ID: 917477058

View in Genome Browser
Species Human (GRCh38)
Location 1:175377988-175378010
Sequence GTCTCACATTCCCAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917477052_917477058 -2 Left 917477052 1:175377967-175377989 CCCAGGAGTGGTGTTGCCTGGGT 0: 1
1: 0
2: 3
3: 15
4: 211
Right 917477058 1:175377988-175378010 GTCTCACATTCCCAGGGGACAGG 0: 1
1: 0
2: 0
3: 22
4: 231
917477048_917477058 6 Left 917477048 1:175377959-175377981 CCAGAGGCCCCAGGAGTGGTGTT 0: 1
1: 0
2: 1
3: 28
4: 242
Right 917477058 1:175377988-175378010 GTCTCACATTCCCAGGGGACAGG 0: 1
1: 0
2: 0
3: 22
4: 231
917477050_917477058 -1 Left 917477050 1:175377966-175377988 CCCCAGGAGTGGTGTTGCCTGGG 0: 1
1: 0
2: 2
3: 22
4: 255
Right 917477058 1:175377988-175378010 GTCTCACATTCCCAGGGGACAGG 0: 1
1: 0
2: 0
3: 22
4: 231
917477053_917477058 -3 Left 917477053 1:175377968-175377990 CCAGGAGTGGTGTTGCCTGGGTC 0: 1
1: 1
2: 0
3: 21
4: 189
Right 917477058 1:175377988-175378010 GTCTCACATTCCCAGGGGACAGG 0: 1
1: 0
2: 0
3: 22
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917477058 Original CRISPR GTCTCACATTCCCAGGGGAC AGG Intronic
901860379 1:12070540-12070562 GTCTCAAACTCCCAGGGCTCAGG + Intronic
905798634 1:40829574-40829596 GTCTCCCATGCCCAGGGCATGGG - Intronic
910610102 1:89132532-89132554 GTCTGACATTTCCAGATGACTGG + Intronic
914255580 1:145959566-145959588 GTCTCATTTTCCCAGGGGGTGGG - Exonic
917477058 1:175377988-175378010 GTCTCACATTCCCAGGGGACAGG + Intronic
917495842 1:175539444-175539466 GGCTCCCCTTCCCAGGGGAGAGG + Intronic
919919721 1:202160764-202160786 CTCACCCATTCCCAGGGAACGGG - Exonic
920196579 1:204231353-204231375 GCCTCAGTATCCCAGGGGACTGG + Intronic
921636086 1:217495273-217495295 GTCTCACATCCCAAGAGGAAAGG + Intronic
923454767 1:234154266-234154288 AACTCACATTCACAGGGCACAGG + Intronic
924925927 1:248680519-248680541 GTCTGCCATTCTCAGGTGACTGG - Intergenic
1063065586 10:2605511-2605533 GACTCACAGTTCCAGAGGACTGG + Intergenic
1063085536 10:2814673-2814695 GTCTCAGTTTCACAGGGGAAAGG + Intergenic
1063414222 10:5860115-5860137 GGCTCACATGCCCAGGAGGCTGG - Intergenic
1064928960 10:20602613-20602635 GCCTCACATTCCAATGGAACTGG + Intergenic
1066182936 10:32981088-32981110 GTATCGGATTCCCAGGGCACTGG - Intronic
1067720877 10:48726957-48726979 GTGGCCCATTCCTAGGGGACAGG - Intronic
1071478909 10:86048330-86048352 GACTCACAATCCCAAGGGAGTGG - Intronic
1073480458 10:103783357-103783379 GTCTCAGTTGCCCAGGTGACAGG + Intronic
1074266808 10:111912532-111912554 GTCTCACATTTCTGGAGGACAGG - Intergenic
1074469743 10:113716005-113716027 TTCTCAAATTCCCAGGGAAGAGG + Intronic
1074885758 10:117691897-117691919 CTCTCTCAATCCCAGGGGAGTGG - Intergenic
1075673118 10:124277667-124277689 GTCTCACCTTCCCAGAGGAGTGG + Intergenic
1076031213 10:127160369-127160391 TTCTCACATTCCTGGGTGACTGG + Intronic
1077236110 11:1482725-1482747 GTCACTCATTCCCATGGGGCAGG + Intronic
1078361837 11:10675215-10675237 TGCTGACATTCCCAGGGGACTGG - Intronic
1080012010 11:27469568-27469590 CTTTCACCTTCCCTGGGGACAGG - Intronic
1081701516 11:45155525-45155547 GTGTCATTTTCCCAGGGGCCAGG + Intronic
1083184077 11:61007545-61007567 GTCTGACACTTCCAGGGGAGCGG + Exonic
1084170095 11:67396851-67396873 CCCCCACCTTCCCAGGGGACAGG - Intronic
1084876344 11:72136369-72136391 GTTTCACATTCCCAGAGGGCTGG + Intronic
1087922906 11:103887156-103887178 TTCTCACACTCCCAGGAGAGGGG - Intergenic
1088856534 11:113759970-113759992 TTCTCACATTTCTAGGGAACAGG + Intronic
1089132797 11:116225320-116225342 GCCTGAGATCCCCAGGGGACAGG - Intergenic
1090428896 11:126629588-126629610 AGCTCAGATTCCCAGGGCACAGG - Intronic
1093586564 12:20844451-20844473 GTCTCAGCTTCCCAGGTAACTGG - Intronic
1093876263 12:24352986-24353008 TTCTCACATGCCCAGGGGATGGG + Intergenic
1094091946 12:26660399-26660421 ATCTCACACTGCCATGGGACTGG + Intronic
1094821925 12:34232678-34232700 GACTCAGATTCCCAAAGGACTGG - Intergenic
1096841237 12:54380173-54380195 GTCTCTCTTTCCCAGTGGACTGG - Intronic
1102007650 12:109598649-109598671 CTCTCTCATTCCCTGGGGACAGG + Intergenic
1102298985 12:111757700-111757722 GACCCACATGCCCAGGGGTCTGG + Intronic
1102543704 12:113639816-113639838 GTCTCCCATACCTAGAGGACTGG - Intergenic
1104105684 12:125656936-125656958 GTCTCACTTTACCAGTGGGCAGG - Exonic
1104334909 12:127885205-127885227 GTCTCAAATACCCAGTGGACTGG - Intergenic
1104695488 12:130860374-130860396 GCCTCACATTCACAGGCGACAGG + Intergenic
1105276368 13:18931423-18931445 GTGTCAGATTCCCAGGTGATGGG - Intergenic
1108593866 13:51934163-51934185 GTCCCACCCTCCCAGGTGACAGG + Exonic
1109001585 13:56811913-56811935 GACTCCCATTCTTAGGGGACGGG + Intergenic
1109827167 13:67736953-67736975 TTCTGAACTTCCCAGGGGACAGG - Intergenic
1113012754 13:105789098-105789120 ATCTCACATTCCCCAGGAACAGG + Intergenic
1113464107 13:110501956-110501978 GTCTCAGCTTCCCAGGGACCAGG - Intronic
1115551117 14:34505942-34505964 GTATCACATTCCCAAGGTAGGGG + Intergenic
1118681866 14:68250007-68250029 GACTCAAATTTCCAGGGGAGAGG + Intronic
1119010830 14:70986131-70986153 GTAGCACATTCCCAGGGGCATGG + Intronic
1119870275 14:78011199-78011221 GGCTCACATGCCTTGGGGACTGG + Intergenic
1122807515 14:104267527-104267549 GTCTCACAGCCCCCGGGCACTGG + Intergenic
1122846120 14:104500150-104500172 CTCTCAGACTCCCAGGGGCCAGG + Intronic
1122846873 14:104505035-104505057 ATCTCACATTTCCAGAGGCCAGG - Intronic
1123667032 15:22615912-22615934 GACTCACATCCCCAGGTGGCTGG + Intergenic
1124235772 15:27988350-27988372 GTCTCACATTCCCAGGTACTAGG - Intronic
1124320873 15:28710480-28710502 GACTCACATCCCCAGGTGGCTGG + Exonic
1124334678 15:28848182-28848204 GGCTCACGTTCCCAAGGAACCGG - Intergenic
1124521970 15:30412322-30412344 GACTCACATCCCCAGGTGGCTGG + Exonic
1124536694 15:30553896-30553918 GACTCACATCCCCAGGTGGCTGG - Exonic
1124543168 15:30605947-30605969 GACTCACATCCCCAGGTGGCTGG - Exonic
1124563123 15:30793395-30793417 GACTCACATCCCCAGGTGACTGG - Intergenic
1124761958 15:32453696-32453718 GACTCACATCCCCAGGTGGCTGG + Exonic
1124776671 15:32595372-32595394 GACTCACATCCCCAGGTGGCTGG - Exonic
1125477264 15:40055617-40055639 TGCTCACATCCCCTGGGGACAGG + Intergenic
1125609387 15:40960435-40960457 GTCTCTCATCAGCAGGGGACAGG + Intergenic
1126900298 15:53307893-53307915 CTCTGACTTTCCCAGGGGATGGG + Intergenic
1127776542 15:62268321-62268343 GACTCACATCCCCAGGTGAGTGG + Intergenic
1128386791 15:67155238-67155260 GTCACATACACCCAGGGGACTGG + Intronic
1129037030 15:72656616-72656638 GACTCACATCCCCAGGTGAGTGG - Exonic
1129212857 15:74080609-74080631 GACTCACATCCCCAGGTGAGTGG + Exonic
1129397545 15:75260477-75260499 GACTCACATCCCCAGGTGAGTGG - Exonic
1129401155 15:75284754-75284776 GACTCACATCCCCAGGTGAGTGG - Exonic
1129729994 15:77924929-77924951 GACTCACATCCCCAGGTGAGTGG + Intergenic
1129838517 15:78729056-78729078 GACTCACATCCCCAGGTGAGTGG - Intergenic
1129899490 15:79135433-79135455 CTGTCACAATCCCAGGGGCCAGG + Intergenic
1130260054 15:82347503-82347525 GACTCACATCCCCAGGTGAGTGG + Exonic
1130268674 15:82431934-82431956 GACTCACATCCCCAGGTGAGTGG - Exonic
1130281178 15:82521508-82521530 GACTCACATCCCCAGGTGAGTGG - Intergenic
1130409472 15:83632533-83632555 GACTCACATTTCCACAGGACTGG + Intergenic
1130472549 15:84237690-84237712 GACTCACATCCCCAGGTGAGTGG - Exonic
1130480041 15:84352261-84352283 GACTCACATCCCCAGGTGAGTGG - Intergenic
1130484268 15:84389836-84389858 GACTCACATCCCCAGGTGAGTGG - Intergenic
1130491729 15:84435868-84435890 GACTCACATCCCCAGGTGAGTGG + Intergenic
1130503344 15:84514908-84514930 GACTCACATCCCCAGGTGAGTGG + Intergenic
1130594846 15:85242324-85242346 GACTCACATCCCCAGGTGAGTGG - Intergenic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1132212837 15:100037524-100037546 GTCTCAGCTACTCAGGGGACAGG - Intronic
1132433707 15:101779990-101780012 GACTCACATCCCCAGGTGAGTGG + Intergenic
1132574642 16:658814-658836 GGCTCACCGTCCCTGGGGACTGG + Intronic
1133658588 16:7891674-7891696 TTCTTAAATTCCCAGGGGAATGG - Intergenic
1133891188 16:9880577-9880599 GTCACATACTCCCAGGGGAGAGG + Intronic
1134322762 16:13178655-13178677 GTTTCACATTCCCAGGTCCCCGG - Intronic
1136065406 16:27755107-27755129 GGGTCACATTCACAGGGGGCAGG - Intronic
1137696045 16:50462877-50462899 GTCTCAGATTCCCTGGTGCCAGG + Intergenic
1142161217 16:88558637-88558659 GACTCACACCCCCAGGGAACGGG - Intergenic
1142161236 16:88558701-88558723 GACTCACACCCCCAGGGAACGGG - Intergenic
1142161296 16:88558924-88558946 GACTCACACTCCCAGAGAACGGG - Intergenic
1142779686 17:2171835-2171857 GGATCACATCCCCTGGGGACAGG - Intronic
1144133397 17:12269525-12269547 GTCTCACATCCTCAGAGGGCAGG - Intergenic
1144625028 17:16840140-16840162 CGCTCACATTCCCAGGGCAGAGG + Intergenic
1144881402 17:18432581-18432603 CGCTCACATTCCCAGGGCAGAGG - Intergenic
1145150831 17:20511805-20511827 CGCTCACATTCCCAGGGCAGAGG + Intergenic
1145763968 17:27445262-27445284 CTCTCAGATGCCCAGGGCACAGG + Intergenic
1147674620 17:42196212-42196234 GTCTCAGCCTCCCAAGGGACTGG + Intergenic
1151384408 17:73746422-73746444 GGCTCACATTCCCAGGGAGCTGG + Intergenic
1152567818 17:81107997-81108019 GTGTCACCCTCCCAGGGGCCGGG + Intronic
1157692117 18:49692120-49692142 GTCTCACAGTCCTAGAGCACAGG + Intergenic
1158418738 18:57273791-57273813 GGCTCATATTCACTGGGGACTGG + Intergenic
1158426849 18:57348000-57348022 GTCTCACCTCCCCACGGGCCTGG + Intergenic
1158772403 18:60535369-60535391 TTCTCATATTCTCAGGGGACTGG + Intergenic
1160389763 18:78521368-78521390 GTCACACGTTCCCAGGGGCACGG + Intergenic
1160553603 18:79711990-79712012 GTCTCACAGTCTGTGGGGACTGG - Intronic
1164148041 19:22524614-22524636 GACTCACATCCCCAGGTGAGTGG + Intronic
1164279266 19:23754549-23754571 GTCTCACCTTCCCAAGTAACTGG - Intronic
1165510517 19:36264191-36264213 GTCCCACTTTTCTAGGGGACGGG - Intergenic
1166390032 19:42403832-42403854 GTATCACATTTCTAGGGGTCTGG + Intronic
1167742168 19:51330216-51330238 GTCTTCCATTCCCAGGGTCCAGG + Exonic
1168349673 19:55668860-55668882 GTCTCCCCTCCTCAGGGGACGGG + Intronic
925105697 2:1289248-1289270 GACCCACATCCCCAGGTGACTGG + Intronic
925286641 2:2720781-2720803 GTCTCAGATCCCAAGGTGACTGG + Intergenic
929010257 2:37434991-37435013 GTCACACATTCCCTCAGGACAGG - Intergenic
931689462 2:64822955-64822977 ATATCACACCCCCAGGGGACGGG + Intergenic
932292410 2:70593751-70593773 GTCCCACAGCCCCAGGGCACAGG + Intergenic
932594797 2:73087195-73087217 GTCGCACCTTCCCAAGGGCCTGG - Intronic
932989698 2:76771748-76771770 TCCTCACATACCCAAGGGACTGG + Intronic
934474830 2:94587026-94587048 GCCTCACAGTCCCAGAGGAAAGG - Intergenic
935065467 2:99643566-99643588 CTCTCACATGGCCAGGGGACTGG + Intronic
935178898 2:100673232-100673254 TTCTCACACACCAAGGGGACTGG + Intergenic
937921990 2:127137397-127137419 GTCAACCAGTCCCAGGGGACAGG + Intergenic
938034677 2:128026995-128027017 GTCTCACACTCCGAGGTGTCTGG - Intronic
942595842 2:177591274-177591296 GTATCACTTTCCCAGGGAAGGGG + Intergenic
943358481 2:186889514-186889536 GTCTCTAAATCCCAGGGGATGGG + Intergenic
945271014 2:207940059-207940081 GTTTGATGTTCCCAGGGGACAGG + Intronic
946893063 2:224297622-224297644 GTCTCACTTTTCTAGGGGAGGGG + Intergenic
948394400 2:237633571-237633593 GTCTCACACTCACTGGGGACGGG - Intronic
1169407224 20:5331934-5331956 GTCTCAGCCTCCCAGGGTACTGG + Intergenic
1170505084 20:17017291-17017313 GCCTCACATTCACTGGGGACAGG + Intergenic
1171411237 20:24950092-24950114 GTCTCAGTTTCCCAGTGCACAGG - Intronic
1172125243 20:32621684-32621706 AGCTCACATTCTCAGGGGGCAGG + Intergenic
1173674215 20:44820082-44820104 CTTTCTCATTCCCAGGAGACTGG - Intergenic
1174897888 20:54470099-54470121 GTCTCACCTTTCCAGAGGAAAGG + Intergenic
1175454561 20:59102150-59102172 AGCTCACAGTCCCAGGGCACAGG - Intergenic
1176893960 21:14353465-14353487 GTCTCAATTTCCCAGAGGAGAGG + Intergenic
1177462797 21:21434960-21434982 GTCACACATCCCCAAGGGGCAGG - Intronic
1178376457 21:32071610-32071632 GACTCACAGTCCCATGTGACTGG + Intergenic
1179258488 21:39738178-39738200 GACTCACAGTTCCAGGGGGCTGG + Intergenic
1179644631 21:42767863-42767885 TGCTCATCTTCCCAGGGGACAGG - Intronic
1181330667 22:22088152-22088174 GTCTCACTTTCCCATGGGCCTGG - Intergenic
1181342822 22:22196286-22196308 GTCTCACTTCCCCATGGGTCTGG - Intergenic
1181670761 22:24424541-24424563 GCCTCACCTTCCCGGGGAACCGG - Intronic
950646853 3:14382524-14382546 GTCTCAGATTCCCACGCCACTGG + Intergenic
950730353 3:14951171-14951193 GTCTCACCATCACAGGGGATTGG + Intronic
951490871 3:23269523-23269545 TTCTCACCTTCCAATGGGACAGG + Intronic
953717484 3:45328478-45328500 GACTCAAAGTCCCAGGGGCCAGG - Intergenic
954541354 3:51394941-51394963 GCCTCAGGTTCCCAGGGGCCCGG + Exonic
954798464 3:53173416-53173438 GGCTCACATTCCCTGGGGCTGGG + Intronic
955487030 3:59445482-59445504 GTCTCAAATTCTCAGGGTTCTGG + Intergenic
957254389 3:77817941-77817963 GTGTCAGATTCCCAGGTGAAGGG - Intergenic
960142005 3:114159860-114159882 GTCTCTGATACCCAGGTGACAGG - Exonic
961240333 3:125405215-125405237 ATCTCCGATTTCCAGGGGACAGG + Intergenic
962912085 3:139862232-139862254 GTTTCAGATTCCAAGGGGACTGG - Intergenic
968228339 3:196989864-196989886 GTCTCACAGTCCCGGAGGCCGGG - Intronic
968235046 3:197026491-197026513 CTCTCAAATTCCCCAGGGACAGG - Intronic
968921834 4:3526245-3526267 TTCTCACATTCCCCCGGGGCTGG + Intronic
969098882 4:4754174-4754196 GTCTCACATGCTCAGGAGAAGGG + Intergenic
969704297 4:8783681-8783703 GTGTCACATTGCCAGCTGACCGG + Intergenic
971393073 4:26203972-26203994 GTCTCACTCTCCCACGGGGCTGG + Intronic
972371203 4:38424813-38424835 GCCACACAATCCCAGGGAACAGG - Intergenic
976900761 4:90172716-90172738 GTCTCATTTTCCCAGAGGAATGG - Intronic
976901452 4:90181857-90181879 GTCTCACACTCTCAGAGGACTGG - Intronic
977809598 4:101345563-101345585 ATCTCACATTCCTGGGGGTCAGG - Intronic
981093325 4:140755804-140755826 GTCGCCCAGCCCCAGGGGACCGG + Intronic
984196084 4:176659849-176659871 CTCTCACAGTTCCAGAGGACAGG + Intergenic
986146739 5:5084922-5084944 GGCTTACATTTCCAAGGGACTGG - Intergenic
986393531 5:7306193-7306215 GGCTCACGTTCCCAAGGAACTGG - Intergenic
987831891 5:23105354-23105376 CTTTCACATTCCCTGAGGACAGG + Intergenic
990440643 5:55841685-55841707 GTTTCACATTCCCATGTGAGAGG + Intergenic
991483291 5:67106776-67106798 GTCTCACTTTACCAGCAGACAGG + Intronic
996691689 5:126347163-126347185 GCCTCAGATTCCCAGGGTGCTGG + Intergenic
997466028 5:134088715-134088737 GTGGGACATTTCCAGGGGACAGG - Intergenic
999111545 5:149125710-149125732 TGCTCACATTCCTAGGAGACTGG - Intergenic
1001659173 5:173377829-173377851 GTCTCAGATTCCCAGCAGAGAGG - Intergenic
1002045021 5:176536861-176536883 GGCCCCCATTCCCAGGGGAGGGG + Intronic
1002261476 5:177996426-177996448 GGCTCGTATTCCCAGAGGACCGG + Intergenic
1005830958 6:29670810-29670832 GGATCACATTCCCAGAGGAAAGG + Intronic
1006016258 6:31083621-31083643 GTCTCAGGTTCCCAGGGGAAAGG - Intergenic
1006436036 6:34026646-34026668 GTCCCATGTTCCCAGGTGACTGG + Intronic
1006793713 6:36719400-36719422 GCTTCACATCCACAGGGGACAGG - Intronic
1006926658 6:37659232-37659254 GTCTCACAGTTCCTGTGGACAGG - Intronic
1010214892 6:73393015-73393037 GCCTCACATTCCCAAGGTGCTGG + Intronic
1010285602 6:74074236-74074258 GTCTCACGTCCCCTGGAGACAGG + Intergenic
1011737910 6:90331169-90331191 GTCTCTCATTTACAGGGGGCTGG + Intergenic
1011835470 6:91425837-91425859 TTCTATCATTCCCAGGAGACAGG + Intergenic
1014200761 6:118606571-118606593 GTCTCCCCTTTCCAGGGAACAGG - Intronic
1015726128 6:136301387-136301409 CTCTCACATTCCTGGGGGTCAGG - Intergenic
1016304690 6:142671362-142671384 GGCTCACAGTCCCATGTGACTGG - Intergenic
1016347665 6:143131667-143131689 GTCTCACAATGTCAAGGGACTGG + Intronic
1016948030 6:149552023-149552045 GTCTCACCTTCCCTGAGGGCAGG - Intergenic
1018706657 6:166468480-166468502 GTTACACATTCCCAGAGGAGAGG + Intronic
1019181277 6:170188611-170188633 GTCACACTTTCCCAGGAGCCAGG + Intergenic
1022209523 7:28195006-28195028 CACTCACATTCCCAGGGTAGAGG - Intergenic
1023089082 7:36601023-36601045 GCCTGACATACCCAGGGGAAAGG + Intronic
1023638079 7:42232995-42233017 GTCTCTCATTTTCAGGGGCCAGG + Intronic
1025776797 7:64567986-64568008 GTCTTCCATTCCCAGGGTCCAGG - Intergenic
1026358714 7:69583156-69583178 GTCTCATTTTCCCAGAGGATTGG + Intergenic
1026554336 7:71392738-71392760 CTCCCAAATACCCAGGGGACCGG + Intronic
1026966392 7:74442758-74442780 GTCTCAGCTGCTCAGGGGACTGG + Intergenic
1027215177 7:76178990-76179012 GCCTGACATGCCCAGGGGATAGG + Intergenic
1031539296 7:122974387-122974409 AGCTCACATTCCCACAGGACTGG + Intergenic
1031602505 7:123728207-123728229 GTTTAACATTACCTGGGGACTGG + Intronic
1032072260 7:128815469-128815491 GGCTCACAGTCCCAGAGCACCGG + Intronic
1032666650 7:134043625-134043647 GTCACACATTCCTAGGGACCAGG - Intronic
1034273734 7:149815236-149815258 GGCACACACTCCCAGGGGACAGG - Intergenic
1035024270 7:155815905-155815927 GACTCACATCCCCAGGGCCCGGG - Intergenic
1035160193 7:156944508-156944530 CTCACCCATTCCCAGGGGACAGG - Intergenic
1035690997 8:1559772-1559794 TTCACACATTCCCAGGAGAGTGG + Intronic
1038747440 8:30266889-30266911 TTCTCAATTTCCCAGGGGAGAGG + Intergenic
1039613091 8:38934532-38934554 GTCTCAGATTCACAGGGGGATGG + Intronic
1041473147 8:58233648-58233670 TTCTCACATTCCCACTAGACTGG - Intergenic
1049339718 8:142105607-142105629 CTCTCACATTGACAGTGGACGGG + Intergenic
1049999626 9:1063361-1063383 GTCTCACAACCCCATGAGACTGG - Intergenic
1053683234 9:40499075-40499097 GCCTCACAGTCCCAGAGGAAAGG + Intergenic
1053933215 9:43127391-43127413 GCCTCACAGTCCCAGAGGAAAGG + Intergenic
1054280480 9:63125853-63125875 GCCTCACAGTCCCAGAGGAAAGG - Intergenic
1054296339 9:63334573-63334595 GCCTCACAGTCCCAGAGGAAAGG + Intergenic
1054394356 9:64639078-64639100 GCCTCACAGTCCCAGAGGAAAGG + Intergenic
1054429005 9:65144277-65144299 GCCTCACAGTCCCAGAGGAAAGG + Intergenic
1054501379 9:65877258-65877280 GCCTCACAGTCCCAGAGGAAAGG - Intergenic
1056350440 9:85743484-85743506 ATGTCACATTCCCAGGGGGTGGG - Intergenic
1056369369 9:85939235-85939257 GTCTCAGCCTCCCAGAGGACTGG + Intergenic
1057128739 9:92638884-92638906 TTCACACATTCCCAGGGCACAGG + Intronic
1057810437 9:98253178-98253200 CTCTCAAGTTCCAAGGGGACAGG - Intronic
1058635741 9:107036733-107036755 GTCTCTCATTCCCAGGTGTTTGG + Intergenic
1061371568 9:130200581-130200603 ATCTCTCAATCCCTGGGGACGGG - Intronic
1061387073 9:130296636-130296658 GTCTCACATCACCAGAGGATGGG - Intronic
1061506206 9:131033307-131033329 GTCTGCCATCCCCAGGTGACTGG - Intronic
1061804753 9:133131661-133131683 GCCTGACTTTCCCAGGGGACAGG - Intronic
1187484760 X:19693097-19693119 GCCCCACATCCCCATGGGACTGG + Intronic
1188247904 X:27856459-27856481 GTCCAACAGTCCTAGGGGACTGG + Intergenic
1190669100 X:52723363-52723385 GTCTCACACTCCCATGGATCTGG - Intergenic
1190670317 X:52735041-52735063 GTCTCACACTCCCATGGATCTGG + Intergenic
1194911758 X:99653857-99653879 TTCTCACCTTCCCAGGCTACTGG - Intergenic
1197886861 X:131227349-131227371 GTTTGACTTTCCCAGGGGAGGGG - Intergenic
1199967788 X:152834170-152834192 GACTCACCTTCCCTGGGGAGGGG + Intronic
1202366585 Y:24170018-24170040 GACTCACATCCCCAGGTGAGTGG - Intergenic
1202373820 Y:24215455-24215477 GACTCACATCCCCAGGTGAGTGG + Intergenic
1202496961 Y:25454665-25454687 GACTCACATCCCCAGGTGAGTGG - Intergenic
1202504197 Y:25500105-25500127 GACTCACATCCCCAGGTGAGTGG + Intergenic