ID: 917475228

View in Genome Browser
Species Human (GRCh38)
Location 1:175363570-175363592
Sequence ATGCTGCATCAGAATGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 212}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917475228_917475231 3 Left 917475228 1:175363570-175363592 CCACTCTCATTCTGATGCAGCAT 0: 1
1: 0
2: 5
3: 17
4: 212
Right 917475231 1:175363596-175363618 ACAGAGAAGAGGAAAAACGCAGG 0: 1
1: 0
2: 2
3: 37
4: 476
917475228_917475233 12 Left 917475228 1:175363570-175363592 CCACTCTCATTCTGATGCAGCAT 0: 1
1: 0
2: 5
3: 17
4: 212
Right 917475233 1:175363605-175363627 AGGAAAAACGCAGGCAGGAGTGG 0: 1
1: 1
2: 5
3: 65
4: 582
917475228_917475235 24 Left 917475228 1:175363570-175363592 CCACTCTCATTCTGATGCAGCAT 0: 1
1: 0
2: 5
3: 17
4: 212
Right 917475235 1:175363617-175363639 GGCAGGAGTGGATGTTCTGCGGG 0: 1
1: 0
2: 2
3: 19
4: 215
917475228_917475234 23 Left 917475228 1:175363570-175363592 CCACTCTCATTCTGATGCAGCAT 0: 1
1: 0
2: 5
3: 17
4: 212
Right 917475234 1:175363616-175363638 AGGCAGGAGTGGATGTTCTGCGG 0: 1
1: 0
2: 2
3: 29
4: 369
917475228_917475229 -8 Left 917475228 1:175363570-175363592 CCACTCTCATTCTGATGCAGCAT 0: 1
1: 0
2: 5
3: 17
4: 212
Right 917475229 1:175363585-175363607 TGCAGCATGCCACAGAGAAGAGG 0: 1
1: 0
2: 2
3: 46
4: 301
917475228_917475232 7 Left 917475228 1:175363570-175363592 CCACTCTCATTCTGATGCAGCAT 0: 1
1: 0
2: 5
3: 17
4: 212
Right 917475232 1:175363600-175363622 AGAAGAGGAAAAACGCAGGCAGG 0: 1
1: 0
2: 2
3: 46
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917475228 Original CRISPR ATGCTGCATCAGAATGAGAG TGG (reversed) Intronic
902178638 1:14670565-14670587 CTACTGAATCAGAATCAGAGGGG - Intronic
905252150 1:36656426-36656448 CTGCTGCATCAGCATGAGGCTGG + Intergenic
905334815 1:37237339-37237361 ATGAGGAATCAGAATGAGCGTGG + Intergenic
908206690 1:61857770-61857792 ATTCTGCATCAGAATTACATAGG - Intronic
908893474 1:68872127-68872149 ATGGTGGAACAGTATGAGAGTGG - Intergenic
908903677 1:68984337-68984359 AAGCTGCATAAAAATAAGAGAGG - Intergenic
911242434 1:95480631-95480653 ATGCTACATAAAAATGTGAGCGG - Intergenic
916668701 1:166991176-166991198 ATTCTGAATCAGAAGGGGAGTGG - Intronic
916993300 1:170267934-170267956 CTGCTGCAGGAGAATGGGAGAGG + Intergenic
917475228 1:175363570-175363592 ATGCTGCATCAGAATGAGAGTGG - Intronic
918265567 1:182839061-182839083 TTGCTGCATCAGAATGCTACAGG + Intergenic
918462386 1:184789874-184789896 ATGCTGCAGTAGAGTGAGAGAGG + Intergenic
920017376 1:202923807-202923829 CTGCTGAATCAGAATGGGAGAGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
922569176 1:226623223-226623245 TTGCTGCTAGAGAATGAGAGAGG + Intergenic
923786730 1:237075063-237075085 AACCTACATGAGAATGAGAGTGG - Intronic
924328994 1:242923657-242923679 ATGCTGGAATAGAAGGAGAGAGG - Intergenic
1066039720 10:31536086-31536108 ATAGTGCATCAGAATAACAGAGG + Intergenic
1068294142 10:55045830-55045852 ATGGTGCTTCAGGATGATAGCGG - Intronic
1069111682 10:64455024-64455046 ATTTTGCATCAGAAAGACAGAGG + Intergenic
1070311172 10:75275278-75275300 ATGCTGCAGCAGAGTGACAAAGG - Intergenic
1070507084 10:77123402-77123424 TTGCTAAATCAGAATGGGAGGGG + Intronic
1071777598 10:88806593-88806615 CTGCTGTATCAGACTGTGAGTGG + Intronic
1071786854 10:88910537-88910559 ATGTAGCATCAGAATTAGAAGGG - Intronic
1071878685 10:89870704-89870726 ATGGTGCATCTGAATTAGAAGGG - Intergenic
1071994288 10:91131608-91131630 ATGTTACTTCAGAAAGAGAGGGG - Intergenic
1073041715 10:100612393-100612415 GTGCTGTATGAAAATGAGAGTGG - Intergenic
1073426670 10:103459251-103459273 ATGCTGTATCAGAATCCTAGAGG + Intergenic
1076032185 10:127168889-127168911 ATACTGCATCACAATTACAGAGG - Intronic
1076774170 10:132685113-132685135 ATGCTGTCTCAGAGTGAGATGGG + Intronic
1077422557 11:2459816-2459838 GTGCTGCATGGGAAGGAGAGTGG - Intronic
1077906067 11:6534420-6534442 ATGTTCCATCAGAATGTGATGGG + Intronic
1078281109 11:9901973-9901995 ATGCTGTATCAGAATCAGGTTGG - Intronic
1079609523 11:22414701-22414723 CTGCTGCATGAGAATGTGTGTGG + Intergenic
1080230230 11:30012191-30012213 CTGCTGCCTCAGGATGAGGGCGG - Exonic
1080746781 11:35115492-35115514 AAGCAGCAGCAAAATGAGAGAGG + Intergenic
1080866166 11:36197210-36197232 ATGAGGCAGCAGAATGAAAGAGG - Intronic
1080890968 11:36409013-36409035 ATCTTACAGCAGAATGAGAGAGG + Intronic
1081142105 11:39514054-39514076 ATGGTACCCCAGAATGAGAGAGG - Intergenic
1081251177 11:40836349-40836371 TTGCTACAACAGAATGAGTGAGG - Intronic
1083356321 11:62068988-62069010 ATGGTGAGTCAGAAAGAGAGGGG + Intergenic
1083533108 11:63443137-63443159 ATGCTGCTTGGGAATGAGTGTGG - Intergenic
1083783754 11:64932073-64932095 AAGCTTAATCAGAATCAGAGTGG - Intronic
1086233455 11:84598180-84598202 GTGCTGCAGTAAAATGAGAGTGG - Intronic
1087940739 11:104093853-104093875 ATACTAGATCAGAAAGAGAGAGG - Intronic
1088843210 11:113643977-113643999 ATGCTGCATTGGAATGAAAAGGG + Intergenic
1090128088 11:124110684-124110706 ATGCTGTATGAGAAGGTGAGTGG + Intergenic
1091329289 11:134718135-134718157 ATGCTGCCTGGGAATGAGCGTGG + Intergenic
1094821591 12:34230482-34230504 ATGCTGCCTGAGAGAGAGAGAGG + Intergenic
1095339699 12:41075171-41075193 ATGCTGAGTCAGAATGAGAGAGG - Intergenic
1095805903 12:46321243-46321265 ATGTTCCATCAGGCTGAGAGTGG - Intergenic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1097441524 12:59614000-59614022 ATGCTGCATCAGGATCAGAATGG - Intronic
1099545998 12:83980372-83980394 ATGCTGGCTCAGACTGAGGGTGG + Intergenic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102414173 12:112746305-112746327 GTGCTGCAACAGAATGTCAGAGG + Intronic
1102763983 12:115415132-115415154 AGGCTGTGTCAGAATGAGAATGG - Intergenic
1109138798 13:58687399-58687421 TTGCAGCATGAGGATGAGAGAGG + Intergenic
1111196420 13:84880189-84880211 ATGCTGTATCAGAAAAATAGAGG - Intergenic
1111737540 13:92161162-92161184 AACCTGCATCAGAATGACATCGG + Intronic
1113381831 13:109811776-109811798 ATGCTGCATGAAAGTGGGAGGGG + Intergenic
1115152711 14:30303744-30303766 ATGCTGCAGGAGAATGAGAGTGG - Intergenic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1115577517 14:34725549-34725571 ATGATGGAGCAGAAAGAGAGAGG + Intergenic
1116115137 14:40638536-40638558 ATGCTGTATCAGAACAAAAGTGG + Intergenic
1116788213 14:49311088-49311110 TGGCTGCATCAGGATAAGAGAGG - Intergenic
1119186580 14:72647065-72647087 AGGCTGACTCAGGATGAGAGTGG - Intronic
1120664196 14:87286537-87286559 ATGATAGATCAGAAAGAGAGAGG + Intergenic
1121513730 14:94535005-94535027 ATGCTGGAACAGAAAGAAAGTGG + Intergenic
1124013385 15:25857566-25857588 AGTTTGCATCAGAATGACAGAGG + Intronic
1124065246 15:26336633-26336655 TTGCTTCATAATAATGAGAGGGG - Intergenic
1124637944 15:31376859-31376881 AAGCTGTATGAGAAAGAGAGAGG - Exonic
1126581046 15:50242815-50242837 GTGCTGACTCAGGATGAGAGTGG + Exonic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128802931 15:70508428-70508450 ATGCTGCAGCAGATTGGGGGTGG - Intergenic
1129130839 15:73493462-73493484 ATTCTGCAACAAAATGAAAGGGG - Intronic
1130793797 15:87187333-87187355 ATACTGCACCAGAAAGAGATAGG + Intergenic
1131779335 15:95839719-95839741 ATGCATCATCAGAAAAAGAGTGG - Intergenic
1135883775 16:26285066-26285088 TGGCTGGAACAGAATGAGAGAGG - Intergenic
1137303119 16:47172961-47172983 AAGTTGCAGCAGAATGAAAGAGG - Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138814279 16:60186532-60186554 ATGATGCTTTAGGATGAGAGGGG - Intergenic
1140942756 16:79737187-79737209 AAGCTGAATTAGAATGAGGGAGG - Intergenic
1141637334 16:85321303-85321325 AAGCTGCAGCACAAGGAGAGAGG + Intergenic
1144306794 17:13975940-13975962 ATCCTGCATCAGAATCACTGAGG + Intergenic
1146593248 17:34146954-34146976 AGGCTGCAGCAGGATGAGGGAGG - Intronic
1147400237 17:40176660-40176682 ATGCTGCCCCAGAAGGAGTGTGG - Intergenic
1148033924 17:44643530-44643552 ATACAACATCAGACTGAGAGGGG - Intergenic
1148258015 17:46154001-46154023 ATGCTGCATCTGATTTAGAGGGG - Intronic
1148476900 17:47934720-47934742 AAGCAGCATCAGAATCAGAGTGG + Intergenic
1152988911 18:344470-344492 AAGCAACATCAGAATGATAGGGG - Intronic
1153667860 18:7382328-7382350 ATGCTGCATCTGAATGTTAAGGG - Intergenic
1153909797 18:9696806-9696828 AATCTGCAGCAAAATGAGAGGGG - Intergenic
1155836089 18:30585834-30585856 ATTCAGCATCAGATTTAGAGGGG + Intergenic
1156665012 18:39394182-39394204 ATGTTGAATAAGAGTGAGAGAGG - Intergenic
1157849625 18:51035873-51035895 ATGCTGCTTCAGAATGGGAATGG + Intronic
1158878159 18:61752400-61752422 ATGCTGCCTCAGGAGGTGAGGGG - Intergenic
1159339683 18:67119046-67119068 CTTCTGCATCAGAAAAAGAGAGG - Intergenic
1160510639 18:79451656-79451678 GGGCTGCATCAGAAGGAGAGGGG - Exonic
1163166393 19:15500917-15500939 AAGCTGCAGCAGAGTGAGTGAGG - Intergenic
1164932645 19:32187151-32187173 AGACTGCATCAGAGTGTGAGTGG - Intergenic
1166554106 19:43686688-43686710 ATGGTCCATCAGAAAGGGAGAGG + Intergenic
1166557936 19:43713816-43713838 CTGCTGCAGCAGAATGAATGAGG + Intergenic
1168190835 19:54737879-54737901 ATGCAGCATCCTCATGAGAGGGG - Intronic
1168205762 19:54849809-54849831 ATGCAGCATCCTCATGAGAGGGG - Intronic
925032963 2:665735-665757 ATGCTCCATCTGAGTGAGTGGGG - Intergenic
925032972 2:665794-665816 ATGCTGCATCTGAGTGAGTGGGG - Intergenic
925032980 2:665853-665875 ATGCTCCATCTGAGTGAGTGGGG - Intergenic
925723625 2:6852194-6852216 ATGGTGCCTCAGTATGAGACAGG + Intronic
926077808 2:9955802-9955824 ACGCTGCATTAGAAAGACAGTGG - Intronic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
930119005 2:47744478-47744500 ATCCTGCATCAGAAAGAATGAGG + Intronic
930519186 2:52442035-52442057 ATAGTACAACAGAATGAGAGTGG + Intergenic
931494272 2:62784914-62784936 ATGATGAATCAGAATCATAGAGG - Intronic
932880014 2:75492501-75492523 ATGCTGCATAAAAATAAAAGTGG - Exonic
933022938 2:77217767-77217789 TTGCTACATCAAAATGAGATTGG - Intronic
933845937 2:86327404-86327426 AGGCTGCAGCTGAGTGAGAGAGG + Intronic
934930379 2:98417404-98417426 AACCTGGATCAGAAGGAGAGGGG + Intergenic
935260387 2:101350785-101350807 TCCCTGCAGCAGAATGAGAGAGG - Exonic
942611667 2:177747998-177748020 ATTCTGCCTCAGATTGAAAGGGG - Intronic
944300189 2:198115179-198115201 GTGCTGTCTCAGGATGAGAGTGG + Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
949071731 2:242029242-242029264 AAGCTGCATGGGAATGGGAGGGG + Intergenic
1170380348 20:15752915-15752937 AGGCTGAATTAGAATGGGAGAGG + Intronic
1173371777 20:42442935-42442957 GAGCTGAGTCAGAATGAGAGAGG + Intronic
1173929350 20:46805872-46805894 ATGCTTCATCGGGATCAGAGCGG + Intergenic
1174421246 20:50400444-50400466 TGGCTGCAGCAGAATGAGTGAGG + Intergenic
1174544249 20:51313611-51313633 ATGATTCATCAGCATGAGGGTGG + Intergenic
1175489085 20:59366620-59366642 ATGCTGGATGAAAGTGAGAGAGG - Intergenic
1176370599 21:6059693-6059715 ATGCTGCAGCAGCCTGGGAGAGG - Intergenic
1177095592 21:16827831-16827853 ATACTGCATTAGAATAAAAGTGG + Intergenic
1177418938 21:20830611-20830633 TTGTTGCATCATATTGAGAGAGG + Intergenic
1179752920 21:43478848-43478870 ATGCTGCAGCAGCCTGGGAGAGG + Intergenic
1181911697 22:26243531-26243553 GTGCTGGATCAGAATAAGTGAGG + Intronic
1183330386 22:37217102-37217124 ATGCTACATCAAAATGAGAGAGG - Intergenic
1183542256 22:38436289-38436311 ATGCTGCATCTGAAATTGAGGGG - Intronic
1183945695 22:41324605-41324627 ATGCTCCCTCAGTATGAAAGAGG - Intronic
950139860 3:10607975-10607997 ATGCTGCCTCTTGATGAGAGAGG - Intronic
954955386 3:54514171-54514193 ATTCTGCATCAGAATGCCAATGG + Intronic
955506198 3:59635565-59635587 ATTCAGAATCAGACTGAGAGAGG - Intergenic
956542794 3:70361522-70361544 ATGCTGCAGCGAGATGAGAGTGG - Intergenic
962187022 3:133270910-133270932 AAGCTGCACCAGAGTGAGTGAGG - Intronic
962425490 3:135265720-135265742 TTACTGCATGAGAATGTGAGTGG + Intergenic
964944338 3:162201379-162201401 ATGCTGAATTAGAATGAAAAAGG + Intergenic
967214444 3:187198692-187198714 ATGCTGAGACAGAGTGAGAGAGG - Intronic
968527693 4:1071882-1071904 ATGCTGGATCAGATGGTGAGAGG - Intronic
971568278 4:28173944-28173966 ATGTTTCATAAGAATGAGACTGG + Intergenic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975940741 4:79642516-79642538 CTGCAGCATCAGAATGTGAGAGG + Intergenic
977905037 4:102467606-102467628 GTGCTGCACCAGAATGAGAGGGG - Intergenic
981666635 4:147234455-147234477 ATGGGGCAAGAGAATGAGAGAGG + Intergenic
982190509 4:152850115-152850137 ATGCTGATGCAGAATGACAGGGG - Intronic
983426476 4:167589721-167589743 ATACTGCATCAGCAAGAGAAAGG - Intergenic
986449767 5:7852269-7852291 CAGGTGCCTCAGAATGAGAGAGG - Intronic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987723372 5:21665742-21665764 AGCCTTCATCAGAATGAGATGGG + Intergenic
988785829 5:34564771-34564793 ATACTGTATCAGGCTGAGAGAGG + Intergenic
990687612 5:58324050-58324072 AAACTGCATCTGAATGAAAGAGG + Intergenic
992225837 5:74619115-74619137 ATGCTGTCTCAGAACCAGAGGGG - Intergenic
997846745 5:137293467-137293489 AGCCTGCATCAGAATCACAGAGG + Intronic
998630207 5:143889660-143889682 ATTCTGCCTCAAAATGAAAGAGG + Intergenic
1001363989 5:171118957-171118979 ATGTTGAATAAGAGTGAGAGTGG + Intronic
1001659608 5:173381243-173381265 GTGCTTCATCAGACAGAGAGAGG + Intergenic
1002915571 6:1525502-1525524 ATGCTGGAGCAGAATGGGAAGGG - Intergenic
1003058502 6:2843378-2843400 GTGCTGCACCAGAATGTGGGGGG + Intergenic
1004352916 6:14906419-14906441 CTGCTGCATCAGAATCTCAGGGG - Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1011010218 6:82695219-82695241 ATGCTGCATCATAGGGAAAGGGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015906421 6:138121976-138121998 ATGGTGCGTCAGAACTAGAGTGG + Intergenic
1016267182 6:142246283-142246305 TTTCTGAATCAGAATCAGAGTGG - Intergenic
1017283743 6:152651064-152651086 TTGCTGCAACACAGTGAGAGAGG + Intergenic
1018116679 6:160593085-160593107 AGGCTGGCTAAGAATGAGAGGGG - Intronic
1018130981 6:160732389-160732411 ATGCTGCATGGGTGTGAGAGTGG - Intronic
1018157572 6:161001754-161001776 ATGCGGAAACAGACTGAGAGAGG - Intronic
1018794563 6:167175815-167175837 CTGCTGCCTCAGAAAGAAAGCGG + Intronic
1018821758 6:167379252-167379274 CTGCTGCCTCAGAAAGAAAGCGG - Intronic
1021516750 7:21497595-21497617 ATGATGCTTCAGAAAGAAAGAGG - Intronic
1021922970 7:25505653-25505675 CTGCTGCTGGAGAATGAGAGAGG - Intergenic
1022107486 7:27206948-27206970 TTGCTGCATCAGAATTATGGAGG + Intergenic
1022591216 7:31665081-31665103 ATGTTGCAACATAGTGAGAGAGG - Intergenic
1025249584 7:57343024-57343046 TGGCTGCAGCAGAATGAGTGAGG - Intergenic
1028952276 7:96649945-96649967 ATGATGGATCAGATGGAGAGTGG - Intronic
1030384174 7:108848069-108848091 ATCCTGCATCAGAAGCAGAAGGG - Intergenic
1031038963 7:116818587-116818609 ATGGTGTAACAGAATGAGATAGG + Intronic
1031246107 7:119313789-119313811 AGGCTGAATAAGACTGAGAGTGG - Intergenic
1032817342 7:135490194-135490216 ATGTTTCAACAGAATGATAGTGG - Intronic
1033830572 7:145246701-145246723 ATGCTCCATCTCATTGAGAGGGG + Intergenic
1034071736 7:148192719-148192741 AATTTGCATCAGAATGAGAGAGG + Intronic
1035165038 7:156984213-156984235 ATGCTGCGTGAGAATGGGAGTGG - Intergenic
1035216514 7:157371582-157371604 ATGCTGCCTCTGAATTGGAGGGG + Intronic
1035850990 8:2919167-2919189 ATGCTGCAGGAGAAGGAGAAAGG - Intergenic
1035921825 8:3685461-3685483 ATGCTGCAGCCGAAGGAGATGGG + Intronic
1038362395 8:26893986-26894008 AGGCTGCACCAGAAGGTGAGTGG + Intergenic
1038463161 8:27733847-27733869 CTGCTGCATCTGTCTGAGAGGGG - Exonic
1038936539 8:32258239-32258261 AAGCTATTTCAGAATGAGAGAGG - Intronic
1039039439 8:33393545-33393567 ATGCTCCTGCAGAAGGAGAGGGG - Intronic
1039148290 8:34474768-34474790 ATGCTGGAACAGAATGAGTAAGG + Intergenic
1039470387 8:37809792-37809814 AGGCTGCCTCAGAGAGAGAGGGG + Intronic
1042166621 8:65951776-65951798 ATGCTGCACCGGAAGGAAAGGGG - Intergenic
1042841484 8:73128501-73128523 AAGCAGCATCAGAATTTGAGAGG + Intergenic
1045990687 8:108303423-108303445 ATGCGCCATCAGCAGGAGAGTGG - Intronic
1045995336 8:108355743-108355765 CTGCTGCATAGTAATGAGAGAGG - Intronic
1047181817 8:122595646-122595668 TTGCTGAATCATAATGAGAGGGG - Intergenic
1048982090 8:139708029-139708051 ATGCTGCAGCTGAATGAGTTTGG - Intergenic
1049491142 8:142903562-142903584 ATACTGAATCAAGATGAGAGAGG - Intronic
1049865421 8:144932433-144932455 ATGATGTATCAGAAAGAGACTGG - Exonic
1049914947 9:308456-308478 AAGGTGCACAAGAATGAGAGTGG - Intronic
1050185633 9:2969901-2969923 ATGCTGGAGCAGAGTGAGTGAGG + Intergenic
1050315619 9:4398008-4398030 TCTCTGCATCAGAATGAGAGGGG - Intergenic
1051431744 9:16986406-16986428 ATGCTGCAACACAATACGAGGGG + Intergenic
1052156145 9:25193263-25193285 CTGCTGCATCAGAAAAACAGTGG - Intergenic
1052224917 9:26074155-26074177 ATGTTGAATCAGAGTGAGAGAGG + Intergenic
1053256363 9:36619382-36619404 ATGCTGAATAAGAACAAGAGGGG + Intronic
1053370699 9:37559308-37559330 ATGCTGCATCAAAGTGTGGGTGG - Intronic
1053911038 9:42904296-42904318 ATGCTGCACCAGAATCAGGTTGG + Intergenic
1058476772 9:105342609-105342631 ATGCTGCGTCAGAATTAGAGTGG - Intronic
1059224077 9:112655463-112655485 ATGCTGCATCAAAACAAGGGGGG - Intronic
1060342071 9:122786482-122786504 ATGGTGAAGCAGCATGAGAGAGG + Intergenic
1060368323 9:123043174-123043196 ATGCTTCTCCAGAATGAGGGAGG + Intronic
1186673209 X:11788179-11788201 ATGCTGCATCAGAATTATGGGGG + Intergenic
1188003292 X:25001638-25001660 TTGCAGCATCAGAATGACATAGG + Intergenic
1188544054 X:31283249-31283271 ATCCTGCATAAGAATGTGAATGG + Intronic
1189995442 X:46633010-46633032 ATCCTGCCTCAGAATGAGGAAGG - Intronic
1190522487 X:51294491-51294513 ATGCTCCATCATTATGAGAGAGG + Intergenic
1190525723 X:51327688-51327710 GTGCTGCATCTTTATGAGAGAGG + Intergenic
1190543764 X:51503984-51504006 ATGCTGCATCATTACGAGAGAGG - Intergenic
1191079670 X:56495677-56495699 ATTCTGAAACAGAATGAGATTGG + Intergenic
1191652253 X:63552421-63552443 ATGTTGCAAGAGAATGAGGGAGG - Intergenic
1194937102 X:99964068-99964090 AAGCTGGATCAGGATGACAGTGG - Intergenic
1197165684 X:123374970-123374992 ATGCTGAATAACAATGAAAGTGG + Intronic
1198213632 X:134537181-134537203 ATACTCCCTCAGAATGAGACTGG + Intergenic
1198946442 X:142020418-142020440 ATGCTGTATCAGAATGTGTTTGG + Intergenic
1201226374 Y:11822759-11822781 ATGCTGGAATAGAAGGAGAGAGG - Intergenic
1201226685 Y:11825398-11825420 ATGCTGGAATAGACTGAGAGAGG - Intergenic