ID: 917476214

View in Genome Browser
Species Human (GRCh38)
Location 1:175371552-175371574
Sequence ATGGAAAAGAATAATGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 321}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917476210_917476214 4 Left 917476210 1:175371525-175371547 CCCATAATATGCCTAGCACTAAG 0: 1
1: 0
2: 0
3: 25
4: 190
Right 917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG 0: 1
1: 0
2: 1
3: 37
4: 321
917476211_917476214 3 Left 917476211 1:175371526-175371548 CCATAATATGCCTAGCACTAAGC 0: 1
1: 0
2: 0
3: 10
4: 116
Right 917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG 0: 1
1: 0
2: 1
3: 37
4: 321
917476213_917476214 -7 Left 917476213 1:175371536-175371558 CCTAGCACTAAGCTACATGGAAA 0: 1
1: 0
2: 0
3: 17
4: 158
Right 917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG 0: 1
1: 0
2: 1
3: 37
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917476214 Original CRISPR ATGGAAAAGAATAATGACGA AGG Intronic
901752450 1:11419068-11419090 ATGGAACAGAGTGATGAAGAGGG - Intergenic
901945033 1:12694895-12694917 AAGAAAAAGAATAATGAACAGGG + Intergenic
902814197 1:18906830-18906852 AAGGAAAAAACTCATGACGAAGG + Exonic
906395059 1:45455656-45455678 CTGGAAAAGGATAATGGAGATGG + Intronic
907191676 1:52654342-52654364 CTGAAAAAGAATAATGAAGTTGG + Intronic
907377385 1:54054773-54054795 TTGCAAAAGAATAACAACGAAGG - Intronic
909031857 1:70550625-70550647 ATGGAAAAGAATATTCAAGAAGG + Intergenic
909421781 1:75475305-75475327 AAGGAAAGGAATGATGAGGAAGG + Intronic
909597183 1:77419499-77419521 ATGGAAAAGAAGAAAGAAAAAGG + Intronic
909732180 1:78906522-78906544 ATGGAAAGGAATAAAGGTGAAGG + Intronic
910098988 1:83556520-83556542 GAGGAAAAGAATAAGGACCAGGG - Intergenic
911329793 1:96513722-96513744 AGGGAAGAGAATTCTGACGATGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911651198 1:100390832-100390854 ATAGAAAATAATCATGAAGAAGG - Intronic
913258187 1:116974176-116974198 ATGAAAGAGAATAATGAGGCTGG + Intronic
916281122 1:163052724-163052746 ATGGACTAGAATAATGACAATGG - Intergenic
916870147 1:168904713-168904735 CTGGAACAGAAAAATGATGATGG + Intergenic
917060891 1:171037659-171037681 ACTGAAAAGAATAATGACAGAGG + Intronic
917225844 1:172781535-172781557 AGGAAAAAGAAGAATGAAGAAGG - Intergenic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
918436933 1:184524495-184524517 ATGGAAAAAAATCATGACATTGG + Intronic
918477265 1:184938261-184938283 ATGGAAATGAATAAGAAAGAAGG + Intronic
918966502 1:191356531-191356553 ATGGAAAACAAAAATGAACAGGG - Intergenic
921975312 1:221196447-221196469 CTGGAAAAGAATAATAAAGTAGG - Intergenic
922150187 1:222995185-222995207 ATGGGAAAGAAAAAGGAAGATGG - Intronic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
924319256 1:242830836-242830858 ATAGCATAGAATAATGAGGAAGG + Intergenic
924505637 1:244681016-244681038 ATCAAAAAGAATAATGATAATGG - Intronic
924956178 1:248929664-248929686 GTGGAAAAGACTAATGATGATGG - Intergenic
1062947054 10:1469341-1469363 AGGGAAGAGAATAAAGACGGTGG - Intronic
1063287074 10:4701250-4701272 ATGGCAAAGAATAGAGACTATGG + Intergenic
1063628356 10:7712069-7712091 GTGGAAAAGAATAAAGAAAAAGG - Intronic
1063737928 10:8782323-8782345 AAGGAAAAGAAAAATGAAGGAGG + Intergenic
1064072320 10:12241302-12241324 CAGGAAAAGACTAATGACAAAGG - Intronic
1065067359 10:21983836-21983858 TTAGAAATGAATAATGAAGATGG + Intronic
1065480642 10:26190384-26190406 ATGGAGAAGAATGATGACTGCGG + Intronic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1067550622 10:47232992-47233014 AAGGAAAAGAGTAAAGACAAAGG - Intergenic
1067762047 10:49055766-49055788 ATGGAAAAGAATCATTTCAAAGG - Intronic
1067976486 10:51031527-51031549 ATGGGAAAGAATGAGGAAGAAGG + Intronic
1068033189 10:51728717-51728739 ATGGAATAGAATGATGAGAAAGG + Intronic
1068328602 10:55530273-55530295 ATGGATAAGAATAATAATGATGG - Intronic
1069093949 10:64235727-64235749 ATAGAAAAGAGTGATGAAGAAGG + Intergenic
1069117205 10:64522656-64522678 ATTGAAAAGAATGATGTAGAAGG - Intergenic
1069495055 10:68896396-68896418 ATAGATTAGAATAATGACCATGG + Intergenic
1071034514 10:81227503-81227525 ATAGAAAAAAATAATGATCAGGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071772605 10:88745948-88745970 ATGGAAAAGAAAAAAGACCAGGG + Intronic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074981296 10:118621995-118622017 AGGGAAATGAATATTGACAAAGG - Intergenic
1075350207 10:121717627-121717649 AAGGAAAAGAATAATTATGTTGG + Intergenic
1075965849 10:126610734-126610756 ATAGATAAAAATAATGACTAAGG - Intronic
1077572221 11:3349322-3349344 ATGGAAAATACTAAAGACGCAGG + Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078989358 11:16630905-16630927 ATGGAAAACAATAAAGAATAGGG - Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1082899996 11:58237729-58237751 ATGGAAGAGAACAATGTCCAAGG - Intergenic
1084583985 11:70044544-70044566 ATGGAAATAAATAATGAAGAAGG + Intergenic
1085098478 11:73780030-73780052 AGGGAAAAAAAGAATGACAAAGG - Intergenic
1085862868 11:80255220-80255242 AAGGAAATGAATAATGACTCTGG - Intergenic
1085975226 11:81644902-81644924 ATGGAAAAAAATAAGGAAAAGGG + Intergenic
1086030414 11:82348217-82348239 ATGAAAGAGAATAATGACAATGG - Intergenic
1086866694 11:91988105-91988127 ATGGAACAGAATAATGAACCCGG + Intergenic
1087726678 11:101725989-101726011 AAGGAAGAGAATAAGGAGGAAGG + Intronic
1087859259 11:103133291-103133313 ACGGAAAGGAAGAATGAAGAAGG - Intronic
1088305034 11:108398792-108398814 ATGAAATAAAATGATGACGATGG + Intronic
1090663388 11:128898094-128898116 TTGGAAAAGAATAAAGTGGAAGG - Intronic
1090903526 11:131053435-131053457 ATGGAAAAGAACAATGCCTTGGG - Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1092037089 12:5345567-5345589 ATGGAAAAGAACATTCAGGAAGG - Intergenic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1093073071 12:14727071-14727093 ATGGAAGAAAATAATAAGGATGG - Intergenic
1093480225 12:19596774-19596796 ATTGATAAGAATAATGAAGAGGG + Intronic
1095307523 12:40655618-40655640 ACAGAAAAGAATGCTGACGAAGG - Intergenic
1097652984 12:62325881-62325903 ATAGAACAGAAAAATGAAGATGG + Exonic
1097681765 12:62656011-62656033 ATGGAAAACAAAAAGGAAGAGGG + Intronic
1098246807 12:68528128-68528150 ATGGAAAAGAAATAAGACGTTGG - Intergenic
1099483000 12:83191978-83192000 AAGAAACAGAATAATAACGAAGG - Intergenic
1099974221 12:89529509-89529531 ATGGAAAAGAACAATGGGAAGGG - Intergenic
1100028492 12:90158362-90158384 ATGTAAAAAAAAAATGACTATGG + Intergenic
1101278895 12:103229642-103229664 ATGGAAAATAAAAATGTGGAAGG - Intergenic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105600818 13:21885483-21885505 ATGTGAACGAATAATGAGGATGG - Intergenic
1105620352 13:22060609-22060631 AAGGAAAAGAATAATGACCTAGG + Intergenic
1106897581 13:34321301-34321323 ATGGAGAAGAATCATGATAAAGG + Intergenic
1106976097 13:35217839-35217861 TTTGAAAAGAATAATTATGAAGG - Intronic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1108523817 13:51268283-51268305 ATGGAAAGGAGTAATGAGAACGG + Intronic
1109603942 13:64667326-64667348 CTGGAAAACAATACTGACTATGG - Intergenic
1110284426 13:73732950-73732972 ATAGAAGAGAATAATCATGAGGG - Intronic
1110842258 13:80156436-80156458 AAAGAAAAGAAAAATGAAGATGG + Intergenic
1110927134 13:81167524-81167546 ATGAGAAAGAAGAATGACAAAGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111208651 13:85047311-85047333 ATGGAGAAGAATGATGATGGAGG + Intergenic
1112809716 13:103203676-103203698 AGGGAAAAAAAAAATGATGACGG - Intergenic
1115854806 14:37619771-37619793 ATGGAAAACATAAATGACAAGGG - Intronic
1117379428 14:55145890-55145912 ATGGGCAAGAATGTTGACGATGG - Intergenic
1117780648 14:59228236-59228258 ATGGAAAAAAATAATTACGGTGG + Intronic
1117878562 14:60282731-60282753 ATGGAAAAGCATAATGCCCAGGG + Exonic
1119583018 14:75804656-75804678 ATGGGAAAGAATAATGTATATGG - Intronic
1120551253 14:85875831-85875853 ATGGAAATGATTAATGTCTAGGG + Intergenic
1120613232 14:86668603-86668625 AAGGAAAAGAAAAAGGAAGAGGG - Intergenic
1121141375 14:91545386-91545408 ATGGAAAAGAAAAAGAAAGAAGG - Intergenic
1121189528 14:92013584-92013606 ATGGAATAGAAAAAAGAGGAAGG + Intronic
1121601327 14:95205928-95205950 ATGGAAAACAATAACCAAGATGG + Intronic
1122463872 14:101917408-101917430 AGGGAAAAGAATCATGAGGTTGG + Intronic
1124920632 15:34022889-34022911 ATAGAAAAGAACAATGAGGCCGG + Intronic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1126656437 15:50982689-50982711 ATGTAAAAAAATAATAATGATGG - Intronic
1127423119 15:58827770-58827792 ATCAAAAAGAATAATGATAATGG - Intronic
1130532374 15:84757297-84757319 AAAGAAAAGAATAATGATCAGGG - Intronic
1130661307 15:85833475-85833497 ATAGAAAAGAAAAAGGATGACGG - Intergenic
1130696122 15:86133290-86133312 ATGGAAAAGAAAAATGCTCAGGG - Intergenic
1130789481 15:87137544-87137566 ATGGAAAAGAGTAAAGAGGATGG + Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131910460 15:97194222-97194244 ATGAATAAGAATAATGATGAGGG + Intergenic
1132217312 15:100074183-100074205 TTAGAAAAGAAAAATGACTACGG - Intronic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1134543044 16:15084624-15084646 AAGGAAAAGTATACTCACGATGG + Exonic
1134776453 16:16857891-16857913 ATGAAAAACAATATTGAAGAGGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135030932 16:19038112-19038134 ATGTAAAACAGAAATGACGATGG - Intronic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1140641587 16:76979521-76979543 ATCAACAAAAATAATGACGATGG - Intergenic
1140806479 16:78536724-78536746 ATGGAGGAGAATGATGACGAAGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142923299 17:3210141-3210163 ATGGAAAAGAAAAAAGAAGACGG - Intergenic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1144643737 17:16954389-16954411 AAGGAAAAGAAAAAAGACCAGGG + Intronic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1147285225 17:39397317-39397339 ATGAAAAACAATAATGAACATGG + Intronic
1147399104 17:40168593-40168615 ACTGAAAAGAATAAAGATGATGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1153586577 18:6627198-6627220 ATGGTAAAGAACAATGACCCAGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1155652092 18:28154662-28154684 ATGAAAAAGAATAATGAGAACGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1161779938 19:6285246-6285268 ATCGAAAAGAATAATGGGGAAGG + Intergenic
1161779994 19:6285589-6285611 AAAAAAAAGAATAATGAGGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166763557 19:45239064-45239086 GGGGAAAAAAATAATGACCATGG + Intronic
1167141351 19:47652938-47652960 ATGGAAAAGTAAAATGTAGAAGG - Intronic
1167969341 19:53177219-53177241 AGGGAAAAGAATAATGAAACAGG - Intronic
924969794 2:115370-115392 ATGGAAATGATTTATGACTAGGG + Intergenic
926501644 2:13661539-13661561 ATGGAAAACAATAAAGAGCAAGG - Intergenic
927037644 2:19196095-19196117 ATGGAAATGTATCTTGACGAAGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
933198906 2:79425342-79425364 ATGGACTAAAATAATGATGATGG - Intronic
935367116 2:102306328-102306350 AAGCAAAAGAATGATGAGGAAGG + Intergenic
936372313 2:111912367-111912389 ATAGAAAAGAATAATGTTCATGG - Intronic
940374350 2:152940991-152941013 ATGAAAAAGGATAATGATAAAGG - Intergenic
940436086 2:153656944-153656966 ATGGGAAAGAAAAATTAAGAAGG + Intergenic
940549536 2:155135658-155135680 TTGTTAAAGAATAATGATGAAGG + Intergenic
941530056 2:166657558-166657580 ATAGAAAACAATAATGACAGGGG - Intergenic
941916540 2:170817243-170817265 AGGGATAAGAAGAGTGACGAGGG - Intronic
942430875 2:175910131-175910153 ATGGGAAAGTATAGTGAAGAGGG - Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942886259 2:180927634-180927656 AAGGAAAAGAAAAATGACCTTGG + Intergenic
943015578 2:182506178-182506200 AAAGAAAAGATGAATGACGAAGG - Intronic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
944200641 2:197103933-197103955 ATGAAAAAGATTAATGACATGGG - Intronic
944386321 2:199169051-199169073 TTGTAAAAGAATAATGACAAAGG + Intergenic
945889517 2:215413569-215413591 ATGGAACAGAAAGATGAGGATGG - Intronic
947074931 2:226332273-226332295 ATGGAAAAAAATAAAAACAAAGG + Intergenic
947514590 2:230791072-230791094 ATGGAAAAGAATTATGCACAGGG - Intronic
1169672547 20:8118793-8118815 AATGAAATGAATAATGACAATGG + Intergenic
1170760925 20:19250986-19251008 ATGGAAAAGTATAATGATTTTGG - Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171530998 20:25853703-25853725 ATAGAAAAGAAAAATGACCGCGG + Intronic
1173002192 20:39112297-39112319 AAGGGAAAGAATAATCACCAGGG - Intergenic
1175907386 20:62387506-62387528 ATGGAAAAGAGTAACGTCGGGGG - Intronic
1177641721 21:23852209-23852231 ATGGAATAGGATAATGAATAAGG - Intergenic
1181442816 22:22945702-22945724 ATGGAAAATAATATTAAAGAGGG - Intergenic
1182365407 22:29775570-29775592 ATGGCAAAGAAAAATAACGGTGG - Intergenic
1182409013 22:30166024-30166046 ATGAAAAAGAAGAATAATGAGGG - Intronic
1182411740 22:30192917-30192939 TTGGCAAACAATAATGAAGATGG - Intergenic
1183196404 22:36356698-36356720 ATGCAAAAAAATCATGACAAAGG + Intronic
1184738599 22:46413637-46413659 ATGTAAAAGAAAAATGAAAAAGG - Intronic
951111007 3:18804262-18804284 ATGTAAAAGCCTAATGACAAAGG - Intergenic
951828413 3:26895580-26895602 ATTGACATGAATAATGACAACGG + Intergenic
952061882 3:29521077-29521099 ATGGAAAAAAATAATAAGGCAGG - Intronic
952294981 3:32053676-32053698 ATTAAAAAAAATAATGAGGATGG + Intronic
955073532 3:55591761-55591783 AAGGACAAGAATAATGGGGATGG - Intronic
955861414 3:63334440-63334462 ATGAAAGACAATAATGACAATGG - Intronic
955893068 3:63670781-63670803 ATTGAAAAGAAAAATGACTTTGG + Intronic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956675893 3:71731441-71731463 ACTGAAAAAAATAATGAGGAAGG - Intronic
956829663 3:73033615-73033637 CTGGAAATGAATAATGATGATGG - Intronic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957879008 3:86185778-86185800 ATGGAAAACAAAAAAGAGGAGGG + Intergenic
958641225 3:96808403-96808425 ATGAAAAAAATTAATGATGATGG + Intergenic
958990869 3:100843105-100843127 ATGGAAAAATATAATAACGCAGG + Intronic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
960184603 3:114623494-114623516 ATGCAGAAGAATAAAGAAGAGGG + Intronic
960195861 3:114767493-114767515 ATTGAAAAGAAAAAGGAAGAAGG + Intronic
960729146 3:120705359-120705381 ATGAAAAAGAATAAAGTAGAAGG + Intronic
961580638 3:127878804-127878826 ATGATAAAGAATAATGATAAAGG - Intergenic
963115849 3:141728329-141728351 ATGGGAAAGAATATGGAGGAGGG + Intergenic
963285987 3:143435024-143435046 ATGGAAAAGCTTGATGACGGCGG - Intronic
963773889 3:149418974-149418996 ATGGGAAAGAAGGATGACAAAGG + Intergenic
963849899 3:150200813-150200835 ATGGAAAGGAATAAGGACTGGGG - Intergenic
966703377 3:182881927-182881949 ATAGAAAAGAATAAGGATAAAGG - Intronic
967335414 3:188338621-188338643 ATTGAAAAGAATAATGAAATGGG - Intronic
968374216 4:24517-24539 GTGGAAAAGACTAATGATGATGG + Intergenic
969266459 4:6067083-6067105 ATGGAAAGGAATAAAGAAGGAGG - Intronic
970454931 4:16214111-16214133 ATGGAAAGGAATAATTATTAAGG + Intronic
971733772 4:30419237-30419259 TTGAAAAAGAATAAAGAAGAAGG + Intergenic
971743310 4:30547480-30547502 AAGGAGAAGAATAATTATGAAGG + Intergenic
972523991 4:39890413-39890435 TTTGAAAAGAAAAATGACTAAGG + Intronic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972645020 4:40959506-40959528 ATTTAGAAGAATAATGACGTTGG - Intronic
972675414 4:41255877-41255899 ACCGAAGAGAATAATGATGATGG - Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
973404001 4:49656244-49656266 ATGGAAAGGAATGAACACGAAGG + Intergenic
973625106 4:52763800-52763822 ATTGAAAAGAAAAATGGCCAAGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976921041 4:90443281-90443303 ATGCAGAAGAATAATGATGCTGG - Intronic
976965074 4:91027984-91028006 ATGGAAAAGAAAAAAGAAGAGGG + Intronic
977064530 4:92296841-92296863 ATGGGAAAGAATGAGGACCAGGG - Intergenic
977083351 4:92561744-92561766 ATGTAAGAGAATAATGACATCGG - Intronic
977289444 4:95147934-95147956 TGGGAAAAGAGTAATGACGGAGG - Intronic
978182987 4:105824179-105824201 ATGTAACAGAATGATGACGAGGG + Intronic
978669617 4:111231139-111231161 ATGGAAAAAAAAAATGACTAAGG - Intergenic
980688705 4:136263044-136263066 ATGGAAAACAAAAATGAGTAGGG + Intergenic
981239511 4:142459477-142459499 AGGGAAGAGAATATTGACAATGG + Intronic
981286362 4:143023773-143023795 CTGGAAATGAATAATGGTGATGG + Intergenic
981877374 4:149563691-149563713 ATTGCAAAGAGTAATGACCAAGG - Intergenic
983843279 4:172482748-172482770 GTGGAAAAGATGAATGATGAAGG - Intronic
984126036 4:175812205-175812227 ATGGAAGAGAATATGGAAGAGGG - Exonic
985460514 4:190101746-190101768 GTGGAAAAGACTAATGATGATGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
988474608 5:31572644-31572666 AAGGAAAACAAAAATGAAGAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990433653 5:55765146-55765168 ATGGAAAAGAATAAAAATGATGG - Intronic
990764927 5:59171374-59171396 ATTGAAAAGAAGAAAGACTAGGG - Intronic
991388349 5:66115233-66115255 ATGAAAAAGAATACAGAAGAAGG - Intergenic
992201833 5:74392421-74392443 TTTGAAAAGAATAATAATGAGGG - Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
993547748 5:89233337-89233359 TTGCAAAAGAATAAACACGAAGG - Intergenic
993814966 5:92532040-92532062 ATGAAAAAGAATACTTATGAAGG + Intergenic
994102603 5:95910251-95910273 ATTGAAAAAAATAATAAGGAGGG + Intronic
995041994 5:107599276-107599298 GTTGTAAAGAATAATGAGGAAGG + Intronic
995488508 5:112664159-112664181 ATGAAAAAGAACAAATACGAAGG - Intergenic
995896300 5:117015169-117015191 ATTGAATAGACTAATGAGGAAGG - Intergenic
996452884 5:123646892-123646914 ATGGAAAAAAATAATGAGGGAGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997833702 5:137175132-137175154 ATGGAAATGAGTTATGAAGAGGG + Intronic
999183340 5:149686559-149686581 ACAGAAAAGAATAATGTCTATGG - Intergenic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000459220 5:161492353-161492375 AGGGAATAGAATAATGAGAAGGG - Intronic
1002034141 5:176453185-176453207 ATGGGAAAGAATAAGGACATAGG + Intronic
1002288094 5:178178787-178178809 AAGAAAAAGAAAAAAGACGATGG + Intergenic
1003215650 6:4107713-4107735 CTGGAGAAGGATAGTGACGATGG - Intronic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1004750265 6:18555239-18555261 ATGGAAAGGCAGAATGACAAAGG + Intergenic
1004786281 6:18971408-18971430 ATGAAAAAGAAAAATGAATAGGG - Intergenic
1004947089 6:20627526-20627548 TCGGAAAAGAATAATGTGGAAGG - Intronic
1005252156 6:23959607-23959629 TTGGAATACAATAATGAAGACGG + Intergenic
1005310982 6:24558803-24558825 ATGGAAAACAATAATAATTATGG - Intronic
1005701077 6:28400668-28400690 ATGAAAAAGAAAAATGGTGAGGG + Intergenic
1007208757 6:40174271-40174293 ATGGCAAAGAATAAAGACTTGGG - Intergenic
1008859489 6:56132411-56132433 ATTATAAAGAATAATGAGGAAGG + Intronic
1010088198 6:71946444-71946466 ATGGAACAGAATAAAGAGCATGG + Intronic
1011068627 6:83358079-83358101 GTGGAAAAGAATATTAAGGATGG + Intronic
1011239375 6:85255072-85255094 CTGCAAAAGAATAAAGATGAGGG - Intergenic
1011913633 6:92473497-92473519 ATGGAAATGAATAATGACTTTGG + Intergenic
1012075906 6:94685607-94685629 ATGGAACAGAAAACTGAGGAAGG - Intergenic
1012159054 6:95859939-95859961 CTGGAAATAAATAATGATGAAGG - Intergenic
1012374243 6:98541739-98541761 AGAGAAAAGAAGAATGACGCGGG - Intergenic
1012813639 6:103993415-103993437 TTGAAAAACAATAATGACTAAGG + Intergenic
1013600089 6:111695613-111695635 ATGGAAAAGAAAAATTACACTGG + Intronic
1013819726 6:114139959-114139981 ATTGAAAAGAACAAAGACTAAGG - Intronic
1013859066 6:114611772-114611794 ATGTAAAATTATAATGACTAAGG - Intergenic
1013995960 6:116308483-116308505 ATGTCAAAGTATTATGACGATGG + Intronic
1014004968 6:116407635-116407657 AGGGAAGAGAAAAATGACTATGG - Intronic
1014155899 6:118109399-118109421 ATGGGAAAGAATAAAGGCAAGGG - Intronic
1014608924 6:123516804-123516826 ATGAATAAGAATTATGACTAAGG - Intronic
1015446604 6:133312829-133312851 ATGGAAAAAAAAAATGAGAAGGG - Intronic
1016355947 6:143218450-143218472 TTGGAAAAGAACAGTAACGATGG - Intronic
1017260953 6:152386545-152386567 ATGCCAAAGAATAATCATGAAGG + Intronic
1017475882 6:154792160-154792182 ATAGTAAAGAATAAAGAAGAGGG + Intronic
1017791760 6:157805817-157805839 ATGTAAAAGAATACAGAAGAAGG - Intronic
1019169064 6:170118984-170119006 TTGGAAAAGAATAAAGTTGAAGG - Intergenic
1019580901 7:1762046-1762068 ATAGAAAGGAATAATGAAGAGGG - Intergenic
1022229840 7:28404174-28404196 ATGGAAAAGAAAAAGAACTATGG + Intronic
1026667227 7:72352549-72352571 ATGTCAAAGAATAATCACAAAGG + Intronic
1027275985 7:76556506-76556528 AGTGAAAAGACTAATGAAGAAGG + Intergenic
1027814025 7:82945748-82945770 CTGGAAAAGAGTAATGAATAAGG + Intronic
1030078294 7:105755534-105755556 GTGGAAAAAAATAAAGACCAGGG + Intronic
1030176852 7:106662573-106662595 ATGCATAAGTAGAATGACGAAGG + Intergenic
1030371066 7:108699839-108699861 ATGGAAGAGAGTAATGAAGTTGG - Intergenic
1030955696 7:115849245-115849267 ATGGACAAAATTAATGACTAGGG + Intergenic
1030975433 7:116116203-116116225 ATGGAAAAGAAGAATAAAAATGG + Intronic
1031380959 7:121085412-121085434 ATAGAAAAAAATAATAAAGAAGG - Intronic
1031494562 7:122430884-122430906 ATGGAAGAGAACTATGATGATGG + Intronic
1032347076 7:131126320-131126342 ATAGTAAAGAATAATAAAGAAGG + Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032945496 7:136847414-136847436 GTGGAATAAAATAATGAAGAAGG + Intergenic
1033435439 7:141329382-141329404 ATGGGAAAGAATAATGAGAATGG - Intronic
1033651617 7:143347755-143347777 AAGGAAGAAAATAATGACCACGG + Intronic
1033970375 7:147031988-147032010 ATTGAAAAGAATATTGACTGAGG + Intronic
1033988883 7:147260093-147260115 ATGGAAGAGATCAAGGACGAAGG + Intronic
1034112267 7:148548426-148548448 ATGGAAGAGAACAAGGATGAGGG - Intergenic
1035979822 8:4357765-4357787 AATGAAAAGAATAAGGAGGATGG + Intronic
1036751462 8:11446111-11446133 AGGGAAAAGAATTAAGATGAGGG + Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1038246759 8:25865099-25865121 ATGGATAAGAATAATTGAGAAGG - Intronic
1039261995 8:35781902-35781924 AGGTAAAAGGATAATGATGAGGG + Intronic
1039897220 8:41725123-41725145 CTGGAACAGAATGATGACAATGG - Intronic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1043854098 8:85245340-85245362 ATACAAAACAATAATGACGATGG - Intronic
1045714948 8:105031485-105031507 ATGGAAAATTATAAAGACGAAGG + Intronic
1047035439 8:120933427-120933449 AGGGAAAAGATTAATTCCGAGGG - Intergenic
1047112950 8:121811289-121811311 ATGGAAAAAAAAAATGCTGAAGG - Intergenic
1049015473 8:139917148-139917170 AAAGAAAATAATAATGAAGAAGG - Intronic
1050066063 9:1760545-1760567 ATGTAAAAGCATAATGTCTAGGG + Intergenic
1050908358 9:11034715-11034737 ATTAAAAAGGATAATGATGATGG - Intergenic
1052755911 9:32540532-32540554 ATGTAAAAGAAGTATGACAAGGG + Exonic
1052847359 9:33349038-33349060 ATAGAAAAGAATAAATACCAAGG - Intronic
1055045985 9:71924230-71924252 TTGGAAAAGAATTAGGACTAAGG - Intronic
1055612676 9:78038989-78039011 ATGGAAGAAAATAATGCAGAGGG - Intergenic
1056425473 9:86471262-86471284 ATGGAAAAGAAGACTGGCAACGG + Intergenic
1058724046 9:107785119-107785141 TTGGAAAAAAATGATGACAAGGG + Intergenic
1059170529 9:112120374-112120396 AGGGAAAAGAAAAAAGAAGAGGG + Intronic
1059634269 9:116156009-116156031 ATCCATAATAATAATGACGATGG + Intronic
1059745035 9:117191933-117191955 ATGGAAAAGGATCATGAGGGAGG + Intronic
1059799617 9:117737061-117737083 ATGGAAAAGAGGAATGTCAAGGG - Intergenic
1060933294 9:127502383-127502405 ATGCTAAAGAATAATGAAGGGGG + Intronic
1187092409 X:16110643-16110665 ATGGAAAAAAAAGATCACGATGG + Intergenic
1187510656 X:19914850-19914872 ATAGGAAAGAAACATGACGAGGG + Exonic
1188112771 X:26211733-26211755 CTGGAAAAGAATAATTAAAAGGG - Intergenic
1189720243 X:43908392-43908414 ATGGAACTGATTAATGACTAAGG + Intergenic
1190637146 X:52446480-52446502 ATGGCAAAAAAAAATGAAGAGGG + Intergenic
1190795836 X:53740905-53740927 TTGGAAAAGAATAATAAAGTAGG - Intergenic
1192130374 X:68544028-68544050 AAGGAAACTAATAATGAAGATGG - Intergenic
1192536497 X:71932930-71932952 ATGGAAAAGAAAAAGCACAAGGG - Intergenic
1192742697 X:73908740-73908762 ATGAAAAAGAATAAAGCCGGAGG - Intergenic
1193816535 X:86110964-86110986 ATGGAAAATAATAAGGATAAAGG + Intergenic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196135171 X:112200914-112200936 AGGGAAAGGAATAATGAGGAAGG + Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1197300506 X:124774462-124774484 ATGGGAAGAAATAATGATGATGG + Intronic
1197732827 X:129826614-129826636 CTGGAAAAGAATAATCCAGATGG + Intronic
1198672198 X:139093052-139093074 AGGGAAAAGAATAATAAAGAAGG + Intronic
1199217552 X:145277758-145277780 ATGGAAAAGAAAAACGTCCATGG - Intergenic
1199899360 X:152157957-152157979 TTGGAAAGGAATAAAGATGAGGG + Intergenic
1200631936 Y:5598378-5598400 AATGATAAGAATAATGACGTAGG + Intronic
1201107779 Y:10776245-10776267 ATGGAAAAGCATAGAGAAGAAGG - Intergenic
1201935567 Y:19407366-19407388 GTGGAAAAGAGTAATGATGTAGG + Intergenic
1202358107 Y:24073366-24073388 ATGGAAAGGAATAAAGAAAAGGG + Intergenic
1202512671 Y:25596747-25596769 ATGGAAAGGAATAAAGAAAAGGG - Intergenic