ID: 917468726

View in Genome Browser
Species Human (GRCh38)
Location 1:175307712-175307734
Sequence CACAATAGCCCCACATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917468726_917468731 -10 Left 917468726 1:175307712-175307734 CCTTCCTATGTGGGGCTATTGTG No data
Right 917468731 1:175307725-175307747 GGCTATTGTGCAAAGTTTGGGGG No data
917468726_917468735 13 Left 917468726 1:175307712-175307734 CCTTCCTATGTGGGGCTATTGTG No data
Right 917468735 1:175307748-175307770 CAAAGCCGGGTGGAGAAATGTGG No data
917468726_917468736 14 Left 917468726 1:175307712-175307734 CCTTCCTATGTGGGGCTATTGTG No data
Right 917468736 1:175307749-175307771 AAAGCCGGGTGGAGAAATGTGGG No data
917468726_917468733 0 Left 917468726 1:175307712-175307734 CCTTCCTATGTGGGGCTATTGTG No data
Right 917468733 1:175307735-175307757 CAAAGTTTGGGGGCAAAGCCGGG No data
917468726_917468732 -1 Left 917468726 1:175307712-175307734 CCTTCCTATGTGGGGCTATTGTG No data
Right 917468732 1:175307734-175307756 GCAAAGTTTGGGGGCAAAGCCGG No data
917468726_917468734 3 Left 917468726 1:175307712-175307734 CCTTCCTATGTGGGGCTATTGTG No data
Right 917468734 1:175307738-175307760 AGTTTGGGGGCAAAGCCGGGTGG No data
917468726_917468738 29 Left 917468726 1:175307712-175307734 CCTTCCTATGTGGGGCTATTGTG No data
Right 917468738 1:175307764-175307786 AATGTGGGTATTTAGAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917468726 Original CRISPR CACAATAGCCCCACATAGGA AGG (reversed) Intergenic
No off target data available for this crispr