ID: 917470068

View in Genome Browser
Species Human (GRCh38)
Location 1:175318922-175318944
Sequence TTCAATAATCCCAAAGAAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917470068_917470069 6 Left 917470068 1:175318922-175318944 CCAACTTCTTTGGGATTATTGAA 0: 1
1: 0
2: 4
3: 19
4: 231
Right 917470069 1:175318951-175318973 CTGAATTTTGAATCTTTCAGAGG 0: 1
1: 0
2: 5
3: 22
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917470068 Original CRISPR TTCAATAATCCCAAAGAAGT TGG (reversed) Exonic
902164756 1:14561237-14561259 TTTAAAACTCCCAAAGAAATGGG + Intergenic
903240267 1:21978127-21978149 TTCAATCCTCCCAATGAAGGAGG + Intronic
903244015 1:22002761-22002783 TTCAATCCTCCCAATGAAGGAGG + Intronic
903862847 1:26375441-26375463 TTCCATGATCCCCAATAAGTAGG - Intergenic
904933738 1:34111589-34111611 TTCCAATATCCCAAAGAAGCAGG + Intronic
906166544 1:43690567-43690589 TTCAATCTTCCCAAAGAAAGTGG - Intronic
906700287 1:47852683-47852705 TTCAATAATCCCAGAGGAGGAGG + Intronic
907978097 1:59453218-59453240 TTGAATAATCCCAATGAAGGAGG + Intronic
908775307 1:67633818-67633840 GTCAATAATGCCAAATAACTTGG + Intergenic
908934439 1:69357566-69357588 TTCCATGATCCCCAAGAAGTAGG - Intergenic
909023041 1:70453034-70453056 TTGATTAATTCCAAAGAGGTGGG - Intergenic
909582290 1:77251139-77251161 TTCAAAAATCTTAAAGAAGAAGG + Intergenic
910837125 1:91525990-91526012 TTCATTAATGGCAAAGAACTTGG + Intergenic
911278519 1:95894417-95894439 TCCAATAAACCCTAAGAAATAGG - Intergenic
911375897 1:97051019-97051041 TTCAATAGACCCAAAGGAGTGGG - Intergenic
911533807 1:99077392-99077414 CTCATTCATCCCAAGGAAGTAGG + Intergenic
915069650 1:153255599-153255621 TTCATAAATCACAAAAAAGTTGG - Intergenic
915642304 1:157237990-157238012 TTTAAGATTCCCAAAGAAGCTGG - Intergenic
915730563 1:158050941-158050963 TTCAAGAATCCAGAAAAAGTAGG - Intronic
916344936 1:163777039-163777061 TTTAATAATGCCAAAGAATGGGG + Intergenic
917470068 1:175318922-175318944 TTCAATAATCCCAAAGAAGTTGG - Exonic
919652289 1:200162397-200162419 TTCAAGAAACTGAAAGAAGTTGG + Intronic
920716658 1:208346435-208346457 TTCAAACATCCCAGAGAGGTAGG + Intergenic
920874569 1:209822230-209822252 TTCAATAAACGCTGAGAAGTAGG + Intergenic
921446387 1:215251737-215251759 TGCAATCATCTCAAATAAGTTGG + Intergenic
921561516 1:216664339-216664361 TTTAATCATCCCAATGAAGTAGG - Intronic
922805313 1:228383689-228383711 TTCCATAATCCAAAAGGACTGGG - Intergenic
923522081 1:234742878-234742900 TGAAATAATCACAAAGACGTTGG + Intergenic
923890699 1:238212344-238212366 TTGTATATTCCCAAAGAAATAGG - Intergenic
923891239 1:238217046-238217068 TTGTATATTCCCAAAGAAATAGG - Intergenic
924416270 1:243859872-243859894 TTCAGGATTCCCAAAGAAGAGGG + Intergenic
924418494 1:243884562-243884584 TTCAAAATTCCAAAAGAAGTTGG + Intergenic
1063469262 10:6271489-6271511 TTCATTACTCTCAAAGAATTCGG - Intergenic
1064130994 10:12709379-12709401 TTCAACAATGGCAAAGAGGTGGG - Intronic
1065509010 10:26458750-26458772 TTCAAAAATATCAAAGAATTTGG - Intronic
1066326184 10:34361447-34361469 TTCAATAACACAAAAAAAGTAGG + Intronic
1068153602 10:53167234-53167256 TTCAATAATGCCATCAAAGTAGG - Intergenic
1068615486 10:59110323-59110345 TTCCATAAACCCAAATAAATGGG + Intergenic
1069877894 10:71574280-71574302 TGCAATAATCCCAAATAAGAAGG - Intronic
1073754097 10:106562388-106562410 TTCAATTATTCTAAAGAAGCAGG - Intergenic
1074520060 10:114211978-114212000 TCCCATAATCCCAAAGTTGTTGG + Exonic
1075916214 10:126169789-126169811 TTCAATGGTTCCAAATAAGTCGG - Intronic
1076065733 10:127446481-127446503 CACAATAATAGCAAAGAAGTAGG + Intronic
1077942486 11:6858010-6858032 TTCAATTACCCCAAAGAAATAGG - Intergenic
1078493245 11:11788969-11788991 TTCAATATTACCTAAGATGTAGG - Intergenic
1078728817 11:13957413-13957435 CTCAAGATTCCCAAAGAAGAGGG + Intergenic
1079929291 11:26537795-26537817 TTCAAGTATCCCAAAGTAGTAGG - Intronic
1080287488 11:30632304-30632326 TCCAATAATCCAAAACATGTTGG - Intergenic
1085872742 11:80369477-80369499 TACAACAAACCCAAAGAGGTAGG + Intergenic
1086737272 11:90321917-90321939 CATAAAAATCCCAAAGAAGTAGG + Intergenic
1087255314 11:95946607-95946629 TTTAGTAATTCTAAAGAAGTTGG + Intergenic
1088709950 11:112499139-112499161 TAGAATAAACCCAAAGATGTGGG + Intergenic
1090841630 11:130494017-130494039 TTGAAAAATCCCAAAATAGTTGG - Intergenic
1091177109 11:133570258-133570280 TTCAGTAATCTAAAAGAAGACGG + Intergenic
1092734879 12:11572202-11572224 GACAATAATCCCACAAAAGTGGG + Intergenic
1093858612 12:24136050-24136072 TTAAATAGTCCCAAAGAGATGGG + Intergenic
1094279309 12:28717789-28717811 TTTCATGTTCCCAAAGAAGTGGG + Intergenic
1097566278 12:61272771-61272793 TTTAATAATATAAAAGAAGTTGG + Intergenic
1097652993 12:62325943-62325965 TACAATAAGCCATAAGAAGTGGG - Intronic
1098685694 12:73417238-73417260 TTAAAAAATCTCAAAGCAGTTGG + Intergenic
1103899525 12:124295933-124295955 TCCGAAATTCCCAAAGAAGTTGG + Intronic
1104593736 12:130105170-130105192 TTCAATAAGCTCAGGGAAGTGGG - Intergenic
1105266406 13:18821648-18821670 AACAAAAATCTCAAAGAAGTAGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1107646414 13:42498663-42498685 TTCAAAACACCCAAAGGAGTTGG + Intergenic
1107708441 13:43129884-43129906 GTCAATCATCCCGATGAAGTTGG - Intergenic
1108728972 13:53213216-53213238 TACAATAATCTCACAAAAGTAGG + Intergenic
1110640305 13:77816084-77816106 TTCATTAATGTCAAAGAAGAGGG + Intergenic
1110894053 13:80726903-80726925 TTCAGAAATCCCACAGGAGTTGG + Intergenic
1112682997 13:101788283-101788305 TTCAACAATCTCAAAGTAGCTGG - Intronic
1112762290 13:102704938-102704960 ATCTATAATCCCAAAGACTTGGG - Intergenic
1117452920 14:55868808-55868830 TTGAATAACCCAAAAGAAGAAGG - Intergenic
1119066972 14:71538336-71538358 TCCAAGAATCTCAAAGAATTTGG - Intronic
1119972663 14:78989557-78989579 TTCAATAATACCAAAAGACTTGG - Intronic
1120232052 14:81850484-81850506 TTCCATAATCCCCAATAGGTAGG - Intergenic
1121526843 14:94625169-94625191 TTCAAGAAACCAAAAGAAGTTGG + Intergenic
1202837460 14_GL000009v2_random:89010-89032 ATAAAGAATCCCAAAGAAGCTGG + Intergenic
1202906846 14_GL000194v1_random:79140-79162 ATAAAGAATCCCAAAGAAGCTGG + Intergenic
1125230633 15:37451525-37451547 TTCAAAAATACCAAGGAATTTGG - Intergenic
1125840686 15:42798592-42798614 TACAATGAACACAAAGAAGTTGG + Intronic
1130402463 15:83570590-83570612 TTAAGTATTCCCAAAGAATTTGG + Intronic
1130670600 15:85909037-85909059 GTCACTAATCCAAAAGAATTAGG + Intergenic
1130879564 15:88043454-88043476 TTCAAAAGTCCCCAGGAAGTTGG - Intronic
1131612182 15:93976833-93976855 TTCACTATTCCCACAGCAGTAGG + Intergenic
1135957599 16:26969047-26969069 AACAATATTCACAAAGAAGTAGG - Intergenic
1136540390 16:30924949-30924971 TTCTAGAATCCCAAGGAATTTGG + Intronic
1136749394 16:32619479-32619501 GTAAATAAGCCCAGAGAAGTAGG + Intergenic
1139030296 16:62872789-62872811 TTCTATAATCACAAAGATATTGG + Intergenic
1139540496 16:67611781-67611803 TTTTTTAATCCCAAAGAAGAAGG + Intronic
1140707446 16:77643918-77643940 TTCTATACTTCCAAGGAAGTAGG - Intergenic
1141072210 16:80968065-80968087 GTCATTAACCCTAAAGAAGTAGG + Exonic
1203051526 16_KI270728v1_random:878693-878715 GTAAATAAGCCCAGAGAAGTAGG + Intergenic
1143716763 17:8777589-8777611 TTGAATTATCCCAAAGAGGATGG + Intergenic
1143797066 17:9345529-9345551 TTAAATAATTTCACAGAAGTAGG + Intronic
1144318824 17:14093410-14093432 ACCAATACTCCCAAAGTAGTGGG + Intronic
1145221238 17:21091018-21091040 TTAAATAAGCCCAGAGGAGTTGG + Intergenic
1146468572 17:33106637-33106659 TGTAATAGTCCTAAAGAAGTTGG - Intronic
1146632398 17:34480207-34480229 GTCAATAAGCCCAAAGAGGATGG - Intergenic
1147472131 17:40672523-40672545 TTTTATAATCCCAAAGAGCTTGG + Intergenic
1149038586 17:52159919-52159941 TTCAATAACCCCAAAGAGGTAGG - Intronic
1149729593 17:58931969-58931991 TTAAATGACCCCAAAGAATTGGG + Intronic
1149800585 17:59564178-59564200 TTGAATGATACCAAATAAGTTGG - Intergenic
1150511858 17:65761673-65761695 TTATATAATCCCAAAGTATTTGG + Intronic
1150558877 17:66277914-66277936 TTCAATAAACCCATAAATGTAGG - Intergenic
1152115543 17:78384756-78384778 TTGAAAAAACCCCAAGAAGTTGG + Intronic
1152128344 17:78460925-78460947 TTCAATAATTACACAGATGTAGG + Intronic
1153917806 18:9761347-9761369 TTCAACAACCCTAATGAAGTAGG - Intronic
1154422009 18:14239828-14239850 AACAAAAATCTCAAAGAAGTAGG - Intergenic
1156206168 18:34888309-34888331 TTCAATAACCCTGAAGAATTTGG + Intronic
1159657135 18:71045014-71045036 TTTAATAATCCCAAGGATGTAGG + Intergenic
1159913621 18:74169247-74169269 TTACAAAATCCCTAAGAAGTAGG - Intergenic
1166758045 19:45206427-45206449 TTGATTAATCCAAAAGAAGGTGG - Intronic
1202635183 1_KI270706v1_random:38341-38363 ATAAAGAATCCCAAAGAAGCTGG - Intergenic
1202650036 1_KI270706v1_random:171764-171786 ATAAAGAATCCCAAAGAAGCTGG + Intergenic
926260341 2:11254521-11254543 TACCATAACCCCAAAGCAGTTGG - Intronic
930292495 2:49512606-49512628 TTCAAACATTCCTAAGAAGTAGG + Intergenic
930891563 2:56394613-56394635 TTGAATAAACACAAAGGAGTGGG + Intergenic
931166536 2:59754989-59755011 TTCAAGAATCCTAATGGAGTAGG + Intergenic
932067599 2:68582947-68582969 TTCAATTATCTCAGTGAAGTAGG - Intronic
932695816 2:73955510-73955532 CACAATAATCCCAAAGACTTGGG - Intronic
934762587 2:96864713-96864735 TTGAAAAACCCCAAAGAAGGTGG + Exonic
935270598 2:101431302-101431324 ATCACTAATCACAAAGATGTTGG + Intronic
936539347 2:113337390-113337412 TTCAAGAGACCCTAAGAAGTCGG - Intergenic
936812248 2:116415923-116415945 TTCAATGATCTCTAAGAACTTGG - Intergenic
938242823 2:129756421-129756443 TTCCATGTTCCCAGAGAAGTGGG + Intergenic
938736765 2:134192727-134192749 TTAAATAATCCCACAGTACTAGG - Intronic
939176978 2:138760137-138760159 TTCATTCATCCCAAAGAAGTGGG + Intronic
939708338 2:145483016-145483038 TGTAATAAACCCTAAGAAGTGGG + Intergenic
940975002 2:159932675-159932697 TTAAATAATCTCTTAGAAGTAGG + Intronic
941581979 2:167309431-167309453 TAGAATAATACCAAAGAAGTAGG - Intergenic
942055010 2:172174022-172174044 TCCAATAATCCAATAGAAATAGG - Intergenic
945739124 2:213639892-213639914 TTCAATAATCCCAAACTTCTTGG + Intronic
947372174 2:229458322-229458344 TTTAACAATCCCAAATATGTAGG + Intronic
947423813 2:229964363-229964385 ATCAATGATACCAAAGAATTAGG - Intronic
1168993362 20:2113660-2113682 TTCAATAATCCCAGTGCTGTAGG - Intronic
1169634127 20:7668242-7668264 TTAAAAAATCTCAAAGAACTTGG - Intergenic
1169933229 20:10856302-10856324 CTCAATTTTCCCAAGGAAGTAGG + Intergenic
1171111386 20:22485775-22485797 TACAATTATCTCAAAAAAGTAGG - Intergenic
1172498027 20:35403105-35403127 TTGAAAACTCCCAAAAAAGTGGG - Intronic
1174016081 20:47489457-47489479 TTAAATAATACCTAAGAAATTGG + Intergenic
1176626195 21:9093940-9093962 ATAAAGAATCCCAAAGAAGCTGG + Intergenic
1176647396 21:9364105-9364127 ATAAAGAATCCCAAAGAAGCTGG - Intergenic
1176851475 21:13920126-13920148 AACAAAAATCTCAAAGAAGTAGG + Intergenic
1177093798 21:16805498-16805520 TCCAGTAATCTCAAAGAATTAGG + Intergenic
1177211293 21:18075209-18075231 TTCCATCAACCCAAAGAAGGTGG - Intronic
1177241017 21:18457366-18457388 TTCATTTCTCCCAAGGAAGTTGG - Intronic
1180365522 22:11934886-11934908 ATAAAGAATCCCAAAGAAGCTGG + Intergenic
1182815386 22:33157685-33157707 TTCAATAATACAAAAAAAGGAGG - Intergenic
953099634 3:39811305-39811327 TTCAATCTTCCCAAGGAACTTGG + Intronic
953825094 3:46245006-46245028 TTCAATAATCCAAAATCATTTGG + Intronic
957388012 3:79521974-79521996 TGCTATAATCCAAAGGAAGTAGG + Intronic
958787849 3:98617894-98617916 TTCAATCAGGCCGAAGAAGTGGG + Intergenic
959265962 3:104139013-104139035 CCCAGGAATCCCAAAGAAGTAGG - Intergenic
959768522 3:110064014-110064036 TTCTTTTATCCCAAGGAAGTGGG - Intergenic
960577235 3:119241159-119241181 TTAAATACTCACAAAGCAGTAGG + Intergenic
961331157 3:126139406-126139428 TTCAATAATCCCTAATAAGTGGG + Intronic
1202739483 3_GL000221v1_random:40882-40904 ATAAAGAATCCCAAAGAAGCTGG + Intergenic
969112752 4:4853875-4853897 TTCAGGACTCCCAAAGAAGGTGG + Intergenic
969278414 4:6152631-6152653 TGCAATATTCTCACAGAAGTGGG + Intronic
970042870 4:11816557-11816579 TTCAGTAACACCAAAAAAGTAGG + Intergenic
970243422 4:14032987-14033009 CTCAAGAAACCCAAAGAGGTAGG - Intergenic
971356136 4:25896773-25896795 TTCCATATTCCCAAAGAAGGAGG - Intronic
973365103 4:49202594-49202616 ATAAAGAATCCCAAAGAAGCTGG - Intergenic
973395487 4:49589860-49589882 ATAAAGAATCCCAAAGAAGCTGG + Intergenic
973909199 4:55562432-55562454 TTCTATAATTCCAATGAATTTGG + Exonic
974189703 4:58488856-58488878 TTCTGTAATCCCAAATAGGTAGG - Intergenic
974221916 4:58986095-58986117 TAAAAAAATTCCAAAGAAGTGGG - Intergenic
975058588 4:69967940-69967962 TTGAAACATACCAAAGAAGTGGG + Intergenic
975682779 4:76893347-76893369 TTCAATATTCCCAAAGTGTTGGG - Intergenic
976868313 4:89758408-89758430 TTCAATAATACCAAACAAGTGGG + Intronic
977256846 4:94750449-94750471 TTGAATATTGCCAAAGAGGTTGG + Intergenic
977741209 4:100485698-100485720 ATTAATAATCAAAAAGAAGTTGG - Intronic
979189476 4:117838804-117838826 TTTAATCACACCAAAGAAGTTGG + Intergenic
979436141 4:120694033-120694055 TTCAATCATCCCATATAATTAGG - Exonic
980325881 4:131345210-131345232 TTCAGTAACCCCAGAGGAGTTGG + Intergenic
980589601 4:134868322-134868344 TTAAAAAATCCCAGAGAACTAGG + Intergenic
982222856 4:153139836-153139858 TTCAAGAGTCCAAAAGAACTTGG - Intergenic
982363181 4:154545755-154545777 CTTAATAATTCCAAAGAAGAGGG + Intronic
982670045 4:158309691-158309713 TACAATAATCACAAAGAAAATGG - Intergenic
982721346 4:158863222-158863244 TTCCATTATTACAAAGAAGTCGG + Intronic
982916096 4:161211425-161211447 ATCAATAATACCAAAAAAGATGG - Intergenic
983840011 4:172446167-172446189 TAATATTATCCCAAAGAAGTAGG + Intronic
1202762484 4_GL000008v2_random:124221-124243 ATAAAGAATCCCAAAGAAGTTGG - Intergenic
986124602 5:4873706-4873728 CTCAACAATCCCAAAGCAGAAGG - Intergenic
986591730 5:9377579-9377601 TTCAATAATCCAAAACAACTAGG + Intronic
986731094 5:10635680-10635702 TTCATCAATCCAAAAGAAGAAGG - Intronic
988985006 5:36609358-36609380 GTCAAAAATTCCAAATAAGTAGG - Intronic
989007817 5:36834638-36834660 TTAAATCATCCTGAAGAAGTGGG + Intergenic
991017761 5:61949720-61949742 TCCAATCATTCAAAAGAAGTGGG + Intergenic
991189315 5:63850786-63850808 TTCAATAAACCAAAACAAGGAGG + Intergenic
994438526 5:99769736-99769758 TACCATGACCCCAAAGAAGTAGG - Intergenic
996296048 5:121918138-121918160 TTCAATAATCTTAAAAAAGAGGG + Intergenic
996863261 5:128088811-128088833 TTCATTAATTCCTAAGAAATAGG + Intronic
998121229 5:139579749-139579771 TTAAATAATCACATAGATGTTGG + Intronic
998382220 5:141734034-141734056 TGCATTGAACCCAAAGAAGTTGG + Intergenic
998617461 5:143756215-143756237 TTTATTAATCCCAAACAAATGGG + Intergenic
1001991328 5:176117977-176117999 GTAAATAAGCCCAGAGAAGTAGG + Intronic
1002225547 5:177720159-177720181 GTAAATAACCCCAGAGAAGTAGG - Intronic
1002268302 5:178051046-178051068 GTAAATAACCCCAGAGAAGTAGG + Intronic
1003349615 6:5303655-5303677 TGCAATAATCACAAAGATGGAGG - Intronic
1004834769 6:19517831-19517853 TTCAATCATCCCACAGGATTTGG + Intergenic
1005668712 6:28082790-28082812 TTCAATAATGGAAAAGAATTTGG - Intronic
1008700255 6:54090839-54090861 TACATTAATCTCAAATAAGTGGG - Intronic
1010561396 6:77355814-77355836 ATAGATAATCCCAAAGAACTGGG + Intergenic
1011176904 6:84573447-84573469 TTCTATTATCTCAAAGAATTTGG - Intergenic
1011980339 6:93367557-93367579 TTCAATGATCCTAAAGAGGTAGG + Intronic
1015770496 6:136763392-136763414 CTCAATATGCCCAAAGATGTGGG + Intronic
1017160495 6:151361183-151361205 TTTAATAATCTCAAATAACTAGG + Intergenic
1017325333 6:153135344-153135366 TTCAAGAAACCCAAATAAGCAGG - Intergenic
1017370397 6:153699382-153699404 TTCATTAATTCTAAAGAATTAGG + Intergenic
1017568432 6:155713944-155713966 TTCAATAATCGTAATGAAGAGGG - Intergenic
1017840577 6:158219126-158219148 TAAAATAATCCCAGTGAAGTGGG - Intergenic
1019082063 6:169441075-169441097 GTCAATAATCTCAAAGTATTTGG - Intergenic
1019914932 7:4126852-4126874 CACAATGATCCCAATGAAGTAGG - Intronic
1020405493 7:7828790-7828812 TTCAGTAATTCCTAAGTAGTGGG - Intronic
1021173568 7:17423848-17423870 TAAAATAATTCCAAAGAATTTGG + Intergenic
1024477043 7:49823535-49823557 TTGAATAATTCCAAATAAGAAGG + Intronic
1024954504 7:54902449-54902471 ATGAATAATCATAAAGAAGTAGG + Intergenic
1026086620 7:67268227-67268249 CTCATCAATCCCACAGAAGTGGG - Intergenic
1027937265 7:84623789-84623811 TTAATGAATCCAAAAGAAGTCGG + Intergenic
1033378754 7:140791362-140791384 TTCAAGAATACCAAAGTAGTTGG - Intronic
1039116815 8:34100540-34100562 ATAAATAATCCCCAAGAAGGAGG - Intergenic
1039545674 8:38409429-38409451 TTCATCATTCCCAAAGAACTGGG - Intronic
1042302237 8:67297415-67297437 TAAAATAATCCCAAAGTAGCTGG + Intronic
1042393939 8:68268870-68268892 TTGACTAATACAAAAGAAGTTGG - Intergenic
1042882427 8:73508522-73508544 TACAATAATCATAAAAAAGTTGG + Intronic
1043458130 8:80432305-80432327 TTCTTTAATCCCCAATAAGTAGG - Intergenic
1044306112 8:90643341-90643363 CTCAATAATCCTATGGAAGTAGG + Intronic
1044872125 8:96629761-96629783 TTCACTAAGCACAAATAAGTTGG - Intergenic
1046263263 8:111798776-111798798 TTCAAACATCCCCAAGAAGTTGG + Intergenic
1047683899 8:127283929-127283951 TTCAATCATCCCAATGATGCAGG + Intergenic
1048429290 8:134353969-134353991 TTAAATAATCCCATAGATTTTGG - Intergenic
1050635604 9:7608992-7609014 TTCAATAATAGCAAAGATGCTGG + Intergenic
1050782378 9:9353923-9353945 TTCAATAACCTGAAAGAACTTGG - Intronic
1052120321 9:24707014-24707036 TTCGATAATTCAAAATAAGTAGG - Intergenic
1058324277 9:103676077-103676099 TTAATTAATCCCAAAGACGCAGG + Intergenic
1058899283 9:109428168-109428190 TTCACAATTCCCTAAGAAGTGGG + Intronic
1060380909 9:123170975-123170997 TTAAACGATCCCAAAAAAGTAGG + Intronic
1060484869 9:124040673-124040695 TTCACGAAACCCTAAGAAGTAGG - Intergenic
1060616768 9:125023769-125023791 TTCAATAAGCATACAGAAGTGGG + Intronic
1062195584 9:135272044-135272066 TTAAATAATCCCAAATTAGCAGG + Intergenic
1203749367 Un_GL000218v1:64360-64382 ATAAAGAATCCCAAAGAAGCTGG + Intergenic
1203708127 Un_KI270742v1:70831-70853 ATAAAGAATCCCAAAGAAGCTGG + Intergenic
1203543247 Un_KI270743v1:109102-109124 ATAAAGAATCCCAAAGAAGTTGG - Intergenic
1188374463 X:29410552-29410574 TTCAAAAATCCATATGAAGTGGG - Intronic
1190024144 X:46907326-46907348 TTCTATAATACCAAAGAGGAGGG + Intergenic
1193678478 X:84486119-84486141 TCAGATAATCCAAAAGAAGTTGG - Intronic
1193821963 X:86175817-86175839 TTCAATTTTCTCAATGAAGTGGG + Intronic
1194315730 X:92375055-92375077 TTTAATAATCCCAAATATTTAGG - Intronic
1194726143 X:97399551-97399573 TGCAACAAGCCCAAAGAAGGAGG - Intronic
1195726614 X:107924153-107924175 TTCATTACTCCCATAGAACTAGG - Intronic
1196072121 X:111537093-111537115 TTGATTAATCCAAAAGAAGGTGG + Intergenic
1200623781 Y:5486589-5486611 TTTAATAATCCCAAATATTTAGG - Intronic
1201162734 Y:11179371-11179393 ATAAAGAATCCCAAAGAAGCTGG + Intergenic
1201425360 Y:13844490-13844512 TTCACAAATCCCAGAGAATTAGG - Intergenic