ID: 917458294

View in Genome Browser
Species Human (GRCh38)
Location 1:175204771-175204793
Sequence CCTCCTGAGGAGCTGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917458294_917458300 -9 Left 917458294 1:175204771-175204793 CCATCCAGCAGCTCCTCAGGAGG 0: 1
1: 0
2: 2
3: 36
4: 350
Right 917458300 1:175204785-175204807 CTCAGGAGGTCAGGAACACAGGG 0: 1
1: 0
2: 0
3: 33
4: 361
917458294_917458302 14 Left 917458294 1:175204771-175204793 CCATCCAGCAGCTCCTCAGGAGG 0: 1
1: 0
2: 2
3: 36
4: 350
Right 917458302 1:175204808-175204830 GACACTGCCTGATGAGACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 153
917458294_917458301 -8 Left 917458294 1:175204771-175204793 CCATCCAGCAGCTCCTCAGGAGG 0: 1
1: 0
2: 2
3: 36
4: 350
Right 917458301 1:175204786-175204808 TCAGGAGGTCAGGAACACAGGGG 0: 1
1: 0
2: 4
3: 34
4: 523
917458294_917458299 -10 Left 917458294 1:175204771-175204793 CCATCCAGCAGCTCCTCAGGAGG 0: 1
1: 0
2: 2
3: 36
4: 350
Right 917458299 1:175204784-175204806 CCTCAGGAGGTCAGGAACACAGG 0: 1
1: 0
2: 1
3: 23
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917458294 Original CRISPR CCTCCTGAGGAGCTGCTGGA TGG (reversed) Intergenic
900136737 1:1120971-1120993 CCTCAGGAGGAGCTGCTGTTTGG - Intergenic
900497518 1:2982770-2982792 CCTCGTCAGGAGCTTCGGGAGGG + Intergenic
900754426 1:4423901-4423923 GCCCATGAGGAGCTGGTGGATGG - Intergenic
901301453 1:8202573-8202595 CCGTCAGAGGAGCTGCTGCAGGG + Intergenic
901685582 1:10941789-10941811 CCTTCTGAGGGGCCTCTGGAGGG - Intergenic
903029353 1:20451878-20451900 CCTGCTGAGGGGTTGCTGGAGGG - Intergenic
903767358 1:25743400-25743422 CCTCCTGGGGAGCTGCCCCAGGG + Intronic
907230689 1:52995808-52995830 GCACCTGAAGAGCTCCTGGATGG - Intronic
907799585 1:57751413-57751435 GCTCCTGAGCAGCAACTGGAGGG + Intronic
908527400 1:65001343-65001365 CCTCCTGCGGAGCTGGGGGCGGG + Intergenic
909480326 1:76123255-76123277 CCTCCCGAGTAGCTGGTAGATGG - Intronic
910449613 1:87331895-87331917 CTCCCCGCGGAGCTGCTGGAAGG - Intronic
911176999 1:94826975-94826997 GCCCCTGGGGAGCTGCAGGAGGG + Intronic
913336555 1:117714009-117714031 ACTCCCTAGGAGCTGCTGAAAGG + Intergenic
914731132 1:150371483-150371505 CCTCCTGAGTAGCTGGTAGCTGG + Intronic
916071137 1:161170611-161170633 CCTCCTTAGGTGATGCTGGGAGG + Exonic
917458294 1:175204771-175204793 CCTCCTGAGGAGCTGCTGGATGG - Intergenic
918000017 1:180484947-180484969 CCTCCTGAGTAGCTGGTAGCTGG - Intronic
918263499 1:182818543-182818565 CGTGCTGAGGAGTTGTTGGATGG + Exonic
919887466 1:201945397-201945419 TCTCCAGAGGAGCCTCTGGAGGG - Intronic
920377852 1:205518946-205518968 CCCACTGAGGAGCTGCAGGGTGG - Intronic
921157569 1:212450251-212450273 CCTCCTGAGATGCTGCTGTGAGG + Intergenic
921785052 1:219220011-219220033 CCTTCTGTGTAGCTACTGGAGGG + Intergenic
922518882 1:226228796-226228818 CCTCCTGAGCACCTCCAGGATGG - Intergenic
922851800 1:228738997-228739019 CCTCCTGAGTGGCTGGTGGCTGG - Intronic
923109665 1:230880483-230880505 ACCCCTGAGCAGCTGCTGCAAGG + Intergenic
923537664 1:234865374-234865396 CCTCCTGCTGATCTGCTGCATGG + Intergenic
1063188575 10:3671742-3671764 CCTCTTGAAGAGGTGGTGGAGGG + Intergenic
1063333790 10:5189030-5189052 CCTCAAGAGGAGGTGCTGAATGG + Intergenic
1063371858 10:5527402-5527424 ATTCCTGAGGGGATGCTGGATGG + Intergenic
1065081742 10:22136223-22136245 CCTCCTAAGCAGCTGGGGGAAGG + Intergenic
1065444360 10:25782313-25782335 CCTCCCAAGTAGCTGCTGGAGGG - Intergenic
1066268252 10:33797240-33797262 CCTCCTGAGTAGCTGGTAGCTGG - Intergenic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1069304546 10:66952343-66952365 CCTCCTGATGAGCTGTTGAAAGG - Intronic
1069455648 10:68551851-68551873 CCTCCAGAGTAGCTGGTGGGTGG + Intergenic
1069994999 10:72336536-72336558 CCTCCGGAACAACTGCTGGAAGG - Exonic
1071420509 10:85492642-85492664 CCTGAGGAGGGGCTGCTGGAAGG + Intergenic
1072698030 10:97618572-97618594 CTTCCTGAGGCTCTGCTGGGTGG + Intronic
1072950938 10:99846284-99846306 TCTCCTGAGGAGCCGCTGCGGGG - Intronic
1073100457 10:101003810-101003832 CCGCCTGGGGAGCTGGTGGTTGG - Exonic
1073127376 10:101159765-101159787 CCTCTTGGGTAGCTTCTGGAAGG - Intergenic
1075629864 10:123994466-123994488 CTTCCAGCGGAGCTGCTGGGCGG + Intergenic
1076178600 10:128387798-128387820 CCTCCTGAGGAGTTGGGGTAGGG + Intergenic
1076590368 10:131578287-131578309 ATTCCTGGGGGGCTGCTGGAGGG + Intergenic
1077179478 11:1205852-1205874 GCTCCTGAGCATCTGCTGGAAGG + Intergenic
1077517130 11:3008785-3008807 CCACCTGAGGAGCAGCTGACTGG + Intronic
1077546055 11:3170535-3170557 GCTCCGGAGAAGCTGCTGGCTGG + Intergenic
1077828183 11:5833151-5833173 CCTCCTGAGTAGCTGGTAGCTGG + Intronic
1078544058 11:12234113-12234135 TCTTCTTAGGAGCTGCTGGTGGG + Intronic
1079230093 11:18642357-18642379 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
1080219035 11:29878995-29879017 CTTCCTCAGGAGCTGAGGGAAGG + Intergenic
1080569137 11:33540630-33540652 CCTCCTTAGGAACTGCTTCATGG - Intergenic
1080752108 11:35160129-35160151 TCACCTGAGGAGCTGCTGAGTGG - Intronic
1080819936 11:35795956-35795978 CTACCAGAAGAGCTGCTGGAAGG - Intronic
1081585825 11:44382921-44382943 CCTCCAGAGGACTTGGTGGAGGG - Intergenic
1081911987 11:46705550-46705572 CCGCCTGAGGCTCTGCGGGAGGG - Exonic
1083400389 11:62419242-62419264 CCTGCTCTGGAGCTGCTGGGAGG + Intronic
1083764708 11:64836283-64836305 CCTCCTCAGGAGCTGGCCGAGGG - Exonic
1084444050 11:69193188-69193210 CTTCCTGAGGAGCTGGTCGGGGG + Intergenic
1085252386 11:75152393-75152415 CCAGCTGAGGAGCAGCTGCAGGG + Intronic
1085442700 11:76578522-76578544 CAACCTCAGTAGCTGCTGGAGGG + Intergenic
1085524366 11:77155736-77155758 CCTCCTTAGGAGCTGGGGCAGGG - Intronic
1087666882 11:101059719-101059741 CCTCCTGATGAGCTGGTAGCTGG - Intronic
1088321283 11:108556841-108556863 CATGATGAGAAGCTGCTGGAGGG - Intronic
1088940751 11:114453454-114453476 CCTCCTGAGGAGTGGTTGGAAGG - Intergenic
1089438456 11:118493102-118493124 CCTTCGGGGGAGCTGCGGGAAGG - Exonic
1090384351 11:126347968-126347990 CCCCCAGTGGTGCTGCTGGAGGG + Intergenic
1091256478 11:134191536-134191558 GCTCCTGAGAAGCTGTTGGGAGG - Intronic
1092704619 12:11268795-11268817 CCATCTGTGAAGCTGCTGGAAGG + Intronic
1092712733 12:11354681-11354703 CCATCTGTGAAGCTGCTGGAAGG + Intronic
1092716530 12:11394657-11394679 CCATCTGTGAAGCTGCTGGAAGG + Intronic
1092834779 12:12477241-12477263 CTTCGTGAGGTGCTGCTGGCTGG + Exonic
1095666987 12:44814140-44814162 CCTCAGGAGGAGCAGATGGAGGG + Intronic
1096367958 12:51044619-51044641 CCTCCTGAGTAGCTGCAGCTGGG + Intergenic
1097617360 12:61899145-61899167 CTTCCTGGGGACCTGCTGAATGG - Intronic
1097780972 12:63704081-63704103 CTTCCTGATGTGCTGATGGATGG - Intergenic
1099280662 12:80641619-80641641 CCTTCAGAGGACCTGCTTGATGG + Intronic
1101210636 12:102532110-102532132 CCTCCTGTGCAGCTGCTGTGTGG - Intergenic
1103506102 12:121443120-121443142 TCTCCAGAGGAGGGGCTGGAGGG + Intronic
1103976109 12:124703792-124703814 CCTCCTCTGGAGCTTCTGGAAGG + Intergenic
1104464983 12:128983044-128983066 CTTCCTGATGAGCTGTTGGTAGG - Exonic
1105599012 13:21869180-21869202 CCTCCCAAGGTGCTTCTGGAAGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105846827 13:24300697-24300719 CCTTCAGAGGGGCTGCTGGAGGG + Intronic
1105890878 13:24681313-24681335 CACCCTGAGGAGCTGCTGGCTGG + Intronic
1107686544 13:42906116-42906138 TCTGCTGGGGAGCTGCAGGATGG + Intronic
1112568840 13:100575070-100575092 CCTTCTGAAAAGTTGCTGGAGGG - Intronic
1113778180 13:112960831-112960853 CCTCCTGCTGCCCTGCTGGAAGG + Intronic
1113825337 13:113248072-113248094 CCTCCTGTGAAGGTGCTGGCTGG + Intronic
1115235850 14:31207833-31207855 CCACCTGGGGCGCTGCGGGACGG + Intergenic
1115649975 14:35396216-35396238 CCTCCTGAGTAGCTGGTGTCAGG + Intergenic
1118442110 14:65821531-65821553 CATCCTAAGGAGGTGCTGCAGGG + Intergenic
1118765068 14:68904152-68904174 CCTCCTCAGAAGATGCTAGAAGG + Intronic
1119234565 14:73008675-73008697 CTTTCTGAGGAGCTTCTGGATGG + Intronic
1121357400 14:93227401-93227423 CCTGCGGAGGAGGTTCTGGAAGG - Exonic
1122065922 14:99174551-99174573 CCGCCCGGGGACCTGCTGGACGG - Exonic
1122657917 14:103274178-103274200 GCTGCTGCGGGGCTGCTGGAGGG - Intergenic
1122885601 14:104709054-104709076 CCTGCTCAGGAGATGCAGGATGG - Intronic
1122920859 14:104879583-104879605 CCTCCTGAGGGGCTCCGAGAGGG - Intronic
1123028014 14:105437731-105437753 CCCCCTGCGGAGCTGATGCAGGG + Intronic
1123491742 15:20786507-20786529 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
1123492116 15:20789131-20789153 TCTGCTGAGGGCCTGCTGGACGG + Intergenic
1123548244 15:21355601-21355623 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
1123548620 15:21358221-21358243 TCTGCTGAGGGCCTGCTGGACGG + Intergenic
1124795326 15:32772809-32772831 ATTCCTGAGGGGCTGCTGGCTGG + Exonic
1125293464 15:38175763-38175785 CCTGCTGATGAACTCCTGGATGG - Intergenic
1128792543 15:70443704-70443726 CCTCCGGAGGTGCTGGGGGAGGG - Intergenic
1129253365 15:74320549-74320571 CCTGCTGGGGAGCAGGTGGAAGG + Intronic
1129532266 15:76277865-76277887 CCTCCACAGGAGCTGGTGGTGGG - Intronic
1130573389 15:85069315-85069337 GGTCCTGAGGAGAGGCTGGATGG - Intronic
1130990063 15:88870885-88870907 CCACCTGAGGTTCTGCAGGAAGG + Intronic
1131063434 15:89418267-89418289 CCTCCCAAGGAGCTGCTGTTGGG - Intergenic
1202956576 15_KI270727v1_random:82831-82853 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
1202956954 15_KI270727v1_random:85452-85474 TCTGCTGAGGGCCTGCTGGACGG + Intergenic
1132831604 16:1930813-1930835 CCTCCCGAGTAGCTGGTGTAGGG + Intergenic
1134200246 16:12191918-12191940 CCTACTCAGTACCTGCTGGACGG + Intronic
1135470012 16:22721876-22721898 CCTCCAGAGCAGCTGGTGAAAGG - Intergenic
1135510901 16:23082076-23082098 GCTCCTGAGAAGCTGTTGTATGG - Intronic
1135925769 16:26692721-26692743 CCTCCTGAAGAGCTAGAGGATGG - Intergenic
1136622063 16:31436057-31436079 CCTCCTGCTGAGCTGCCGGCTGG + Exonic
1137552524 16:49449356-49449378 CCTCCTGAGTAGCTGGGGCAAGG - Intergenic
1137586302 16:49665703-49665725 CCTCCAGAGGTGCTGATGGGGGG - Intronic
1138350067 16:56341737-56341759 GCCCCTGAGGAGCTGCAGGTTGG + Intronic
1140863114 16:79036499-79036521 CTTCCTTAGGAGCTGCTCGGAGG - Intronic
1141079990 16:81041945-81041967 TCCCCTGAGGGTCTGCTGGAGGG + Intronic
1141521376 16:84582107-84582129 CCTCCTGAGTAGCTGGTAGCTGG + Intronic
1141577493 16:84973591-84973613 GCTCCTCAGGAGATGCTGTAGGG + Intergenic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1141666690 16:85469430-85469452 CCTCCTGAAGAGCTTCTTGTGGG + Intergenic
1141854506 16:86671950-86671972 TCCCCCGAGGAACTGCTGGAGGG - Intergenic
1142026335 16:87815997-87816019 CACCCTGAGCAGCTCCTGGAAGG + Intergenic
1142032943 16:87847425-87847447 CCTCCTGAGGAGCTTCCTGGAGG - Intronic
1142143416 16:88482730-88482752 CCTCCTGCTGAGCAGCTGTAGGG - Intronic
1142230233 16:88896732-88896754 GCGTCTGAGAAGCTGCTGGAAGG - Intronic
1142286342 16:89173062-89173084 CCTCAGGGGCAGCTGCTGGAGGG - Intronic
1142319463 16:89371739-89371761 CATCCTGAGGGGGTGCAGGAGGG - Intronic
1142348778 16:89570525-89570547 AATCCTGAGGTGCTGCTGGGAGG - Intergenic
1142554679 17:765832-765854 CCTCCTGAGTAGCTGGTAGCTGG - Intronic
1143015887 17:3890980-3891002 CCTCCACACCAGCTGCTGGAGGG + Intronic
1144863485 17:18320326-18320348 CCTCCTGAGGAGGAGCTTTATGG + Intronic
1145743909 17:27298937-27298959 CCTCCTGAGTAGCTGTAGCAGGG - Intronic
1147386889 17:40088265-40088287 CCTCCTGAAGGGGTGCTGCATGG + Exonic
1147393093 17:40122151-40122173 CCTCCTCAGGAGGGGGTGGAGGG - Intergenic
1147558671 17:41495944-41495966 CCCCCAGAGGAGCTGCTCAAAGG + Intergenic
1148876911 17:50693601-50693623 CCTCCAGAGGAGCAGCTGCAGGG - Exonic
1150937994 17:69658601-69658623 GCTCCTGAGGAGCCTCAGGATGG + Intergenic
1151402999 17:73868388-73868410 CCTCCTAGGAAGCTGCTCGAGGG - Intergenic
1151451389 17:74200337-74200359 CCTCCTGAGGGAGTCCTGGAAGG - Intergenic
1151669701 17:75565295-75565317 CCTCCTGGAGAGCTCCTGCAGGG - Intronic
1152513401 17:80805478-80805500 TCTCCTGAGAAGCTGCTGAAAGG - Intronic
1152570120 17:81118012-81118034 ACACCGGAGGAGCTGCCGGATGG + Exonic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1152879592 17:82807601-82807623 CCTACAGAGCAGCTGCTGGTCGG + Exonic
1153769521 18:8404111-8404133 CCTTTTGAGGAGCTGCCAGACGG + Intronic
1153825215 18:8868575-8868597 ACTCCAGAGCAGCTGCTGGAAGG + Intergenic
1153926574 18:9839945-9839967 CCTCCTGAGCCGCTGCGGGATGG - Intronic
1155151567 18:23127470-23127492 GCTCCTGAGTAGCTTCAGGATGG + Intergenic
1155324810 18:24655132-24655154 TCACCTGAGGAGCTGGTGGGTGG - Intergenic
1155351505 18:24911840-24911862 CCTCCTGAGTAGATGCAGGCAGG + Intergenic
1155830223 18:30507666-30507688 CCTGCAAAGGAGCTGATGGAGGG - Intergenic
1155894066 18:31301336-31301358 CCTGGTGAGGAAATGCTGGAGGG + Intergenic
1157937659 18:51891094-51891116 CCTCATGGGGAGGTGATGGAAGG + Intergenic
1158250797 18:55485330-55485352 CCTACTGGGGTGCTGGTGGAGGG - Intronic
1158638249 18:59180031-59180053 CCTCCAGAGGAAAGGCTGGAAGG - Intergenic
1160152538 18:76406109-76406131 CCTCCGGAGGAGGGGCTGCAGGG - Intronic
1160369196 18:78357183-78357205 GCCACTGAGGAGCTGCAGGAGGG + Intergenic
1160838102 19:1133890-1133912 TCTTTTGAGGAGCTGCAGGATGG - Intronic
1160993946 19:1873293-1873315 TCCCCTGGGGAGCAGCTGGAGGG + Intergenic
1161124890 19:2550337-2550359 CCTCCTGAGTAGCTGGTAGCTGG + Intronic
1161341527 19:3745787-3745809 CCTCCTGAGGAGTGGGTGGCTGG - Intronic
1161347610 19:3776086-3776108 CCTCATGAGCAGCTGCTGGGAGG - Intergenic
1161348210 19:3778320-3778342 CCTCATGAGCAGCTGCTGGGAGG - Exonic
1161617771 19:5281736-5281758 CTCCCTCTGGAGCTGCTGGAAGG + Intronic
1162918277 19:13885713-13885735 GCTCCTGGGGAGCTTCTGGGTGG + Intronic
1163125497 19:15242248-15242270 CCTCCTGATGTGGTGCTGCAGGG - Intronic
1164983737 19:32632915-32632937 CCTCCTGGGGGACTGCTGGGAGG - Intronic
1165095586 19:33408079-33408101 GCTCCAGGGAAGCTGCTGGAAGG + Intronic
1165717875 19:38058303-38058325 CCTTCTGTGGTGCTGCTGAAGGG + Intronic
1166360724 19:42251933-42251955 CACCCTGAGGGGCTGGTGGAAGG - Intronic
1167403383 19:49287907-49287929 CCTCCTGAAGACCTACTGAATGG + Intergenic
1167463060 19:49636396-49636418 CCTCAGGAGAGGCTGCTGGACGG - Intronic
1167521443 19:49958447-49958469 CTTGGGGAGGAGCTGCTGGAGGG - Exonic
1167756132 19:51414985-51415007 CTTGGGGAGGAGCTGCTGGAGGG - Exonic
1167833715 19:52048841-52048863 CCTCCTGAGGAAAAGCCGGAAGG - Intronic
1168689939 19:58370192-58370214 CCTCCCCAAGAGCTTCTGGAAGG - Intronic
925825926 2:7848602-7848624 CCTCCTGGGTAACTGCAGGAAGG - Intergenic
926136883 2:10342777-10342799 CATCCTGCGTAGCTACTGGAGGG - Intronic
929277931 2:40045479-40045501 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
931788104 2:65639663-65639685 CCTGCTGAGGAACTGCAGCAGGG + Intergenic
932357459 2:71078199-71078221 ACTCCTGTAGAGATGCTGGAGGG - Intronic
932691500 2:73917463-73917485 CCTCCTGGGCATCTGCAGGATGG + Intronic
933486450 2:82930531-82930553 CCTCCTGAGGAGACACTGCAAGG - Intergenic
934033796 2:88071604-88071626 CCCCTGGAGGACCTGCTGGAAGG - Intronic
935118525 2:100159266-100159288 CCTCCTGAGTAGCTGGTGTTGGG - Intergenic
935229651 2:101084575-101084597 CATCCTGAGGAACGGCTGCATGG - Intronic
935492127 2:103734024-103734046 TTTCCTCAGGAGCTGCTGGGCGG + Intergenic
936233800 2:110726129-110726151 CTCTCTAAGGAGCTGCTGGAAGG - Intergenic
937373518 2:121319344-121319366 CCTCTGGAGGAGCTGCTACATGG - Intergenic
938163146 2:129004542-129004564 GTCCCTGAGGAGATGCTGGATGG - Intergenic
938455978 2:131464607-131464629 CCTCCTGAGGGGCTTCTGAGGGG + Intergenic
938482146 2:131671659-131671681 CCTCCTGAGTAGCTGGTAGCTGG - Intergenic
938753165 2:134354714-134354736 CTTCCTAAGCAGCTTCTGGAGGG + Intronic
942394971 2:175537321-175537343 CCTCCTGAGTGTCTCCTGGATGG - Intergenic
944439203 2:199725549-199725571 CTTCCTGAGGAGCTCTTGCAAGG + Intergenic
945039333 2:205730950-205730972 CCTCATGATGACCTGTTGGATGG - Intronic
946284683 2:218694063-218694085 CCTCCTAAGGATATGCTGTAGGG - Intronic
946312192 2:218888462-218888484 CCTCCTGAACATCTGGTGGAAGG + Intronic
948790654 2:240374851-240374873 CCCCCAGAGGAGCTGCTTCAGGG - Intergenic
948873394 2:240815186-240815208 GCTCCTGAGGAGCTGCTGTGGGG - Intronic
948936578 2:241169144-241169166 CCTGCTGAGCACCTGCTGCAGGG - Intronic
1169082148 20:2804158-2804180 CCTCCTGATGGTCTGCTTGATGG - Intergenic
1169264864 20:4161597-4161619 CCTCCTGGGGACTTGCTGAATGG - Intronic
1169390648 20:5187767-5187789 CCTCCTGAGTAGCTGGTAGCTGG - Intronic
1170140864 20:13123922-13123944 GCTCCTGAGGAGCAGCAGCAGGG - Intronic
1171059321 20:21940780-21940802 CCTCATGGGGAGCTGGGGGAAGG + Intergenic
1171447752 20:25216808-25216830 CCTGCTGAGGTGCTGCGGGGTGG + Intronic
1171958380 20:31476328-31476350 TGTCCTGATGAGCTGCTGTATGG - Exonic
1172008314 20:31832115-31832137 CCTCATGAAGAGGCGCTGGAAGG + Exonic
1172178459 20:32986567-32986589 CCTCCTGAGGAGCTGGGGCCAGG + Intronic
1172519850 20:35559487-35559509 CCGCCTGAGGGGCTGGTGGCCGG - Intergenic
1172910462 20:38405387-38405409 AATCCAGAGGAGCAGCTGGAGGG - Intergenic
1173751545 20:45480493-45480515 CCTCCTGAGTAGCGGGTGGGTGG - Intronic
1173954664 20:47021732-47021754 GCTCCTGAGTGGCTGCTGGAGGG - Intronic
1174157891 20:48528512-48528534 CCGCCTGGGCAGCTGCTGCAAGG - Intergenic
1175113662 20:56666508-56666530 CCTTGTGTGGGGCTGCTGGAAGG - Intergenic
1175670276 20:60896686-60896708 ACTCCTGGTGAGCTCCTGGATGG + Intergenic
1176052775 20:63129286-63129308 CCTCCTGAGGAGCAGGTGGACGG - Intergenic
1176089225 20:63311637-63311659 CGGCCCGAGGTGCTGCTGGATGG + Exonic
1176313116 21:5165122-5165144 CCTCCTCAGAAGCTTCTGGCTGG + Intergenic
1176411257 21:6450702-6450724 CCTGCTGAGGTGCTGCCGGCGGG - Intergenic
1177474522 21:21602478-21602500 AGCACTGAGGAGCTGCTGGATGG + Intergenic
1179514352 21:41896607-41896629 CCTCCTGAGGTTCTGCTGGTTGG - Intronic
1179627529 21:42657179-42657201 CCTGGTGAGAAGCTGCTGAAGGG + Intronic
1179686750 21:43059024-43059046 CCTGCTGAGGTGCTGCCGGCGGG - Intronic
1179843932 21:44096908-44096930 CCTCCTCAGAAGCTTCTGGCTGG - Intronic
1180192451 21:46172548-46172570 CCTCCTGACCAGCTGTGGGAAGG - Intronic
1180741168 22:18054116-18054138 CCTCCTGAGGAGCCACAAGAGGG - Intergenic
1181560170 22:23695408-23695430 CTTCCTGAGGAATTGCTGGCCGG - Intronic
1181688772 22:24546676-24546698 GATCCTGAGCAGGTGCTGGAGGG - Intronic
1181971743 22:26695802-26695824 CGTGCTGAGGAGCTACTGGGTGG + Intergenic
1182325967 22:29513233-29513255 CCTCCTGAGTAGCTGGTAGCTGG - Intronic
1182530478 22:30951925-30951947 CCTCCAGAGTAGCTTCTGTAAGG + Intronic
1183288356 22:36982137-36982159 CCTCATGAGGAGATGCAGGGAGG - Intergenic
1184040446 22:41940025-41940047 CCTGGTGGGGAGCTGCTGGAGGG - Intronic
1184249716 22:43253195-43253217 CCTCATCAGGAGCTACTGGTTGG + Intronic
1184835195 22:47016835-47016857 CCTCCTGCAGAGCTGCTGCGTGG + Intronic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1185380310 22:50504827-50504849 CGGCCTGAGGTGGTGCTGGAGGG - Exonic
950471423 3:13188977-13188999 CCTCCTGAGGGGGTGCTGCCAGG - Intergenic
951049392 3:18077337-18077359 CTTCCTGAGTGGCTGCTGAAGGG + Intronic
951081993 3:18463511-18463533 CCATCTGAGGACCAGCTGGAAGG - Intergenic
954250854 3:49366269-49366291 CCTTTTGTGAAGCTGCTGGAAGG - Intronic
954285744 3:49617706-49617728 CCTCCTGAGGAGGCCTTGGACGG + Intronic
954685025 3:52365639-52365661 CCACCAAAGGACCTGCTGGAGGG - Intronic
957040498 3:75332263-75332285 TCTGCTGAGGAGATGCTGAAAGG - Intergenic
959546231 3:107599635-107599657 CCATCTAAGCAGCTGCTGGACGG - Intronic
961045282 3:123703825-123703847 TCTGCTGAGGAGATGCTGAAAGG - Intronic
961602379 3:128071877-128071899 CCACATGTGGAGCTGCTGCAGGG + Intronic
961660839 3:128468061-128468083 CCTCCATAGGGCCTGCTGGAGGG + Intergenic
961862899 3:129931748-129931770 GCACCTTAGCAGCTGCTGGAGGG - Intergenic
963974673 3:151467551-151467573 TCTCATGAGGAGCTTTTGGAGGG - Intergenic
964332420 3:155618765-155618787 CTTCCTGAGGAGCTTCCTGAGGG + Intronic
967832184 3:193929037-193929059 CATCCTGAGAGGCTGCTGGGAGG + Intergenic
968732138 4:2274202-2274224 CCAGCTGTGGAGCTGCTGCATGG + Exonic
968750138 4:2384571-2384593 CCTCCTGAGGGAGTGCTGGATGG + Intronic
968994726 4:3938381-3938403 GCTCCTGGGTAGCTTCTGGAAGG + Intergenic
969241045 4:5897871-5897893 CCTGCTGAAGAGCTTCCGGAGGG + Intronic
969574137 4:8026567-8026589 CATCCTGAGCAGCTGCTGAGTGG - Intronic
969604835 4:8197246-8197268 CCTCCCCTGGAGCTTCTGGAGGG + Intronic
969610570 4:8225652-8225674 CTTCCTGAGGGGCTGATTGAGGG + Intronic
969718994 4:8882735-8882757 GCTCCTCCAGAGCTGCTGGAAGG + Intergenic
969721848 4:8896403-8896425 CCTCCTGAGGTCAGGCTGGAGGG - Intergenic
969932135 4:10641153-10641175 CCTCCTGAGGGACAGTTGGAGGG + Intronic
972240115 4:37181588-37181610 TCTCCCAAGGAGCTGCTGAATGG - Intergenic
972323546 4:37994091-37994113 CCTGCTCAGGAGGTCCTGGAAGG + Intronic
972633164 4:40859255-40859277 CCTCCTGATGAGATGTTGGCTGG - Intronic
977244031 4:94608101-94608123 ACACCTGAGGAGTTGCAGGAGGG - Exonic
980917199 4:139044783-139044805 TCTACTGAGGAGTGGCTGGAAGG - Exonic
983936734 4:173507759-173507781 CCTCCGGAGCAGTTGCGGGAGGG + Intergenic
984162591 4:176272468-176272490 CTTCTTGAGGAGCTGCTGTAAGG - Intronic
984218932 4:176949259-176949281 CCTCCTGTAGAGCATCTGGAAGG + Intergenic
984785885 4:183566930-183566952 AGTCCTGAGGAGCTGGTGGTGGG - Intergenic
984946579 4:184973353-184973375 TCTCCTGTGGAGGTGCAGGAAGG - Intergenic
985174663 4:187188342-187188364 CCTGCTGAGGTGCTGCTTGCAGG + Intergenic
985576114 5:674264-674286 CCTGCTGAGGAGCAGCTGCCAGG + Intronic
985608780 5:874217-874239 CCTCCTGTGGAGCTGATGACAGG + Intronic
985897421 5:2757026-2757048 GCCACGGAGGAGCTGCTGGAGGG - Intergenic
986249532 5:6043973-6043995 CATCCTGAGGGGCAGCTGGTGGG - Intergenic
987105777 5:14637527-14637549 CCTCCTGAGTGGCTGCTGAAGGG + Intergenic
988466941 5:31500220-31500242 CCAACTGGGGAGGTGCTGGAAGG + Intronic
988913593 5:35870369-35870391 CCCCCTGAGGACATTCTGGAAGG + Intronic
989121601 5:38009980-38010002 CCTCCTGAGGAGCAGCACGCTGG - Intergenic
989743620 5:44801223-44801245 CTTCCAGAGGTGCTACTGGAAGG - Intergenic
996531646 5:124533556-124533578 CCTCCTGAGTGGCTGCCAGAAGG + Intergenic
997738259 5:136230780-136230802 CTTCCAGAGGTGATGCTGGAAGG - Intronic
1001892134 5:175348438-175348460 CCTACTGAGAAGCTGCTGTGAGG + Intergenic
1002305811 5:178282111-178282133 CCTGCAGAGGAGCAGCTGAACGG - Intronic
1002857445 6:1050761-1050783 CCTCCTCAGAGGCTGCAGGATGG + Intergenic
1003096817 6:3148652-3148674 CCACCTGAGCAGCAGCTGGGAGG - Intronic
1003749497 6:9040576-9040598 CCTCCTGAGAAGCTGGTGAAAGG + Intergenic
1003887586 6:10535211-10535233 CCTCCAGAGGACCTGCTGGATGG - Intronic
1006124308 6:31827745-31827767 CAGCCTGAGGAGCTGCTGCGAGG + Exonic
1006520553 6:34568699-34568721 CCTCCTGTGGAGCTGGTGATAGG - Intergenic
1006628010 6:35411199-35411221 TCACCTGTGTAGCTGCTGGAAGG - Exonic
1006829289 6:36959036-36959058 CCTGCTAAGGAGGTGCCGGAAGG + Intronic
1006914654 6:37586432-37586454 CCCCTTCAGGAGCTGCTGGTCGG + Intergenic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1013655043 6:112237819-112237841 CCTCCTTAGGCCCTCCTGGATGG + Intronic
1014832118 6:126115124-126115146 CCTCCTGAAGGGTGGCTGGAAGG - Intergenic
1015499869 6:133920901-133920923 CCACCTGAGGAGACGATGGATGG + Intergenic
1017019733 6:150130573-150130595 GCTCCTGAGGAGAGGCTGCATGG + Intergenic
1017841138 6:158224016-158224038 CCTTCTGCAGAGCTGCTGGGTGG - Intergenic
1018171959 6:161150712-161150734 CCTCCTGAGGAGTAGCTGCCTGG + Intronic
1018731699 6:166656523-166656545 CCTGCCGAGGCCCTGCTGGAGGG - Intronic
1019415684 7:925622-925644 CCTGCCCAGGAGCTGCTGGTGGG - Intronic
1019575099 7:1733891-1733913 CCTCCTGCTAAGATGCTGGAAGG - Intronic
1019907718 7:4077308-4077330 CCTCCTGCCAAGATGCTGGAGGG + Intronic
1022478138 7:30725280-30725302 CCTCCTCTGGAGCTTTTGGAGGG + Intronic
1023095892 7:36659401-36659423 AATCCCGGGGAGCTGCTGGATGG + Intronic
1023864341 7:44231808-44231830 CCTCCTGGGGACCTGGGGGATGG - Intronic
1024934285 7:54697717-54697739 GCTGCGGAGGGGCTGCTGGAGGG - Intergenic
1024986997 7:55202714-55202736 CCCCCTCTGGAGATGCTGGAGGG - Intronic
1025011157 7:55400000-55400022 CTTCCTGATGAGCTGCTTTATGG + Exonic
1026903871 7:74051687-74051709 CCTCCTGAGGACAGGCAGGATGG - Intronic
1029275698 7:99402923-99402945 CCTCCTGTGTAGCTGTTGAAGGG - Intronic
1029530318 7:101121231-101121253 CCTCCTGAGGAGTTGCTAGTTGG - Intergenic
1029549790 7:101231654-101231676 CCTCCAGAGGCTCTTCTGGAAGG + Intergenic
1032154658 7:129458207-129458229 CTTAGTGAGGAGTTGCTGGAGGG - Exonic
1032315193 7:130831299-130831321 CATCCTGAGGTGCTGCAGGTTGG + Intergenic
1034447781 7:151122259-151122281 CCGCCTGTGGAGCTGCTGGGTGG + Intronic
1035280120 7:157773124-157773146 CCTCGCGATGAGCTGCTGGTTGG - Intronic
1035336666 7:158133753-158133775 CCTCCTGAGCACCCGCTGGAAGG + Exonic
1037787442 8:21911293-21911315 GCTTTTGAGGAGCTGGTGGAGGG - Intronic
1037826750 8:22164663-22164685 CCTCCGGAGACGCCGCTGGAGGG - Intergenic
1038066320 8:23967310-23967332 CCTCCCAAGGGGCTGTTGGAGGG - Intergenic
1038539680 8:28381910-28381932 CTTTTTGAGGAGCTGCTGGCTGG - Intronic
1038892754 8:31745201-31745223 CCTGCTGAGTAGCTGGTGGAAGG + Intronic
1039435347 8:37556123-37556145 TCTGCTGATGAGATGCTGGATGG - Intergenic
1040372197 8:46788122-46788144 ACTCCTGAGGAGCTCCAGCAAGG - Intergenic
1041073903 8:54151668-54151690 CCTCCTGAGTAGCTGGTAGCTGG + Intergenic
1042284428 8:67092557-67092579 CCTCCTGAGTAGCTGGAGGCAGG + Intronic
1042669668 8:71247248-71247270 CCTCCTCTAGGGCTGCTGGAAGG - Intronic
1044547819 8:93479189-93479211 CCTCCTGAATAGCTCCTGAATGG + Intergenic
1044607141 8:94057445-94057467 TCTCCTGATGTGCTGCTGGAAGG + Intergenic
1045224578 8:100232003-100232025 CCTTCTGAAGTGCTGCGGGAAGG + Intronic
1048297200 8:133223172-133223194 CCTCCTGGGGAGGTGGTGGTGGG - Intronic
1049274890 8:141715253-141715275 CCTCCTGTGGGGCTGCTGGGAGG + Intergenic
1049308761 8:141922292-141922314 GCTCCTGAGGGCCTGCTGGAAGG + Intergenic
1049373457 8:142278450-142278472 CCTTCCTGGGAGCTGCTGGAAGG - Intronic
1049384147 8:142332611-142332633 CCTCATGAGGACATGGTGGATGG + Intronic
1049443287 8:142618870-142618892 TCTCCTGAGGAGCTGAGGGCGGG - Intergenic
1049598789 8:143497698-143497720 CCTGCTGTGGGGCTGCTGGCCGG - Intronic
1049759609 8:144326145-144326167 GCTCCTGAGGAGCTTTTCGAGGG - Intronic
1049785893 8:144450595-144450617 GCTCTTGAGGAGGAGCTGGAAGG + Exonic
1053572325 9:39321696-39321718 CCACCTGAGGAGCCACTTGATGG - Intergenic
1053623714 9:39846231-39846253 CCACCTGAGGAGCCACTTGATGG - Intergenic
1053881155 9:42596997-42597019 CCACCTGAGGAGCCACTTGATGG + Intergenic
1053891511 9:42697317-42697339 CCACCTGAGGAGCCTCTTGATGG - Intergenic
1054093885 9:60880408-60880430 CCACCTGAGGAGCCGCTTGATGG - Intergenic
1054115359 9:61156331-61156353 CCACCTGAGGAGCCGCTTGATGG - Intergenic
1054124820 9:61297315-61297337 CCACCTGAGGAGCCACTTGATGG + Intergenic
1054220184 9:62404468-62404490 CCACCTGAGGAGCCACTTGATGG + Intergenic
1054230531 9:62504704-62504726 CCACCTGAGGAGCCACTTGATGG - Intergenic
1054592397 9:67026211-67026233 CCACCTGAGGAGCCGCTTGATGG + Intergenic
1055469261 9:76595172-76595194 CATCCTGGGGAGCTGCAGGTAGG + Intergenic
1055943751 9:81674382-81674404 GCTCCTGAGGAGCAACCGGAAGG + Intronic
1056646951 9:88421422-88421444 CCTCCTGAGTAGCTGGTAGCTGG + Intronic
1056908879 9:90679823-90679845 TCTCCTGAGGAGTTTTTGGAGGG + Intergenic
1057183226 9:93040871-93040893 CCTCCTGTGGCCCAGCTGGAAGG - Intergenic
1057576610 9:96247437-96247459 ACCTCTGAGGAGCTGCTGCAGGG - Intronic
1057808015 9:98234602-98234624 AATCCTGAGGAGCTGTTGGGTGG + Intronic
1057814664 9:98285701-98285723 CTTTCAGAGGAGCTGCAGGAAGG + Intergenic
1057885695 9:98828041-98828063 CCACCTGGGGAGCTTCTGGTTGG - Intronic
1059432201 9:114257069-114257091 CCTCCACAGCAGCTGTTGGAGGG + Intronic
1059493591 9:114690658-114690680 CCTCCTAAGAAGCTGTGGGAGGG + Intergenic
1060073306 9:120569696-120569718 GACTCTGAGGAGCTGCTGGAAGG + Intronic
1060533025 9:124359741-124359763 CCATCAGAGGAGCTGCTGGTTGG - Intronic
1061035547 9:128112121-128112143 CCTCCTGAGTAGCTGGTAGCTGG - Intergenic
1061954205 9:133953204-133953226 CCTCCAGGGCTGCTGCTGGAAGG + Intronic
1062624504 9:137436702-137436724 CCTCCGGAGGAGATGCTGGTGGG - Exonic
1185511277 X:666727-666749 CCTCCTCAAGAGCCTCTGGAGGG + Intergenic
1185735387 X:2491909-2491931 CCTCCTGAGTGGCAGCTGGAAGG - Intronic
1189311370 X:40020485-40020507 CCTCATGAGTAGCTGCTGGCTGG - Intergenic
1191200180 X:57772285-57772307 TCTCATGAGGAGCTTTTGGAGGG - Intergenic
1192313416 X:70034400-70034422 CCACCTGAAGAGCTGATAGAGGG + Intronic
1193550301 X:82884170-82884192 CCTCCTGAAGTACTTCTGGATGG - Intergenic
1197723858 X:129762607-129762629 CCTACTGATGAGTGGCTGGAGGG - Intronic
1200080317 X:153573010-153573032 CCTGGTGTGGCGCTGCTGGAAGG - Intronic