ID: 917466216

View in Genome Browser
Species Human (GRCh38)
Location 1:175278741-175278763
Sequence AATTATGCCCACTGTGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917466210_917466216 13 Left 917466210 1:175278705-175278727 CCGTGTAAATGGACAAAGAATAT No data
Right 917466216 1:175278741-175278763 AATTATGCCCACTGTGGAAGGGG No data
917466211_917466216 -10 Left 917466211 1:175278728-175278750 CCTCCTTGCTCTCAATTATGCCC No data
Right 917466216 1:175278741-175278763 AATTATGCCCACTGTGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917466216 Original CRISPR AATTATGCCCACTGTGGAAG GGG Intergenic
No off target data available for this crispr