ID: 917477141

View in Genome Browser
Species Human (GRCh38)
Location 1:175378689-175378711
Sequence ATGGAAAGAAGCAGACTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917477138_917477141 10 Left 917477138 1:175378656-175378678 CCTATATAGCAGGAGGGAAAACG 0: 1
1: 0
2: 1
3: 10
4: 113
Right 917477141 1:175378689-175378711 ATGGAAAGAAGCAGACTTGTGGG 0: 1
1: 0
2: 0
3: 38
4: 300
917477137_917477141 15 Left 917477137 1:175378651-175378673 CCAGTCCTATATAGCAGGAGGGA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 917477141 1:175378689-175378711 ATGGAAAGAAGCAGACTTGTGGG 0: 1
1: 0
2: 0
3: 38
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917477141 Original CRISPR ATGGAAAGAAGCAGACTTGT GGG Intronic
903710394 1:25319279-25319301 ATGTAAAGAAGAAAACTTGTTGG - Intronic
903716711 1:25373133-25373155 ATGTAAAGAAGAAAGCTTGTTGG + Intronic
905181039 1:36166931-36166953 ATGGGGAGAAGCAGGCTTTTGGG + Intronic
905998207 1:42400642-42400664 GAGGAAAGAAGCTGATTTGTGGG + Intronic
906200912 1:43959729-43959751 ATGTAAAGAAGCAGCTCTGTGGG - Intronic
906853335 1:49277640-49277662 ATTGAAAGAAGCATATTTTTTGG - Intronic
906936760 1:50220903-50220925 ATTGAAAGAAATAGAATTGTTGG - Intergenic
907917428 1:58883741-58883763 AAGAAAAGAAGCAAACATGTTGG + Intergenic
909146102 1:71934467-71934489 ATGAAAAGTAGCAGCCTTCTAGG - Intronic
910095594 1:83518108-83518130 CTGGAAAGAAGCAGGCTTTGGGG + Intergenic
912800603 1:112717494-112717516 GTATGAAGAAGCAGACTTGTGGG + Intergenic
913457012 1:119043299-119043321 TTGGAAATAATCAGACTTGAGGG - Intronic
913461804 1:119094792-119094814 ATGCAAAGTAGCAGATATGTAGG - Intronic
913512046 1:119571065-119571087 ATGAAAAGAAACTGACATGTGGG - Intergenic
917287652 1:173438040-173438062 ATGGAAAGATTCAGTTTTGTAGG - Intergenic
917477141 1:175378689-175378711 ATGGAAAGAAGCAGACTTGTGGG + Intronic
918999446 1:191810952-191810974 ACAGAAACATGCAGACTTGTTGG + Intergenic
919111665 1:193227276-193227298 ATGTAAAGCAGCACACTGGTTGG + Intronic
920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG + Intergenic
920736580 1:208538227-208538249 ATGGAAGGGAACAGGCTTGTAGG + Intergenic
921001644 1:211050149-211050171 ATGGAAAGAAACACACATATAGG - Intronic
921654566 1:217719550-217719572 AAGTAAAGAAGGAGAGTTGTTGG + Intronic
924781185 1:247149110-247149132 AATGAAAGAAACAGACTTGAAGG - Intronic
1062928236 10:1334099-1334121 ATGGCAAGACGCAGACTCATGGG + Intronic
1063370325 10:5517165-5517187 ATGTAACCAAGCAGACTTCTTGG - Intergenic
1064903014 10:20314926-20314948 ATGGGTAGAGGCAGCCTTGTGGG - Intergenic
1065003719 10:21360960-21360982 CAGGAAAGAAGCAGATTTCTTGG - Intergenic
1065372899 10:25008065-25008087 ATGAAGAGAAGTAGTCTTGTGGG + Intronic
1066373532 10:34837353-34837375 ATGACAAGAAGCAGACATGTTGG - Intergenic
1067023601 10:42824244-42824266 ATACAAAGTAGCAGACATGTAGG - Intronic
1067404048 10:46004254-46004276 ATGGAATGAAGCAGGATTGTTGG - Intergenic
1071045091 10:81363583-81363605 ATGGAAAGAATCAGAATTTCTGG + Intergenic
1071145504 10:82565572-82565594 ATGGAAACAAGGAGACTGTTAGG - Intronic
1073075900 10:100825849-100825871 AAGGAAAGTAGAAGCCTTGTTGG + Intronic
1074666890 10:115737761-115737783 TTAGAAAGAAGCAGAATTGGGGG - Intronic
1075770324 10:124929129-124929151 CTGGAATGAAGCAAACTTTTGGG + Intergenic
1076551749 10:131283230-131283252 ATGGAAAGAAGTCGACTTCTTGG - Intronic
1080769180 11:35324820-35324842 CTGGAAATAAGCAAATTTGTTGG - Intronic
1080827368 11:35859589-35859611 ATTGAGAGAAGCAGACTTGGAGG + Intergenic
1082083987 11:48033943-48033965 TTGGAAAGAAGAAGCCTTTTAGG - Intronic
1082140782 11:48606041-48606063 TAGGAAAGAAGTAGACTTGGGGG + Intergenic
1085519781 11:77131092-77131114 ATGGGAAGAAGCAGAGGTGCTGG + Intronic
1086527949 11:87751128-87751150 CTTGAAAGAAGTAGAGTTGTAGG + Intergenic
1087434941 11:98102692-98102714 ATGCAAAGAAGCAGATATGTAGG + Intergenic
1088322322 11:108566815-108566837 ATGTAAAGAACAAGACTTGGAGG + Intronic
1089429141 11:118406864-118406886 ACCGAAAGAAGCAGATGTGTGGG - Intronic
1089735015 11:120544725-120544747 ATGGAAAGGAGGTGTCTTGTGGG + Intronic
1090127845 11:124107590-124107612 ATCGAAATAAACACACTTGTTGG - Intergenic
1090979786 11:131709366-131709388 GTGGAAGCAGGCAGACTTGTTGG + Intronic
1091249114 11:134127103-134127125 ATAGGAAGAAGAAGAATTGTAGG + Intronic
1091280995 11:134381570-134381592 AGGGGAAGAGGCAGACTTGGGGG + Intronic
1092919497 12:13218488-13218510 ATGAAAAGAAGAAAACTTGTTGG + Exonic
1095927649 12:47595004-47595026 ATAGAAAGATGGAGAATTGTTGG + Intergenic
1098424725 12:70349055-70349077 ATGAAAACAGGCAGAATTGTTGG + Intronic
1098623339 12:72633255-72633277 ATGAAAAGAAAGAGACTTGCTGG - Intronic
1098990545 12:77060766-77060788 CTGGAAAGAAGGAGAGTTGTTGG - Intronic
1099310486 12:81015164-81015186 ATGCAAAGCAGCAGATATGTAGG - Intronic
1099802715 12:87476908-87476930 AAGGAAAGAAGCAGAGATGGAGG - Intergenic
1099931348 12:89078809-89078831 ATAGAAAGTAGCAGATATGTGGG - Intergenic
1100273336 12:93047264-93047286 ATGGAAAATAGCAGAGTTGGAGG - Intergenic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1105478917 13:20755297-20755319 ATGGCAGGATGCAGTCTTGTGGG + Intronic
1107063896 13:36191385-36191407 ATGGGAAGAAGCAGAGTAGTAGG + Intronic
1108354452 13:49617678-49617700 ATGGAAAGTAGCAGAGCTGGGGG + Intergenic
1109241495 13:59895381-59895403 ATGGAAAATAGCAGACTTGCAGG + Intronic
1109675167 13:65665700-65665722 ATACAAAGAAGCAGATATGTGGG - Intergenic
1109719869 13:66261765-66261787 CTGGAAAGAGACAGACTTGTTGG - Intergenic
1109738200 13:66514939-66514961 ATGGAAATAAGTAGATATGTGGG - Intronic
1109966451 13:69704340-69704362 ATGGATAGAATTAAACTTGTTGG - Intronic
1112326415 13:98445169-98445191 ATGGAATGAGGCAGACTCGGAGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114363452 14:22001589-22001611 ATGGAAAGATGCAGGCTCTTGGG - Intergenic
1114443424 14:22769425-22769447 ATGGAAAGAAGTAGGCTAATTGG - Intronic
1114544896 14:23492258-23492280 ATGCATAGAAGTAGACTTGCTGG + Intronic
1114718457 14:24853866-24853888 ATGGACAGAAGCAGTGTGGTGGG + Intronic
1116610121 14:47058323-47058345 ATGGTCAGTAGCTGACTTGTGGG - Intronic
1119028621 14:71174169-71174191 ATGGAAAGGAGCTGACTACTGGG - Intergenic
1119632375 14:76244222-76244244 ATAGAAAGAACCAGAGTTCTTGG + Intronic
1120056345 14:79928808-79928830 AAGGAAATAATCAGACTTTTGGG - Intergenic
1121242036 14:92438122-92438144 GTCTAAAGAAGCAGTCTTGTGGG - Intronic
1121629991 14:95414949-95414971 ATGCAAACAAACAGACTTGATGG + Intronic
1121709758 14:96028850-96028872 ATGGACAGAAGCTCACCTGTTGG - Intergenic
1122011230 14:98750655-98750677 AGGGACAGAAGAAGAGTTGTTGG - Intergenic
1122024760 14:98867688-98867710 CTGGAAAGAATCAGATTTGCAGG - Intergenic
1122206683 14:100151121-100151143 ATGGGAAGACGCAGGCTGGTGGG - Intronic
1123424745 15:20161286-20161308 ATACAAAGTAGCAGACATGTAGG - Intergenic
1123533969 15:21167817-21167839 ATACAAAGTAGCAGACATGTAGG - Intergenic
1125871530 15:43106330-43106352 ATGAAAGGAAGAAAACTTGTCGG + Intronic
1127217629 15:56840932-56840954 ATGCAAAGTAGCAGATGTGTAGG - Intronic
1127736582 15:61845904-61845926 ATGGAAAGATGCTGCCTTCTTGG + Intergenic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1130123364 15:81071216-81071238 TTGCAAGGAAGCAGGCTTGTAGG - Intronic
1132136586 15:99347125-99347147 ATGGAAAATAGCAGACATATAGG - Intronic
1134862628 16:17574285-17574307 ATGGAAGGAAGAAGAGTTATTGG + Intergenic
1134875104 16:17691172-17691194 AAGGGAAGAAGCAGAGATGTGGG + Intergenic
1135161965 16:20104315-20104337 ATGGAAGGAAGAAGTCTTGCTGG - Intergenic
1135383443 16:22013409-22013431 AGGGAAAGAAGGAGACTTGGGGG + Intronic
1135684663 16:24489148-24489170 ATGCAAAGAAGCAGAAAAGTAGG - Intergenic
1136860113 16:33694458-33694480 ATACAAAGTAGCAGACATGTAGG + Intergenic
1137097672 16:36330698-36330720 ATGAAAAGAAGAAGCCTTCTGGG + Intergenic
1137358335 16:47788458-47788480 ATACAAAGTAGCAGACATGTAGG - Intergenic
1139021259 16:62752937-62752959 ATGGAAAGCAGGAGAATTGACGG - Intergenic
1140201881 16:72901662-72901684 GTTGAAAGAGACAGACTTGTCGG + Intronic
1141186518 16:81791385-81791407 ATATAAACAAGCAGATTTGTGGG + Intronic
1141557519 16:84845852-84845874 ATGGACACCAGCAGACTGGTGGG - Exonic
1203121615 16_KI270728v1_random:1542616-1542638 ATACAAAGTAGCAGACATGTAGG + Intergenic
1143244010 17:5468129-5468151 ATGAAAAGAGGCAGAGTTGTGGG - Intronic
1143912767 17:10265568-10265590 ATGGTTAGAAGCAGAATTGGGGG - Intergenic
1144202689 17:12955605-12955627 AAGGAAAGAAGGAGACTTTCTGG + Intronic
1146090793 17:29875449-29875471 ATGGAAAGAAGGAGGCCAGTAGG - Intronic
1146140158 17:30360231-30360253 ATGGAAAGGAACAGACTTAATGG + Intergenic
1146635278 17:34499503-34499525 AGGGAAAGGAGCAGAATTGGGGG + Intergenic
1146982496 17:37177842-37177864 ATGGAGAGTATCAGACTTGTAGG - Intronic
1148619201 17:49021987-49022009 ATGGAAAGAGGCAGGCGGGTAGG - Intronic
1149379976 17:56083970-56083992 AAGGAAAGAAGCAGTCAGGTGGG + Intergenic
1149997827 17:61414099-61414121 TTGGAGAGATGCAGACTAGTGGG + Intergenic
1151089352 17:71418305-71418327 ATGGAGAGAAGCAGATTAATTGG + Intergenic
1151327039 17:73385920-73385942 GTGGAGAGAAGCAGACAGGTGGG + Intronic
1153115986 18:1656839-1656861 AAGGAGAGCAGCAGACTTGCGGG + Intergenic
1153370879 18:4314610-4314632 ACGGTAAGAACCAGGCTTGTTGG + Intronic
1153811555 18:8756615-8756637 AAGGAGAGAGGCAAACTTGTTGG + Intronic
1154960568 18:21304630-21304652 ATGGGAAGAAGCAGACAGATTGG + Intronic
1155520736 18:26666394-26666416 CTGCAAAGAAGCAGACTGCTTGG - Intergenic
1157276044 18:46311806-46311828 TTGGAAAGGAGGAGCCTTGTGGG + Intergenic
1158227882 18:55219261-55219283 CTGTAAAGAAGTAGACTTGTAGG - Intergenic
1158252118 18:55500414-55500436 ACTTTAAGAAGCAGACTTGTGGG - Intronic
1159576999 18:70191332-70191354 AAGGAAATAAGCAGATTTATAGG + Intronic
1159831372 18:73282181-73282203 ATGGAAACAAACAGATTTTTTGG + Intergenic
1159848845 18:73501575-73501597 ATAAAACAAAGCAGACTTGTAGG - Intergenic
1164585625 19:29473054-29473076 AGGGAAAGAAGGAGAGATGTTGG - Intergenic
1166834294 19:45657875-45657897 ATTGAAAGATTCAAACTTGTAGG - Intergenic
926342070 2:11911784-11911806 AAGGAAATAATCAGACTTTTGGG - Intergenic
926615955 2:14996674-14996696 ATGGGAAGAAGCAGTCTGCTGGG + Intergenic
927281888 2:21316034-21316056 ATGAAAAGAAGTGGAGTTGTGGG + Intergenic
927946931 2:27140581-27140603 ATACATAGAAGCAGACTTGCTGG + Intergenic
930423126 2:51178413-51178435 AAGGAAAGATACAGTCTTGTGGG + Intergenic
930767641 2:55100527-55100549 AAGGGAAGCAGCAGACCTGTGGG + Intronic
931062225 2:58543894-58543916 ATAGAAAGTTGCAGAATTGTAGG + Intergenic
932896121 2:75641811-75641833 GTGGCAAGAAGCAGCCTTGCTGG + Intergenic
933378898 2:81517664-81517686 ATGTAAAGTAGCAGATATGTAGG + Intergenic
933591138 2:84233862-84233884 ATGGGAAGAATCAGAATTCTGGG - Intergenic
934147542 2:89110358-89110380 AAGGAAAGGTGCAGATTTGTAGG + Intergenic
934221728 2:90090233-90090255 AAGGAAAGGTGCAGATTTGTAGG - Intergenic
934232251 2:90194614-90194636 AAGGAAAGAAGCAGATTTATAGG - Intergenic
934458471 2:94195573-94195595 ATACAAAGTAGCAGACATGTAGG + Intergenic
934974343 2:98790031-98790053 ATGGATAGGAATAGACTTGTAGG - Intergenic
937469159 2:122160652-122160674 ATGGAAAGACTCAGCCTTGAGGG + Intergenic
937693836 2:124785937-124785959 ATAGAAAGAAGCAGACAAGCTGG + Intronic
938659617 2:133472177-133472199 ATGGAAACAAGCAGAATTTTAGG - Intronic
938909634 2:135874980-135875002 ATGAAAGGAAGCAGAGTGGTGGG + Intronic
939222413 2:139319348-139319370 AGGGAAAGGATCAGAATTGTTGG - Intergenic
939880796 2:147629297-147629319 ATGGGAAAATGTAGACTTGTGGG - Intergenic
940451800 2:153847101-153847123 ATAGAAAAAAGCAGATTTCTAGG + Intergenic
941037396 2:160583388-160583410 ATGGAAAATAGCAGAAATGTTGG - Intergenic
942169645 2:173277275-173277297 ATGGAAAGCAGCAGCCCTGTGGG - Intergenic
943091167 2:183376546-183376568 ATGGAGAAAAGTAGACTTGGAGG - Intergenic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
944613871 2:201440147-201440169 ATGGATGGGTGCAGACTTGTTGG - Intronic
946134540 2:217635015-217635037 ATGGAAAAAATCAGCCTCGTTGG + Intronic
1169094012 20:2880047-2880069 ATGGCAAGGAGCAGAGTTGAGGG + Intronic
1169680758 20:8210462-8210484 TTGGAAACAACCTGACTTGTAGG + Intronic
1169736006 20:8838306-8838328 AAGGAAATAATCAGACCTGTTGG + Intronic
1169908449 20:10626720-10626742 ATGCAAAGAAGCAAACATTTGGG + Exonic
1170146834 20:13184724-13184746 ATGGCAAAAAGCAGAAGTGTGGG - Intergenic
1170809048 20:19659269-19659291 AGGGAAGGAAGGAGACGTGTTGG - Intronic
1172461693 20:35123777-35123799 ATGGAAAGAAATGAACTTGTGGG + Intronic
1172504767 20:35453555-35453577 ATGCAAAGAAGCAGTGGTGTGGG - Intronic
1172539965 20:35704584-35704606 ATTAAAAGAAACAGACATGTTGG + Intronic
1172931561 20:38589759-38589781 CTGGATAGAAGCACACTTGTGGG - Intergenic
1173114261 20:40225153-40225175 ATGGAAAGAGACAGACTCATAGG + Intergenic
1173714360 20:45189320-45189342 ATAGAAAAAAGCAGACATGGAGG - Intergenic
1175083556 20:56440931-56440953 AAGGAAGGGAGCAAACTTGTAGG - Intronic
1179520695 21:41942560-41942582 AAGGAAAGAAACAGACTCTTGGG + Intronic
1181357732 22:22310861-22310883 ATACAAAGTAGCAGACATGTAGG - Intergenic
1181895153 22:26100672-26100694 ATGGCAAGAAGGGGATTTGTAGG - Intergenic
1181992279 22:26846656-26846678 AAGGGAAGAAGAAAACTTGTTGG + Intergenic
949148623 3:736276-736298 ATAGCAAGAGGCAGACTTGAAGG + Intergenic
952161215 3:30695296-30695318 AGGCAAAGAAGCAGATTTTTAGG + Intergenic
952636929 3:35544326-35544348 ATGGAAAGAAGAAACCTAGTAGG + Intergenic
953132311 3:40151802-40151824 ATAGAAAGAAACAGCCTTTTTGG - Intronic
955500769 3:59580351-59580373 ACACACAGAAGCAGACTTGTTGG - Intergenic
955537356 3:59938434-59938456 ATAGTAAGCAGCAGATTTGTAGG + Intronic
955622369 3:60878078-60878100 TGGGAAAGAAGCAGAGTTTTAGG - Intronic
958960862 3:100508322-100508344 ACGGCAAGATGCAGTCTTGTCGG - Intronic
959234606 3:103703574-103703596 ATGGAAACAAGTATACCTGTAGG + Intergenic
959769577 3:110076563-110076585 ATGGAAAGAAACAGATTAATTGG - Intergenic
960742081 3:120845532-120845554 ATGGGAGGAAGCAGACTAGAGGG + Intergenic
963231606 3:142914130-142914152 ATAGAAAGTAGCAGATATGTAGG - Intergenic
963264412 3:143226726-143226748 ATGAAAGGAATGAGACTTGTAGG + Intergenic
964429238 3:156587358-156587380 ATGAAAATAAGCAGAAGTGTGGG - Intergenic
964652860 3:159030935-159030957 ATGGTAAGCAACAGACTTGAAGG + Intronic
964724387 3:159799289-159799311 GTGAAAAGAAGCAGACTTCAGGG + Intronic
965346337 3:167555552-167555574 AAAGGAAGAAGCAGACTTGTGGG + Intronic
965843316 3:172932269-172932291 TTAGAAAGATGCAGATTTGTTGG + Intronic
966447046 3:180012458-180012480 AAGGAAAGAAACAAACTGGTAGG + Intronic
970038753 4:11771958-11771980 ATGGAAAAAAGGAGATTTGAGGG + Intergenic
970842023 4:20484886-20484908 ATGGAAGAAAGCAGACATTTGGG - Intronic
971155772 4:24081338-24081360 TTGGCAAGAAGCTGACTTGAGGG + Intergenic
971469298 4:27003010-27003032 ATGCAAAGGAGGAGGCTTGTCGG + Exonic
973060656 4:45719477-45719499 AGGGAAAGAAACAAACTGGTAGG + Intergenic
973824643 4:54693010-54693032 ATAGAAAGAAGAGCACTTGTGGG - Intronic
973838288 4:54833837-54833859 ATGGAAAGAAGCATATTTGAAGG + Intergenic
974005809 4:56556111-56556133 ATGGAAAGAAGCAGGCTTTGTGG - Intronic
974936015 4:68410673-68410695 ATGGAAGGAAAAAGACTTGGAGG - Intergenic
975201300 4:71593080-71593102 ATGTATACTAGCAGACTTGTGGG - Intergenic
976579137 4:86714391-86714413 ATGGAAAAAAGAACACATGTGGG - Intronic
977137299 4:93321448-93321470 ATGGAAAGAAGGATATTTTTAGG + Intronic
977740208 4:100470954-100470976 ATGGAAAGAAGGAAATTTATAGG + Intronic
978815534 4:112900663-112900685 ATGGAAAGAGGGAGACTTGAAGG - Intronic
979163065 4:117488628-117488650 AGTGAAGGAAGCAGAGTTGTAGG - Intergenic
979728105 4:123989329-123989351 ATGTAAAGAAACAGACTGATTGG - Intergenic
980484371 4:133436338-133436360 ATGGACAGCAGCAGGTTTGTTGG + Intergenic
980543875 4:134231490-134231512 AAGGAAAGAAGAAGCCTGGTGGG - Intergenic
980969203 4:139553788-139553810 ATGGAAAGAGGTAGATTAGTTGG + Intronic
983521373 4:168712407-168712429 CTGGAGGGAAGCAGGCTTGTGGG + Intronic
983771268 4:171552278-171552300 ATGGAAATAAGCAGATTTGGAGG - Intergenic
984925224 4:184800563-184800585 ATGGATAGAAGCAGATTTTGTGG - Intronic
985077502 4:186231020-186231042 AGGGAGAGAGGCAGTCTTGTTGG + Intronic
986093470 5:4534048-4534070 AGGAAAAGAAGCTGACTTCTGGG + Intergenic
987173944 5:15287626-15287648 AGTGAAAGAAGCAGACTTCAAGG - Intergenic
987548588 5:19347120-19347142 ATGGAGGGAAGGAGACTTCTGGG - Intergenic
987819547 5:22945135-22945157 ATGGAAAGAAAGGTACTTGTTGG + Intergenic
989843898 5:46115359-46115381 TTGGAAAGAAGCAGACTTAAGGG - Intergenic
991460917 5:66857417-66857439 ATGCCAAGAAGCAGAATTGCTGG + Intronic
993181343 5:84557085-84557107 ATGGATAGGATCAGACTTGGAGG - Intergenic
994369534 5:98952348-98952370 ATGGAAAAGAGCAAACTTATTGG + Intergenic
994381119 5:99072798-99072820 ATGTAAAGTAGCAGATATGTAGG - Intergenic
994656271 5:102597002-102597024 AAGGAAACAAACTGACTTGTTGG - Intergenic
994866976 5:105286534-105286556 ATGGAAAGTAGCACACATGAAGG + Intergenic
995640364 5:114249842-114249864 ATGAAGAGAAGAAGACTTGCAGG + Intergenic
996290150 5:121843127-121843149 ATGCAAAGTAGCAGATGTGTAGG + Intergenic
996381623 5:122867656-122867678 GGGGAAAGAGGCTGACTTGTAGG + Intronic
996934262 5:128929887-128929909 ATGCAAAGAAGTAGGTTTGTTGG + Intronic
997834532 5:137181576-137181598 ATGGCAAGCTGCAGACTTCTGGG - Intronic
998451021 5:142234882-142234904 ATGGATAGAAGCAGACCTTGAGG + Intergenic
998711568 5:144831813-144831835 GTTGAAAGGAGCAGACTTGGGGG + Intergenic
998853472 5:146372799-146372821 ATGCAGAGAAGCAGTCTTGGAGG + Intergenic
999387674 5:151166552-151166574 ATGGAAAAAAACAGAATTTTAGG - Intergenic
1000076654 5:157794808-157794830 ACAGAAAGAAGCTGACTTGGGGG + Intronic
1000832852 5:166125773-166125795 ATGGAATGAAGCTGACATGTAGG + Intergenic
1001090655 5:168737813-168737835 ATGGAAGCAAGCAGATTTTTAGG + Intronic
1001820621 5:174707375-174707397 ATCCAAAGAAGCAGTGTTGTTGG + Intergenic
1001852783 5:174984123-174984145 TTGTAAAGAAGCAGCATTGTAGG - Intergenic
1007435439 6:41806961-41806983 ATGGATAGATGCAAACATGTAGG - Exonic
1007489556 6:42208508-42208530 ATGGAAAGAAGGAAACTTGATGG + Intronic
1008612588 6:53197823-53197845 AGGGAAAGAAGCAGAGATGGAGG + Intergenic
1010811342 6:80302885-80302907 ATGGAATGAAGCAGCTTTATTGG + Intronic
1011716409 6:90109663-90109685 CTGGAAAGAAGCAGGTTTGGAGG - Intronic
1012621169 6:101345692-101345714 ATGCATAGAAGCAGAATTGTTGG - Intergenic
1013660995 6:112296858-112296880 CTGAAAAGAAGCAGCCTGGTAGG + Intergenic
1014830127 6:126093093-126093115 ATGGAAAGAGGGAGTCTTTTTGG + Intergenic
1015538413 6:134290348-134290370 AAGAAAAGAAAAAGACTTGTTGG + Intronic
1016657747 6:146541529-146541551 TTGGAAAGTAGTAGACTTGTGGG - Intergenic
1016835232 6:148470334-148470356 AAGCAATGAAGCAGACGTGTGGG - Intronic
1017681770 6:156871631-156871653 ATGGAAAGAAACATTCTGGTTGG + Exonic
1017834686 6:158167072-158167094 TTGGGAAGAAGAAGACTTGGAGG + Intronic
1018946528 6:168350352-168350374 ATGGAGAGATGTAGACATGTAGG - Intergenic
1019173895 6:170150082-170150104 ATGGCAGGCAGCAGGCTTGTGGG - Intergenic
1020875964 7:13693967-13693989 AGTGAAAGAATCAGATTTGTAGG - Intergenic
1022119175 7:27290662-27290684 ATGGTAAGAAGCAGATTTGGTGG + Intergenic
1022497681 7:30863271-30863293 CTGGAGAGAAGCAGAGTGGTGGG + Intronic
1022948607 7:35314387-35314409 ATCCAAAGTAGCAGATTTGTAGG - Intergenic
1024815126 7:53259824-53259846 ATGGAAAATAGAAGACTTCTGGG + Intergenic
1025698410 7:63793702-63793724 ATGGAAAGTTCCAGACTTTTAGG + Intergenic
1027730887 7:81871104-81871126 ACGGAAATAAGCAAACTTATTGG + Intergenic
1028154633 7:87415908-87415930 GTGGAAAGAAGCAGGATTGAGGG + Intronic
1029896882 7:103991972-103991994 ATGGAAAGAAGGGGACTTCCTGG - Intergenic
1030815992 7:114038387-114038409 ATTGAAAGAAGAAGAGTTTTTGG - Intronic
1031470822 7:122167229-122167251 AGGGAAAGGAGAAGACTTATGGG - Intergenic
1031620817 7:123931680-123931702 TTGGAAAAAAGCAGACTAATTGG - Intronic
1032934390 7:136712189-136712211 ATGAATGGAAGCAGACTTCTGGG + Intergenic
1033233183 7:139617916-139617938 ATGAACAGAAGAAGTCTTGTTGG + Intronic
1035234327 7:157486594-157486616 ATGGAGAGAAGCCGTCTTGGCGG + Intergenic
1037283688 8:17272475-17272497 ATGAAAACAAGTAAACTTGTCGG - Intronic
1038286805 8:26212587-26212609 ATGGAAAGAAGTAGATTGATTGG - Intergenic
1041215508 8:55596280-55596302 ATGGACAGAAGCAGCCTTGGAGG + Intergenic
1041518119 8:58725301-58725323 ATGGAAAGAAACAGAATTACAGG + Intergenic
1041935973 8:63332016-63332038 ATTCAAAGAAGCAGTCATGTGGG - Intergenic
1042122011 8:65498533-65498555 AGGGAAAGAAGTAGCCTTGAAGG - Intergenic
1042373443 8:68019260-68019282 ATGGAAACCAGCAGAGTTGCTGG - Intronic
1046564097 8:115876492-115876514 CTTGGAAGAAGCAGAGTTGTTGG - Intergenic
1046740139 8:117819280-117819302 AATAGAAGAAGCAGACTTGTTGG - Intronic
1047048866 8:121086366-121086388 ATGGAATGCAGCAGACAGGTAGG + Intergenic
1047551510 8:125877770-125877792 AAGGAAAGAAGCAGAGAAGTGGG - Intergenic
1049174481 8:141183110-141183132 ATGAAAGCAAGCAGACTTCTAGG + Intronic
1049302283 8:141877966-141877988 CTGGAGAGAAGGAGACTAGTGGG - Intergenic
1049722608 8:144126463-144126485 ATGGAAAGATCCAAACTTTTCGG - Intergenic
1049961819 9:744457-744479 ATGGAAAGAACAAGCCATGTTGG - Intronic
1050335028 9:4582520-4582542 ATGGACAGAAGGATAGTTGTAGG - Intronic
1052498823 9:29262099-29262121 AAGGAAAGAAGAAGAACTGTTGG + Intergenic
1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG + Intergenic
1053688980 9:40571389-40571411 ATACAAAGTAGCAGACATGTAGG + Intergenic
1054275056 9:63059677-63059699 ATACAAAGTAGCAGACATGTAGG - Intergenic
1054300220 9:63372321-63372343 ATACAAAGTAGCAGACATGTAGG + Intergenic
1054399773 9:64705252-64705274 ATACAAAGTAGCAGACATGTAGG + Intergenic
1054433359 9:65189513-65189535 ATACAAAGTAGCAGACATGTAGG + Intergenic
1054497026 9:65832156-65832178 ATACAAAGTAGCAGACATGTAGG - Intergenic
1055262162 9:74449930-74449952 ATGAAAAGAAGCTGACTAATGGG - Intergenic
1056247687 9:84712989-84713011 ACAGAAAGAAGCAGAATTGTTGG + Intronic
1056462002 9:86817565-86817587 TGGGAAAGGAGCAGACTTGGTGG + Intergenic
1056844336 9:90024508-90024530 ATAGAAGGAAGCAGAGTGGTTGG - Intergenic
1057149326 9:92782444-92782466 AGGGAAATAATCAGACTTTTTGG + Intergenic
1057150117 9:92789265-92789287 ATGGAAAGAAGCTGTCAAGTGGG + Intergenic
1057894221 9:98894203-98894225 ATGGGAAAAAGCAGCATTGTCGG - Intergenic
1058089581 9:100789504-100789526 ATAGAAAGAAGAAGATATGTAGG + Intergenic
1058511786 9:105727172-105727194 ATACAAAGAAGCACACATGTAGG - Intronic
1058548375 9:106085910-106085932 ATGGAAAGAAAAAGAATTGGAGG + Intergenic
1058751740 9:108045811-108045833 CTGGAAAGAAGCAATCTTATAGG - Intergenic
1059381745 9:113932487-113932509 ATGGAAATTAGAAGACTGGTTGG + Intronic
1059682694 9:116601709-116601731 TTGGAAAGGAGCAAACTTGTAGG + Intronic
1059740584 9:117145855-117145877 ATGGAAAGAGGCTGACCTTTAGG - Intronic
1186287731 X:8064115-8064137 ATGGAATGAACAAGAATTGTTGG - Intergenic
1186537808 X:10368040-10368062 ATTGCAAGAAGTAGCCTTGTTGG + Intergenic
1186580809 X:10816062-10816084 TAGGAAAGAAGCAGATTGGTGGG - Intronic
1186583152 X:10842715-10842737 ATGGAAAGAGGCAGCCATTTAGG - Intergenic
1187852879 X:23608472-23608494 ATGGAAGATAGCAGACTTGGAGG + Intergenic
1187858694 X:23661129-23661151 CCGGAAAGTAGCAGGCTTGTGGG - Intergenic
1188142959 X:26574927-26574949 TTAGAAAGAAGCAGACTAGTAGG - Intergenic
1188403139 X:29772496-29772518 ATGGGAAGAAGGACACTTATAGG - Intronic
1189000607 X:36940412-36940434 CTGGAAAGAAGTAGAGTGGTGGG - Intergenic
1191972244 X:66829531-66829553 ATGGAAAAAAGGAGACTGGTTGG - Intergenic
1192556130 X:72091114-72091136 CTGGAAAGAAGTGGAATTGTTGG + Intergenic
1192659921 X:73031305-73031327 ATAGCCAGAAGCAGACTTGCTGG + Intergenic
1192761450 X:74098962-74098984 GTGGAAAGAAGTAGACATGGGGG + Intergenic
1193187237 X:78527869-78527891 AAGGAAATAACCAGACTTTTTGG + Intergenic
1193240591 X:79164566-79164588 ATGCAAAGAACCAGTATTGTGGG - Intergenic
1195169649 X:102253863-102253885 ATGCAAAGTAGCAGATATGTAGG - Intergenic
1195189208 X:102433236-102433258 ATGCAAAGTAGCAGATATGTAGG + Intronic
1195266728 X:103188707-103188729 ATGGAACGAAGGAGACAAGTTGG - Intergenic
1195334752 X:103840911-103840933 ATACAAAGTAGCAGACATGTAGG + Intergenic
1195879703 X:109579663-109579685 AAGGAAAGAAGTAGCCTTGTTGG - Intergenic
1195883063 X:109612744-109612766 ATGGAAAGAAGGAGACATAAAGG - Intergenic
1196232679 X:113242193-113242215 ATGGAAAGAAGTAGATGTATTGG + Intergenic
1196789562 X:119451760-119451782 CTGGAAGGAAGCAGACATTTGGG - Intronic
1198074755 X:133183701-133183723 ATGCAACGAAGCAGCTTTGTAGG - Intergenic
1198892123 X:141409210-141409232 ATGGAAAGAGGCATATTGGTTGG - Intergenic
1199168261 X:144703309-144703331 ATGGAAAATAGTAGTCTTGTTGG + Intergenic
1200427119 Y:3033653-3033675 ATGCAAAGAAGACTACTTGTAGG - Intergenic
1200790567 Y:7295761-7295783 AAGGAAAGAAGCAGACAGGAAGG + Intergenic