG - Intronic
1042710726 8:71714034-71714056 TGGCAGAAGGGGAAGCAAACAGG - Intergenic
1044223645 8:89698791-89698813 TCTCAGACGGGGCAGTTGCCGGG - Intergenic
1044660582 8:94590694-94590716 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1044996310 8:97841097-97841119 TCCCAGATGGGGCAGCAGCCGGG + Intronic
1045120446 8:99028974-99028996 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1045195638 8:99927302-99927324 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1045298707 8:100892795-100892817 TCTCAGACGGGGCGGCTGCCAGG + Intergenic
1047687230 8:127316320-127316342 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1047782144 8:128118974-128118996 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1047848165 8:128826703-128826725 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1048848285 8:138620263-138620285 GGGCAGAAGGGGCAGCAAGCTGG + Intronic
1049481617 8:142827049-142827071 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1049819120 8:144623767-144623789 TGTCAGAGGCCGCAGCACCCAGG + Intergenic
1050557078 9:6798838-6798860 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1050558170 9:6807681-6807703 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1051276870 9:15406625-15406647 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1051661892 9:19434009-19434031 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1052236133 9:26214898-26214920 TCTCAGACGGGGCGGCGGCCAGG + Intergenic
1052881046 9:33601047-33601069 TCTCAGACGGGGCGGCTGCCAGG - Intergenic
1052887983 9:33667752-33667774 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1052887993 9:33667792-33667814 TCTCAGACGGGGTAGCTGCCGGG - Intergenic
1053048121 9:34936868-34936890 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1053457187 9:38242030-38242052 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1054359703 9:64101064-64101086 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1055133945 9:72806497-72806519 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1055133956 9:72806537-72806559 TCTCAGACGGGGCAGTTGCCGGG + Intronic
1055137550 9:72841608-72841630 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1055214916 9:73847674-73847696 TGCTAGATGTGGCAGCAACCAGG - Intergenic
1055414352 9:76064607-76064629 TCTCAGACGGGGCAGCTGCCAGG + Intronic
1055960281 9:81813976-81813998 TTTAAGACTGGGCAGCAGCCAGG - Intergenic
1056020122 9:82431763-82431785 TCTCAGACGGTGGAGCAGCCGGG + Intergenic
1056097832 9:83272899-83272921 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1056326796 9:85486807-85486829 TTTCTGATGTGGCAGCAACCTGG + Intergenic
1056336447 9:85573903-85573925 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1057087848 9:92227572-92227594 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1057155115 9:92831695-92831717 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1057751496 9:97796603-97796625 TCTCAGACGGGGCGGCTGCCAGG - Intergenic
1058659954 9:107257704-107257726 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1058722519 9:107776155-107776177 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1059118141 9:111617572-111617594 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1059120782 9:111640725-111640747 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1059210977 9:112514190-112514212 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1059707795 9:116840614-116840636 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1060041517 9:120305058-120305080 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1060064897 9:120495543-120495565 TCTCAGATGGGGCAGCTGCCGGG - Intronic
1060350100 9:122852296-122852318 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1060625562 9:125108591-125108613 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1060625574 9:125108631-125108653 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1060669783 9:125459011-125459033 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1060687052 9:125623595-125623617 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1061143069 9:128780236-128780258 TCTCAGACGGGGCAGTTGCCAGG - Intergenic
1061635831 9:131908017-131908039 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1061983974 9:134118576-134118598 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1186922978 X:14302774-14302796 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1187183741 X:16965462-16965484 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1187184316 X:16968922-16968944 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1187976577 X:24709586-24709608 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1188477090 X:30602290-30602312 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1189056864 X:37707442-37707464 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1189056875 X:37707482-37707504 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1189056886 X:37707522-37707544 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1189361720 X:40358758-40358780 TGGCTGAGGGGGCAGCAGCCTGG + Intergenic
1189505852 X:41612419-41612441 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1189570026 X:42285816-42285838 TCTCAGACAGGGCAGCTGCCGGG + Intergenic
1189587246 X:42474140-42474162 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1189587257 X:42474180-42474202 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1189825292 X:44911303-44911325 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1189955807 X:46275508-46275530 TCTCAGACAGGGCAGCTGCCGGG - Intergenic
1189968607 X:46396232-46396254 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1189968619 X:46396272-46396294 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1190171505 X:48115401-48115423 TCTCAGACGGGGCAGTTGCCAGG - Intergenic
1190184508 X:48222431-48222453 TCTCAGACGGGGCAGTTGCCAGG - Intronic
1190505247 X:51119650-51119672 TCCCAGACGGGGCAGCTGCCAGG + Intergenic
1190680948 X:52827064-52827086 TCTCAGACGGGGCAGCTGCCAGG + Intergenic
1190769609 X:53504167-53504189 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1190778948 X:53578244-53578266 TCTCAGACGGGGCGGCGGCCGGG - Intronic
1190820311 X:53967031-53967053 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1190839171 X:54129257-54129279 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1190891522 X:54572782-54572804 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1191069004 X:56380362-56380384 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1191069014 X:56380402-56380424 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1192474373 X:71427039-71427061 TGTCAGAAGGGGCAGAGAACTGG + Intronic
1192477004 X:71452257-71452279 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1192610305 X:72559959-72559981 TCCCAGACGGGGCAGCGGCCGGG - Intronic
1192621197 X:72681324-72681346 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1192794200 X:74412782-74412804 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1192794212 X:74412822-74412844 TCTCAGACGGGGCGGCTGCCGGG + Intergenic
1192969896 X:76218417-76218439 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1193068041 X:77279380-77279402 TCTCAGACGGGGCAGTTGCCAGG - Intergenic
1193068051 X:77279420-77279442 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1193114854 X:77766417-77766439 TCTCAGACGGGGCGGCTGCCAGG + Intronic
1193362202 X:80591188-80591210 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1193362215 X:80591228-80591250 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
1193372334 X:80712868-80712890 TCTCAGACGGGGCAGTTGCCAGG - Intronic
1193372344 X:80712908-80712930 TCTCAGACGGGGCGGCTGCCGGG - Intronic
1194241811 X:91458338-91458360 TGGCAGAAGGGGAAGCAAACAGG - Intergenic
1194714681 X:97275514-97275536 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1194714693 X:97275554-97275576 TCTCAGACGGGGCGGCTGCCGGG + Intronic
1194732776 X:97475115-97475137 TGTCAGATAAGGCAGCAGCCAGG - Intronic
1195036205 X:100972910-100972932 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1195257578 X:103104672-103104694 TCTCAGACGGGGCAGCTGCCAGG + Intergenic
1195706782 X:107743072-107743094 GGTCAGACGGGGCAGTGTCCAGG - Intronic
1196404497 X:115347786-115347808 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1196778526 X:119362115-119362137 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1197199301 X:123734288-123734310 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1197452933 X:126641477-126641499 TCTCAGACGGGGCGGCTGCCGGG - Intergenic
1198260414 X:134960419-134960441 TCTCAGACGGGGCGGCTGCCAGG - Intergenic
1199452707 X:147992613-147992635 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1199782321 X:151073880-151073902 TCCCAGACGGGGCAGCAGCTGGG + Intergenic
1200088288 X:153622202-153622224 TGTCAAACCGGGCAGCCACTCGG + Intergenic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic