ID: 917473766

View in Genome Browser
Species Human (GRCh38)
Location 1:175350485-175350507
Sequence TAGACCTTGGATGAAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917473764_917473766 9 Left 917473764 1:175350453-175350475 CCTCATTTATATTCATATCTCTA 0: 1
1: 0
2: 5
3: 54
4: 544
Right 917473766 1:175350485-175350507 TAGACCTTGGATGAAATTTCAGG 0: 1
1: 0
2: 1
3: 28
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917473766 Original CRISPR TAGACCTTGGATGAAATTTC AGG Intronic
906908888 1:49925253-49925275 TAGCTCCTGGATGACATTTCTGG + Intronic
907990592 1:59578660-59578682 CATTCCTGGGATGAAATTTCAGG - Intronic
908715961 1:67069302-67069324 TACACCTTGGATGAAACTTGAGG - Intergenic
909900789 1:81132177-81132199 TAAGCCTGGGATGCAATTTCAGG - Intergenic
910519739 1:88106183-88106205 TAGCCCATGGATGAATTTTCTGG + Intergenic
910536820 1:88307654-88307676 TACACCTAGCATCAAATTTCAGG - Intergenic
912056313 1:105603212-105603234 TAGATGTTGGATGAAATTTTAGG + Intergenic
912633236 1:111267434-111267456 TAGCTCTTGGATGGCATTTCTGG - Intergenic
913303766 1:117401331-117401353 CAGAGCTTGAATTAAATTTCTGG + Intronic
913981279 1:143519286-143519308 TATACCTAGGAATAAATTTCTGG - Intergenic
914075650 1:144345941-144345963 TATACCTAGGAATAAATTTCTGG - Intergenic
914103528 1:144620555-144620577 TATACCTAGGAATAAATTTCTGG + Intergenic
916438197 1:164796364-164796386 TAGAGCTTGGAATAAAATTCAGG - Intronic
917088583 1:171328840-171328862 TTGCCCCTGGATGAAATCTCAGG + Intronic
917473766 1:175350485-175350507 TAGACCTTGGATGAAATTTCAGG + Intronic
918619534 1:186586799-186586821 TAGGCTTAGGATGAAATTTAAGG - Intergenic
918990561 1:191693130-191693152 TAGACACAGGATGAAATTACAGG - Intergenic
919067792 1:192714774-192714796 TGGCCCTTGGATGGCATTTCTGG + Intergenic
920142826 1:203831848-203831870 TTTACCTTTGATGAATTTTCAGG + Intronic
921638100 1:217521480-217521502 TAGACCTTGCCTGTAACTTCTGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063649246 10:7917177-7917199 TAAACATTTGATAAAATTTCAGG + Intronic
1064696784 10:17975188-17975210 TGGCCCTTGGATGGGATTTCTGG - Intronic
1065225171 10:23536219-23536241 TTGGGCTTGGATGAATTTTCAGG + Intergenic
1066649701 10:37642785-37642807 TGGCTCTTGGATGACATTTCTGG - Intergenic
1067032588 10:42888331-42888353 TGGCTCTTGGATGACATTTCTGG - Intergenic
1068411365 10:56660152-56660174 TGGCTCTTGGATGACATTTCTGG - Intergenic
1068627575 10:59265696-59265718 TAGAACTTAGAAGAAATTTAAGG + Intronic
1070463545 10:76693911-76693933 TAGACCATGGAAGTCATTTCAGG + Intergenic
1071048379 10:81413920-81413942 TAGACCTTGGGAGAAATTTGAGG - Intergenic
1071377238 10:85019977-85019999 TAGAACTTGGAAGAAACTTTGGG + Intergenic
1071719120 10:88125068-88125090 TATAGCTAGGATGAAATTTCTGG - Intergenic
1071869726 10:89780912-89780934 CAGAATTTGGATGGAATTTCTGG - Intergenic
1075261311 10:120965724-120965746 TAGAACCTGGAGGGAATTTCTGG - Intergenic
1075843605 10:125526874-125526896 AAGACATTTTATGAAATTTCAGG - Intergenic
1077749315 11:4946805-4946827 CAGGCATTGGATGAAATTTCAGG + Exonic
1078680093 11:13467764-13467786 TAGACCTGGTATGTAAATTCAGG - Intergenic
1079486985 11:20945391-20945413 TAGAACTTGCATGTAACTTCCGG + Intronic
1080415060 11:32061877-32061899 GAGACAGTTGATGAAATTTCTGG + Intronic
1081265344 11:41014337-41014359 TAGACCTGGGTTGGAATTTCTGG - Intronic
1082089836 11:48080216-48080238 TGGAACTTGGATTTAATTTCAGG + Intronic
1082252074 11:49993632-49993654 TGGTCTTTGGATTAAATTTCTGG - Intergenic
1086141122 11:83501597-83501619 TTGACCTTGAATGAGGTTTCAGG - Intronic
1087017630 11:93569721-93569743 TAGAACCTGGATGCAATCTCAGG + Intergenic
1089043495 11:115477295-115477317 TATACCTTGGATAAGATTTAAGG - Intronic
1093122967 12:15295109-15295131 TAGCTCCTGGATGACATTTCTGG + Intronic
1093124555 12:15313068-15313090 TGGCCCTTGGAAGACATTTCTGG - Intronic
1094258587 12:28464908-28464930 TGGCTCTTGGATGACATTTCTGG + Intronic
1095573597 12:43709893-43709915 TGGCTCTTGGATGACATTTCTGG - Intergenic
1096327296 12:50675611-50675633 TAGATCTTAGATGAAAATTAAGG + Intronic
1097037105 12:56131188-56131210 TAGTCCTTGGCTGAAGTTGCGGG - Intronic
1099523304 12:83690094-83690116 TAGGCCTTGGATGAAACCTAAGG + Intergenic
1100270963 12:93024143-93024165 TACACCATGGATGAAACTTGAGG - Intergenic
1100909163 12:99338451-99338473 TAGCTCTTAGATGACATTTCTGG - Intronic
1101579385 12:106028113-106028135 TTGATCTTGGATGAGATTGCTGG - Intergenic
1105406327 13:20135476-20135498 TACAACATGGATGAAATTTGAGG - Intergenic
1108879077 13:55087096-55087118 TAGCTCCTGGATGACATTTCTGG - Intergenic
1109685853 13:65819001-65819023 TGGCTCTTGGATGATATTTCTGG + Intergenic
1110501318 13:76231560-76231582 TGGCCCTTGGATGGCATTTCTGG + Intergenic
1111817412 13:93170846-93170868 CATGCCTTGGATAAAATTTCAGG - Intergenic
1111894812 13:94128161-94128183 TAGACTTTTGATGAAAATTTAGG + Intronic
1112856981 13:103784743-103784765 TAAACCTTGGATTAACTCTCAGG + Intergenic
1114624006 14:24116775-24116797 TAGACCTTGGCTGTTATTTTTGG - Intronic
1116411240 14:44626202-44626224 TACACCTGGCATAAAATTTCAGG + Intergenic
1117242152 14:53844896-53844918 TAGGCCTTGAATCAGATTTCTGG - Intergenic
1117504463 14:56388596-56388618 TAGCTCCTGGATGACATTTCTGG - Intergenic
1118792068 14:69103907-69103929 TACAACTTGGATGAACTTTAAGG - Intronic
1121224747 14:92313074-92313096 AAGACCTTGAATATAATTTCTGG - Intergenic
1121763055 14:96461932-96461954 TAAGCCTTGGATAAGATTTCTGG - Intronic
1122066568 14:99177952-99177974 AAGACCTTGGATGGAATTCAGGG - Intronic
1202938651 14_KI270725v1_random:119682-119704 TATACCTAGGAATAAATTTCTGG + Intergenic
1123394546 15:19918213-19918235 TATACCTAGGAATAAATTTCTGG - Intergenic
1124907109 15:33880245-33880267 GAGGACTTGGATGAAATTCCTGG + Intronic
1129122630 15:73410673-73410695 TTGAACTTGGATGACATGTCTGG - Intergenic
1131714773 15:95096498-95096520 GGGACCTTGGTTGGAATTTCAGG - Intergenic
1133307509 16:4819985-4820007 TAGACCTGGGATAAAGCTTCTGG + Intronic
1136679193 16:31945575-31945597 TAGCTCTTGGATGACATTTCAGG + Intergenic
1136697268 16:32094787-32094809 TATACCTGGGAATAAATTTCTGG + Intergenic
1136700580 16:32136309-32136331 TATACCTAGGAATAAATTTCTGG - Intergenic
1136767077 16:32791156-32791178 TATACCTAGGAATAAATTTCTGG + Intergenic
1136797767 16:33038078-33038100 TATACCTGGGAATAAATTTCTGG + Intergenic
1136801071 16:33079545-33079567 TATACCTAGGAATAAATTTCTGG - Intergenic
1136863336 16:33716544-33716566 TATACCTAGGAATAAATTTCTGG + Intergenic
1136936835 16:34476408-34476430 TATACCTTGGAATAAATTTCTGG + Intergenic
1136944894 16:34637529-34637551 TATACCTAGGAATAAATTTCTGG - Intergenic
1136947838 16:34676673-34676695 TATACCTAGGAATAAATTTCTGG - Intergenic
1136955228 16:34776557-34776579 TATACCTAGGAATAAATTTCTGG - Intergenic
1136962984 16:34872162-34872184 TATACCTTGGAATAAATTTCTGG - Intergenic
1137092132 16:36206637-36206659 TATACCTAGGAATAAATTTCTGG - Intergenic
1137221704 16:46458970-46458992 TATACCTAGGAATAAATTTCTGG + Intergenic
1140100562 16:71912890-71912912 TACAACATGGATGAAATTTGAGG - Intronic
1203069474 16_KI270728v1_random:1053402-1053424 TATACCTAGGAATAAATTTCTGG + Intergenic
1203124827 16_KI270728v1_random:1564696-1564718 TATACCTAGGAATAAATTTCTGG + Intergenic
1143599973 17:7938697-7938719 TAGACCTGGGTTCAAATCTCAGG - Intronic
1145324182 17:21785768-21785790 TATACCTGGGAATAAATTTCTGG + Intergenic
1145689421 17:26722192-26722214 TATACCTGGGAATAAATTTCTGG - Intergenic
1145711256 17:26981314-26981336 TATACCTAGGAATAAATTTCTGG - Intergenic
1145873094 17:28292875-28292897 TAGGCATTGCATGTAATTTCTGG - Intergenic
1149884064 17:60323126-60323148 TATACCTTGCATGGAATTTCTGG - Intronic
1203182680 17_KI270729v1_random:78157-78179 TATACCTGGGAATAAATTTCTGG - Intergenic
1203190620 17_KI270729v1_random:183654-183676 TATACCTGGGAATAAATTTCTGG - Intergenic
1155282524 18:24254364-24254386 TAGCCATTGGATGAAATGTTTGG - Intronic
1155995286 18:32324849-32324871 TATACCATGTATGACATTTCTGG + Intronic
1156330542 18:36117670-36117692 TAGAGCTTGAATGAAATCTTAGG - Intronic
1159287189 18:66369737-66369759 TAGACTTTTCAGGAAATTTCAGG - Intergenic
1162693007 19:12449388-12449410 TGGATCTTGGATGGCATTTCTGG - Intronic
1164791888 19:30993377-30993399 TATATCTAGGAGGAAATTTCAGG + Intergenic
925482934 2:4296774-4296796 GAGACCATGGAGGAAATGTCTGG - Intergenic
925624696 2:5831239-5831261 TAGGCCCTGGATTAAATTTCAGG - Intergenic
928257624 2:29737886-29737908 TAGACCTTGGAAGAATAGTCAGG + Intronic
928367884 2:30716687-30716709 TAGTCCTTGGGTGACATTTCAGG - Intergenic
928458902 2:31451065-31451087 TAGGACTTGGATGGCATTTCTGG + Intergenic
931813169 2:65874446-65874468 TAGAATAGGGATGAAATTTCTGG + Intergenic
931838340 2:66123977-66123999 TATAACATGGATGAAACTTCAGG - Intergenic
933001569 2:76931008-76931030 TAGACCTTGTATGATTTTTGAGG + Intronic
933730215 2:85450626-85450648 GAGACCATGGATGGAATTCCAGG - Intergenic
934252435 2:90369814-90369836 TATACCTGGGAATAAATTTCTGG + Intergenic
934257007 2:91433131-91433153 TATACCTGGGAATAAATTTCTGG - Intergenic
934480806 2:94641516-94641538 TAGACCTTGAAAGCAATCTCAGG + Intergenic
934928689 2:98401754-98401776 AAGACTTTGCATGAAATTTGAGG - Intergenic
937165694 2:119813860-119813882 CAGTTCTGGGATGAAATTTCTGG - Intronic
937318135 2:120945025-120945047 AAGCCCTTGGATGGGATTTCAGG - Intronic
939299970 2:140322993-140323015 AAGACTTTGGATAAAATTTCAGG + Intronic
939316139 2:140551703-140551725 TATACTTTGGATGAATGTTCTGG - Intronic
940559809 2:155281094-155281116 TGGCTCTTGGATGACATTTCTGG - Intergenic
940823613 2:158385550-158385572 TAGACATTGGTAGAAACTTCTGG + Intronic
941357519 2:164511853-164511875 CAGCTCTTGGATGACATTTCTGG + Intronic
942734694 2:179096727-179096749 TAGGTCTTGGATGGCATTTCTGG - Intergenic
943008701 2:182419584-182419606 TAGAGCTTAGCTGAAAATTCTGG - Intronic
944620400 2:201508776-201508798 TAGAGCATGGATGAACTTTGAGG - Intronic
945095945 2:206219557-206219579 TAGTCCATAGATGAAATTTTTGG + Intergenic
945135720 2:206625716-206625738 TAGAGCTGGGATGAAATCCCAGG + Intergenic
945575667 2:211525664-211525686 TGGTTCTTGGATGACATTTCTGG + Intronic
945755400 2:213839743-213839765 TAACCCATTGATGAAATTTCAGG + Intronic
945831870 2:214797176-214797198 TGGGCCTTGGATGAAATATTGGG - Intronic
947009115 2:225546613-225546635 TAGTTCTTGGATGGCATTTCTGG - Intronic
947527781 2:230889784-230889806 CTGACCTTGGATGAAATTGAAGG + Intergenic
1169292654 20:4365842-4365864 AAGAAGTTGGATGAAATTTGAGG + Intergenic
1169716183 20:8621127-8621149 TTGACCTTGGATGAAAGTTGAGG + Intronic
1169786159 20:9361325-9361347 TAGAGCATGGATGAACTTTGAGG + Intronic
1170071217 20:12371086-12371108 TAGAGTTAGGAGGAAATTTCTGG - Intergenic
1170452580 20:16499431-16499453 TTGACCTTGGGTTAACTTTCTGG - Intronic
1170930271 20:20763340-20763362 TATACCTGGAATGGAATTTCTGG - Intergenic
1175779538 20:61673506-61673528 TTCACCTTAGATGAAATGTCAGG + Intronic
1176042956 20:63075219-63075241 TACAACGTGGATGAAATTTGAGG - Intergenic
1176584662 21:8569451-8569473 TATACCTAGGAATAAATTTCTGG - Intergenic
1177334485 21:19705921-19705943 CAGAGCTTGGTTGAAACTTCAGG + Intergenic
1177444395 21:21173799-21173821 GAGACCTTTGATGAAAATTGAGG + Intronic
1178202205 21:30420053-30420075 AAAACCATGAATGAAATTTCTGG - Intronic
1178723842 21:35034148-35034170 GTGACCTTGGATGAAATATTTGG + Intronic
1180267473 22:10546353-10546375 TATACCTAGGAATAAATTTCTGG - Intergenic
1182156628 22:28079687-28079709 TACACCATGGATGAATTTTGAGG - Intronic
1182167363 22:28189588-28189610 AAGACCTTCTGTGAAATTTCAGG + Intronic
1182838576 22:33364688-33364710 TATAACTTGGATGAACTTTGAGG - Intronic
1183242168 22:36666059-36666081 TACACCATGGATGAAACTTGAGG + Intronic
1203325785 22_KI270738v1_random:15291-15313 TATACCTGGGAATAAATTTCTGG + Intergenic
950145363 3:10646070-10646092 TGGGCTTTGGATGAAGTTTCTGG - Intronic
951049014 3:18073488-18073510 TAGATCTTGGAGAAATTTTCTGG + Intronic
951715722 3:25643693-25643715 AAGATCTTTGATGAAATTTTGGG - Exonic
954889825 3:53915194-53915216 TAGTACATGGATGAAATTTGAGG - Intergenic
955805474 3:62729513-62729535 GAGACCTTGGATGAAATCTCAGG + Intronic
956476078 3:69621606-69621628 TAGCTCCTGGATGACATTTCTGG + Intergenic
956869425 3:73402205-73402227 TAGACCTAAGAGGAAATTACAGG + Intronic
957337618 3:78852070-78852092 TAAAACATGGATTAAATTTCTGG - Intronic
958837558 3:99163311-99163333 TAGCTCTCGGATGAAATTTCTGG + Intergenic
959404527 3:105943941-105943963 TTGACAATGGTTGAAATTTCAGG + Intergenic
960091709 3:113646673-113646695 TAGACATTGTATGTATTTTCTGG + Intergenic
960504654 3:118478352-118478374 AAGACAATGGCTGAAATTTCAGG + Intergenic
963172983 3:142270138-142270160 TATACCTAGGATGAAATTGCTGG - Intergenic
963740518 3:149075632-149075654 TAGACCTTGGTTCAAATATTAGG - Intronic
965916722 3:173857396-173857418 TAGACCTGGGAGGGAGTTTCAGG - Intronic
966141966 3:176767183-176767205 TCGTCCTTGGATGGCATTTCTGG + Intergenic
966563828 3:181353602-181353624 CAGAGTTTGGATGAAGTTTCAGG + Intergenic
966838776 3:184070890-184070912 TACACCATGGATGAAACTTGAGG + Intergenic
967225881 3:187290864-187290886 TAGAACTTGTATGAAAGGTCTGG + Intronic
968900498 4:3429348-3429370 TACGCCCTGGATGAAAATTCAGG - Intronic
969315750 4:6380610-6380632 TAGACCCTGGATGAATGGTCAGG - Intronic
969919929 4:10528444-10528466 TAGAACTTGGCTCAGATTTCAGG - Intronic
971745374 4:30572948-30572970 TATACCTGGGATTAAGTTTCAGG - Intergenic
972114764 4:35617757-35617779 TAGACCTTGGAAAGAATTTATGG + Intergenic
972904454 4:43728080-43728102 TAGCTTTTGGATGACATTTCTGG + Intergenic
973214646 4:47655394-47655416 TGGCTCTTGGATGACATTTCTGG + Intronic
973599881 4:52531677-52531699 TAGAGCTTGGATAAAAGATCAGG - Intergenic
974103529 4:57442848-57442870 CAGACCTTGGATGAAAGATCAGG - Intergenic
975122062 4:70739118-70739140 TAGACCTTGGCCCAAATTACTGG + Intronic
976366100 4:84234053-84234075 TAGAGCTAGGATGGAATTTATGG - Intergenic
976422700 4:84864694-84864716 TAGAACTTGGATGAGAATCCAGG + Intronic
979819971 4:125158903-125158925 TAAATGTAGGATGAAATTTCAGG + Intergenic
980820996 4:138017491-138017513 TATACTTAGGATGAAATTACTGG + Intergenic
980924731 4:139123719-139123741 TAGAACCTGTTTGAAATTTCTGG - Intronic
985799937 5:1998650-1998672 AAGGCCTTGGATGAAAGTCCTGG + Intergenic
986695302 5:10349920-10349942 AAAACATTGCATGAAATTTCAGG - Intergenic
987357394 5:17076404-17076426 TACAACTTGGATGAAACTTAAGG - Intronic
989664107 5:43832698-43832720 TAGAATTTTTATGAAATTTCAGG + Intergenic
992128818 5:73670289-73670311 GAGAACATGGATGAAACTTCAGG - Intronic
992345199 5:75869224-75869246 TGGCTCTTGGATGACATTTCTGG + Intergenic
992721142 5:79562289-79562311 CCGTCCTTGGATGAAATTTTAGG - Intergenic
994974125 5:106780182-106780204 TGGCTCTTGGATGGAATTTCTGG + Intergenic
998782383 5:145672320-145672342 TAGACCTAGGCTGTAATTTGGGG + Intronic
998830206 5:146149374-146149396 GAGAACTTTGATGATATTTCTGG - Intronic
1001177674 5:169486984-169487006 TGGCTCTTGGATGGAATTTCTGG + Intergenic
1001245122 5:170100487-170100509 CAGGGCTTGGGTGAAATTTCAGG - Intergenic
1005853737 6:29844150-29844172 TAAACCTTTGATGATTTTTCAGG + Intergenic
1006259435 6:32855249-32855271 TAGACCTGGGACTAAAATTCAGG - Intronic
1006428826 6:33982760-33982782 AAGACCTTGGATGAGGTCTCTGG + Intergenic
1006462952 6:34174455-34174477 TAGCTCTTGGATGGCATTTCTGG - Intergenic
1007043126 6:38743885-38743907 TATACCTGGGGTGGAATTTCTGG + Intronic
1008731818 6:54491930-54491952 TAGCTCCTGGATGACATTTCTGG - Intergenic
1008880777 6:56378295-56378317 CAGCTCTTGGATGACATTTCTGG + Intronic
1013687473 6:112601755-112601777 TAGCTCTTGGATAACATTTCTGG + Intergenic
1014636888 6:123858623-123858645 TAGAACTTGGATGAGATTCTAGG + Intronic
1014813915 6:125914645-125914667 TGAACCTTGGAGGATATTTCAGG + Intronic
1016241150 6:141932546-141932568 TTTACCTTGGCTGATATTTCTGG + Intergenic
1016256001 6:142106152-142106174 TAGACCTAGCATGTAAATTCAGG - Intergenic
1017089582 6:150747257-150747279 TTCACTTTGGAAGAAATTTCTGG - Intronic
1017575219 6:155794676-155794698 TAGTCCGTGGATGATATTTAAGG + Intergenic
1019758697 7:2792545-2792567 TAGAACTTGGATGGAAATTGAGG - Intronic
1021046159 7:15925311-15925333 TGGCTCTTGGATGACATTTCTGG + Intergenic
1021530223 7:21635749-21635771 TAGACCTAGCATGTAATATCTGG - Intronic
1023920147 7:44622859-44622881 ATGACCTTGGATGAAATGTAAGG + Intronic
1024849585 7:53695701-53695723 TAGACCTTGGATTACAACTCTGG + Intergenic
1025305985 7:57856066-57856088 TATACCTGGGAATAAATTTCTGG + Intergenic
1025319366 7:58077605-58077627 TATACCTGGGAATAAATTTCTGG - Intergenic
1025483205 7:61012339-61012361 TATACCTAGGAATAAATTTCTGG - Intergenic
1025489303 7:61092448-61092470 TATACCTAGGAATAAATTTCTGG + Intergenic
1026152345 7:67798830-67798852 TTCACCTTAGATGAAATATCAGG - Intergenic
1027557043 7:79677868-79677890 AAGACAATGGATGAAATTTGGGG + Intergenic
1027941487 7:84686740-84686762 GATACCTTGCATGCAATTTCAGG + Intergenic
1030093830 7:105880056-105880078 TTGACTTTGGATGAAAATTGAGG + Intronic
1030749927 7:113218931-113218953 TACAACATGGATGAAACTTCAGG - Intergenic
1032541175 7:132704334-132704356 TAGAGCCTGGAGGAAATTCCTGG - Intronic
1033993943 7:147322092-147322114 TAGAACTTGGATGTAATATCTGG - Intronic
1033993956 7:147322174-147322196 TAAACATTGTATGAGATTTCAGG - Intronic
1034387858 7:150755468-150755490 TAGACCTTGCAAGAAATTCCAGG - Intergenic
1034722077 7:153302646-153302668 TTGACCTTGAATGCAATTTAGGG + Intergenic
1036452084 8:8877732-8877754 GAGACCTTGGAAGAGATTTATGG - Intronic
1037003073 8:13744978-13745000 TAGAGCCAAGATGAAATTTCAGG - Intergenic
1037572728 8:20172354-20172376 TAGGCCGGGGAAGAAATTTCAGG + Intronic
1038382520 8:27109956-27109978 GAGAACTTGGTGGAAATTTCAGG - Intergenic
1038850326 8:31269182-31269204 TGGACCTTGGATGAGTCTTCAGG - Intergenic
1041612468 8:59867884-59867906 TAGACTTTGGAAGCAATGTCTGG - Intergenic
1043025597 8:75064038-75064060 TCAACTTTGGATAAAATTTCTGG + Intergenic
1044261829 8:90134028-90134050 TAACACATGGATGAAATTTCAGG - Intergenic
1045364780 8:101465838-101465860 TATAACTTGGATGAAACTTCAGG + Intergenic
1045809379 8:106203360-106203382 TAGACCTTGGATTTATTTGCTGG + Intergenic
1047100747 8:121673336-121673358 TAGAGCTTGGATTTCATTTCTGG + Intergenic
1048757812 8:137757153-137757175 TGGCTCTTGGATGGAATTTCTGG + Intergenic
1051245835 9:15110063-15110085 TAGACATTGTATATAATTTCAGG + Intergenic
1051573377 9:18585030-18585052 TAGAGCTTGGATGAATTTTGAGG - Intronic
1052399590 9:27983878-27983900 TAGACCTTGCCAGAAATTTCTGG - Intronic
1055651260 9:78409515-78409537 TAGGGGTTGGATGAGATTTCAGG + Intergenic
1057527319 9:95814368-95814390 AAGGCTTTGGATGAAATTACAGG + Intergenic
1057971171 9:99559213-99559235 TAGAAGTTGGTTGAAGTTTCTGG - Intergenic
1058983145 9:110188599-110188621 AAGGCCTTGGATGAAATTCATGG - Intergenic
1059191151 9:112327657-112327679 TATACCTTGGATGTTATTTGTGG - Intronic
1059764431 9:117370457-117370479 TAGAACATGGATGACATTTTTGG - Intronic
1203770071 EBV:45384-45406 TCGGCCTTGGTTGTAATTTCAGG + Intergenic
1203614567 Un_KI270749v1:46973-46995 TATACCTAGGAATAAATTTCTGG - Intergenic
1185894524 X:3845563-3845585 TAGACTATGGATGAAATCTCAGG + Intergenic
1185899642 X:3883987-3884009 TAGACTATGGATGAAATCTCAGG + Intergenic
1185904758 X:3922416-3922438 TAGACTATGGATGAAATCTCAGG + Intergenic
1186576213 X:10768753-10768775 TAAACTTTGGAGGACATTTCCGG + Intronic
1187919695 X:24189196-24189218 TAGAATTTGGATTAAATTTAGGG + Intronic
1188972291 X:36632729-36632751 TGGATCTTGGATGGAATTTCTGG - Intergenic
1190907874 X:54746303-54746325 TGGATCTTGGATGGCATTTCTGG - Intergenic
1191044717 X:56123430-56123452 TAGACATTGGATGAAATAAGAGG + Intergenic
1192836138 X:74801780-74801802 TGGCTCTTGGATGACATTTCTGG + Intronic
1192955528 X:76065989-76066011 TAGATCTTGGAGATAATTTCAGG + Intergenic
1193191121 X:78572444-78572466 TTGATCTTGGATGGCATTTCTGG - Intergenic
1193194842 X:78619618-78619640 TGGCCCTTGGATGGCATTTCTGG - Intergenic
1193297128 X:79846443-79846465 TGGCTCTTGGATGGAATTTCTGG - Intergenic
1194361025 X:92950534-92950556 TGGCTCTTGGATGGAATTTCTGG - Intergenic
1196088828 X:111716708-111716730 TAGACCTGGGATCAAATAACTGG + Intronic
1197835091 X:130685944-130685966 AAGCACTTGGATGAAATGTCAGG + Intronic
1198938891 X:141931375-141931397 TGAATCTTGGATGACATTTCTGG - Intergenic
1199159907 X:144596859-144596881 TGGCACTTGGATGACATTTCTGG - Intergenic
1199426615 X:147709234-147709256 TAGAACTTGGAGTAGATTTCTGG - Intergenic
1199462971 X:148104033-148104055 CACATCTTGGATGAAACTTCAGG - Intergenic
1200669222 Y:6066346-6066368 TGGCTCTTGGATGGAATTTCCGG - Intergenic
1200923935 Y:8637741-8637763 TAGGCCTTGCATGAGCTTTCTGG - Intergenic