ID: 917478144

View in Genome Browser
Species Human (GRCh38)
Location 1:175386389-175386411
Sequence CTGGTGAGTCAGAGAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 741
Summary {0: 1, 1: 1, 2: 2, 3: 78, 4: 659}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917478141_917478144 -8 Left 917478141 1:175386374-175386396 CCTCCTTATGGAAGTCTGGTGAG 0: 1
1: 0
2: 1
3: 6
4: 92
Right 917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG 0: 1
1: 1
2: 2
3: 78
4: 659
917478138_917478144 16 Left 917478138 1:175386350-175386372 CCTTGGGTGTCAGCTCTCTCTTT 0: 1
1: 0
2: 2
3: 18
4: 247
Right 917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG 0: 1
1: 1
2: 2
3: 78
4: 659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917478144 Original CRISPR CTGGTGAGTCAGAGAGAGGA TGG Intronic
900226169 1:1534555-1534577 CTGGTGACCCTGAGAGAGGAGGG + Exonic
900251291 1:1671489-1671511 CTGGTGAGTCACAGAGAAGGTGG - Exonic
900334107 1:2152819-2152841 CCGGCCAGGCAGAGAGAGGAAGG - Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
901188481 1:7389781-7389803 GTGGTGAGGCCGAGGGAGGAGGG + Intronic
902038606 1:13475813-13475835 CTGGAGAGTAAGAGGCAGGAGGG + Exonic
902409780 1:16206084-16206106 CTGAGGAGTCAGAGCCAGGATGG + Intronic
902603225 1:17554213-17554235 TGGGTGAGTCACAGTGAGGATGG + Intronic
902941010 1:19800050-19800072 CTGGCGAGTCAGAGCCTGGAAGG - Intergenic
903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG + Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903491562 1:23732569-23732591 CTGCTGAGTCATAGAGACGGGGG + Intergenic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904311647 1:29632970-29632992 CTGGAGAGCCAGGGAGATGAGGG - Intergenic
904367929 1:30028526-30028548 CTGGGGAGTGAAAGAGAGGTTGG - Intergenic
904519866 1:31086537-31086559 CTGGGGAGGCTGAGACAGGAAGG + Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
904794046 1:33045433-33045455 CTCTTGAGGGAGAGAGAGGAAGG + Intronic
905236703 1:36554964-36554986 CTGGTGAGATAGAGAGAGACAGG - Intergenic
905364120 1:37439459-37439481 CTTGGGAGTCAGAGAGATTAGGG - Intergenic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906187264 1:43871482-43871504 CTGGGGTGTGAGGGAGAGGATGG + Intronic
906187331 1:43871708-43871730 CTGGGGTGTGAGGGAGAGGAGGG + Intronic
906187363 1:43871819-43871841 CTGGGGTGTGAGGGAGAGGAGGG + Intronic
906785480 1:48611704-48611726 CAGCTGAGTAAGAGAGAGAAAGG + Intronic
906920982 1:50064137-50064159 CTGGTGTGTCATAGAGTGCAAGG + Intronic
907274329 1:53308912-53308934 ATGGTGAGGCACAGAGAGGTGGG - Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
908131087 1:61076345-61076367 AAGGTGAGTCAGTGAGATGAAGG + Intronic
910726433 1:90344754-90344776 ATGGAGAGTGAGAGAGAAGAAGG - Intergenic
911814309 1:102325453-102325475 CTGATGAGTCAGTAAGGGGAAGG + Intergenic
911974685 1:104477039-104477061 ATGGCAAGTCAGTGAGAGGAGGG + Intergenic
912530273 1:110315752-110315774 CTGGTGAGGCAGAGAGATACTGG + Intergenic
912868499 1:113281203-113281225 ATGGTGAGTGAGGGAGAGAATGG + Intergenic
912974972 1:114321317-114321339 GTGGGGAGGCAGAGAGAGTAGGG + Intergenic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915149579 1:153819717-153819739 CTAGTGAGCCAGAGCGAGGAAGG - Exonic
915481764 1:156191338-156191360 CTGGAGATTGAGGGAGAGGATGG - Intergenic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
916057100 1:161075246-161075268 CTAGAGAGTCAGGGAGAGGTTGG - Intronic
916140301 1:161691593-161691615 CTGGTATATCAGAGACAGGAAGG - Intergenic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
917250996 1:173060551-173060573 GTGGTGTGTCAGAGAGGGGATGG - Intergenic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
919673116 1:200355827-200355849 CTGGTGAGTGAGAGAGAGGAGGG - Intergenic
920221166 1:204402513-204402535 CTGGGGAGGCTGAGACAGGAGGG - Intergenic
920259970 1:204682687-204682709 CTGGTGCTTCAGACAGAGAAGGG - Intronic
920415823 1:205798816-205798838 CTGGTGAGCAAGTGGGAGGAGGG + Intronic
920646594 1:207808185-207808207 AGGGTGAGTGAGAGAGAGGAGGG + Intergenic
920676793 1:208043721-208043743 CTGGTGAGTTTGGCAGAGGAAGG - Intronic
920944128 1:210512296-210512318 CTGGTGTGGCAGTGAGTGGAGGG - Intronic
921555277 1:216591341-216591363 GTGGTGTGCCAGAGAGAGCATGG + Intronic
922542316 1:226428702-226428724 CTGGGGAGGGAGAGAAAGGATGG - Intergenic
923807531 1:237274683-237274705 CTGGTGAGTCAGTGAGTGAGTGG - Intronic
924032459 1:239900153-239900175 CTGTTGAGTCAGGATGAGGAAGG + Intronic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063607955 10:7539554-7539576 GTGGTGAGAAAGAGAGAAGATGG + Intergenic
1064259563 10:13774309-13774331 CTGCTGGGAAAGAGAGAGGAAGG + Intronic
1064366481 10:14713104-14713126 CTGATTAGCCAGAGAGAGGGAGG - Intronic
1064841047 10:19592384-19592406 CTGGTGAGTTGGAGATAAGATGG - Intronic
1065044979 10:21739090-21739112 GTGGGGTGTCAGAGTGAGGATGG - Intronic
1065450853 10:25855465-25855487 CTGATGAGCCAGAGACAGCAGGG + Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066228871 10:33412387-33412409 CAGGAGAGTCACAGAGAGGTTGG + Intergenic
1066430782 10:35349229-35349251 CAGGTGAGTTAGAGAAGGGATGG + Intronic
1068765358 10:60757407-60757429 AGGGTGAGTCGGGGAGAGGAGGG - Intergenic
1069619044 10:69825001-69825023 CAGGTCAGTCAGAGAGAGGCAGG - Intronic
1069776090 10:70928098-70928120 CTGGGGGTTTAGAGAGAGGAGGG + Intergenic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1069890449 10:71649110-71649132 CTGGGGAGACTGGGAGAGGAAGG - Intronic
1070225275 10:74497721-74497743 CTTGGGAGGCAGAGACAGGATGG + Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070277122 10:75017991-75018013 CTCATGAGTCAGAGAGGAGAGGG + Intronic
1070675645 10:78409688-78409710 CTAGGGAGTCAGGGAGTGGAGGG - Intergenic
1071260329 10:83913767-83913789 CTTGAGAGTCAGAGAGATGTGGG - Intergenic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1071588239 10:86846290-86846312 CTGTGGAGTGACAGAGAGGAAGG - Intronic
1071961378 10:90811403-90811425 CAGGTGGATCAGAGAGATGAAGG - Intronic
1072070406 10:91909590-91909612 CTGGAGAGACAGAGAGAGAGAGG - Intergenic
1072201777 10:93166558-93166580 CTGGTGGGTGAGAGGGAGAATGG - Intergenic
1073453676 10:103623827-103623849 CTGGTGGGGCAGGGAGAGGTGGG + Intronic
1073526267 10:104185040-104185062 CTGGTGAATGGGAGAGATGATGG - Exonic
1074199919 10:111225489-111225511 CTGCTGAGACAGACAGAAGAAGG - Intergenic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1075422865 10:122316722-122316744 CTGGTGAGTCAGTGAGTGAATGG + Intronic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1075703854 10:124486815-124486837 CTGGTCAGACTGAGAGAGCAGGG + Intronic
1076120483 10:127933028-127933050 CAGGAGAGCCAGAGAGATGAGGG - Intronic
1076804482 10:132848421-132848443 CTGGTGAGTCGGGGGGAGGGAGG + Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077172508 11:1174244-1174266 CTGTTGGGTCACAGAGATGAAGG + Intronic
1077233658 11:1469704-1469726 CTGGCGAGGCCGGGAGAGGAGGG + Intronic
1077899822 11:6479282-6479304 CTGGTGTATCTGAGAGAGGCTGG - Intronic
1077901987 11:6497234-6497256 CGGGGGAGCCAGAAAGAGGAGGG - Intronic
1079260186 11:18871168-18871190 TTGGTGAGACAGAGAAAGGTGGG + Intergenic
1079911376 11:26314692-26314714 CTGGGGTCTCAAAGAGAGGAAGG - Intronic
1080931141 11:36812567-36812589 CTGATAAGTCAGTGAGATGAGGG - Intergenic
1081525491 11:43924897-43924919 TAGGAAAGTCAGAGAGAGGAGGG + Intergenic
1082216934 11:49582768-49582790 ATGGTGCCTAAGAGAGAGGAAGG - Intergenic
1083169452 11:60914359-60914381 CTGGAGAGTCCGAGTGGGGAGGG + Intronic
1083356321 11:62068988-62069010 ATGGTGAGTCAGAAAGAGAGGGG + Intergenic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1085659155 11:78346953-78346975 GTGGTGAGGCAGAGAAAGGGAGG + Intronic
1085764051 11:79267114-79267136 ATGGTGAGAAAGGGAGAGGAAGG - Intronic
1085777541 11:79380047-79380069 CTGGTGGGGCAGAGAGAAGCAGG + Intronic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1085988238 11:81809902-81809924 GGGATGAGTCAGGGAGAGGAAGG - Intergenic
1086632617 11:89041398-89041420 ATGGTGCCTAAGAGAGAGGAAGG + Intronic
1086816877 11:91382906-91382928 CTGATCAGTCAGGGAGAGGTAGG - Intergenic
1087544053 11:99561219-99561241 CTGGTGTGTCAAAGAGATGTAGG + Intronic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089051372 11:115548898-115548920 ATGGTGAGCCAGAGGAAGGAGGG + Intergenic
1089083038 11:115793478-115793500 TTGGTGAGTCCCAGAGAGCAAGG - Intergenic
1089141601 11:116289128-116289150 GTGGTGTGGCAGAGAGGGGAGGG + Intergenic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090580508 11:128153813-128153835 CTGGAATGTCAAAGAGAGGAGGG + Intergenic
1090744113 11:129693184-129693206 CTGGTGTGTTAGAAAGAGCATGG - Intergenic
1092060802 12:5548864-5548886 CTGTGGAGTGAGAGTGAGGAAGG - Intronic
1092110334 12:5956945-5956967 TTGGTGAGTCAGAGAGTGAGTGG - Intronic
1092205761 12:6613531-6613553 TTGGGGAGTCTGAGAGAGGACGG + Intergenic
1095166447 12:38978909-38978931 CTGTTAAGTCAGAGAAAGAAGGG - Intergenic
1095363511 12:41373533-41373555 CTGGTGAGCCAGGCAGAAGAGGG - Intronic
1096718729 12:53505968-53505990 CTGGAGAGCAAGAGAGAGGAGGG - Intronic
1097081092 12:56431451-56431473 CAGGTGAGTGACAGAGAGGCAGG - Exonic
1097588034 12:61538512-61538534 CTGGTGAGTGAAGGAGAGAAAGG + Intergenic
1098236064 12:68419621-68419643 CTGGAGAGGCTGAGACAGGAGGG + Intergenic
1098670793 12:73228255-73228277 CTAGAAAGTCAGAGAGAAGATGG - Intergenic
1099594454 12:84642117-84642139 GTGGGGAGTAAGAGAGAGCATGG - Intergenic
1100268356 12:93000046-93000068 CTGATGGGCCAGAGACAGGAGGG - Intergenic
1101352319 12:103942913-103942935 CTGGTCAGTCACTGACAGGAAGG + Intronic
1101724270 12:107376145-107376167 GTGGTGAGGGAGGGAGAGGAGGG - Intronic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102005087 12:109584561-109584583 CCAGTGAGTCAGTGATAGGATGG + Intronic
1102063392 12:109952413-109952435 CTGGTGGGTTAGAGAGTGGAGGG - Intronic
1102288827 12:111682388-111682410 CTTGGGAGGCTGAGAGAGGAAGG + Intronic
1102406132 12:112675952-112675974 CTTGTGGGACAGAGAAAGGAAGG + Intronic
1102536275 12:113583695-113583717 CAAGTGAGTCAGTGAGAGGCTGG - Intergenic
1102638169 12:114342704-114342726 CTGGTGAGTCAGGAAGAAAAGGG + Intergenic
1102744937 12:115242269-115242291 CTGGGAAGTCAGAGAGAGGGTGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1103198001 12:119062273-119062295 CTGGTGAGCCAGGGAGAGAATGG + Intronic
1103212959 12:119179677-119179699 CTGGTAAGTCAGGGGCAGGAGGG + Exonic
1103713917 12:122932172-122932194 CTGGTGAGTCACAGGGTGGTGGG - Exonic
1103914430 12:124369192-124369214 CTGAAGAGTAAGAGAGGGGAAGG + Intronic
1103992111 12:124806213-124806235 GTGGGGAGCAAGAGAGAGGAAGG + Intronic
1105046406 12:133007534-133007556 TGGGTGAGTGAGAAAGAGGAAGG + Intronic
1105211708 13:18260986-18261008 TTTGTTAGGCAGAGAGAGGAAGG - Intergenic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1105330559 13:19411815-19411837 CTTGTGAGTCAGGGTGAGGGGGG + Intergenic
1105564288 13:21528896-21528918 GTGGTGAGTCAGAGAGTAGAGGG + Intronic
1105734288 13:23251663-23251685 CTGGGGAGTCTGAGACAGGGAGG + Intronic
1106049196 13:26174867-26174889 CTGGTGAGTGAGTGAGTGTAGGG - Intronic
1106498325 13:30303455-30303477 CTGGGGAGGCTGAGACAGGAAGG + Intronic
1106856922 13:33863894-33863916 ACGCTAAGTCAGAGAGAGGAGGG - Intronic
1107087174 13:36437778-36437800 CTGCTCGGTCAGAGAGGGGATGG + Exonic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108141851 13:47431823-47431845 ATGGTGAGAGAGAGAGAGGGAGG - Intergenic
1108188075 13:47908282-47908304 CTGCTGAGTCAGGCACAGGAGGG - Intergenic
1109290812 13:60473175-60473197 CATGTGAGACAGAGAGAGGCTGG + Intronic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110358138 13:74592936-74592958 TTGGAGAGTAAGGGAGAGGAGGG - Intergenic
1110678013 13:78273362-78273384 CTGGTAGTTCAGAAAGAGGATGG - Intergenic
1113226155 13:108161952-108161974 CTGGTGTGGAAGGGAGAGGAAGG + Intergenic
1113668806 13:112160987-112161009 ATGGAGAGTCAGAGAGCTGAAGG - Intergenic
1114525815 14:23366303-23366325 CTGGGGATTAAGAGAAAGGAGGG + Intergenic
1114980207 14:28154508-28154530 CTGGTGAGAGAGAGAGAGAGAGG + Intergenic
1116216842 14:42027479-42027501 CTGGTGAGTCAGAAACAGAGAGG - Intergenic
1116621404 14:47208660-47208682 CTGCTGAGTCAGCCAGAGAATGG - Intronic
1118327193 14:64789496-64789518 CAAGTGGGTCAGTGAGAGGAAGG + Intronic
1118409412 14:65462299-65462321 ATGGTAAGTCAGAGAGATCAGGG - Intronic
1119325012 14:73754683-73754705 CTGGGGCCTCAGACAGAGGAAGG + Intronic
1119556947 14:75560547-75560569 CTGGCGAGGCAGAGACAGGTGGG - Intergenic
1119886229 14:78145188-78145210 CTGAGGAGTCAGGGAGGGGATGG - Intergenic
1119891367 14:78184986-78185008 CTGAGGAGTGAGAGAGAAGAAGG + Intergenic
1119984222 14:79117636-79117658 ATGGTGAGTGGGAGTGAGGAAGG + Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120648479 14:87101950-87101972 CTGGAGAGTCTGAGTGAGGTGGG - Intergenic
1120959461 14:90111239-90111261 CTGGGGTGTCAGATAGAGGATGG + Intronic
1121234653 14:92383443-92383465 ATCTTGAGGCAGAGAGAGGAAGG - Intronic
1121703883 14:95976648-95976670 GGGATGAGTCAGAGAGAGGTAGG - Intergenic
1121886610 14:97548794-97548816 CTGGAGATTCAGAGAAAGGCAGG + Intergenic
1122444147 14:101757010-101757032 CTAGTGACACAGACAGAGGAGGG + Intergenic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1124836343 15:33199171-33199193 CTGGTGGGTCATGGAGAGGGTGG + Intergenic
1125444143 15:39735522-39735544 CTGGTGAGTCAGTGAGTGAGTGG + Intronic
1125832840 15:42728733-42728755 CTGGTGACACAGGGAGAGGAAGG - Exonic
1126110704 15:45173185-45173207 CTGGTGACTGAAAGAGAGTAAGG - Intronic
1126704850 15:51397447-51397469 CTGGAGAGAGAGAGAGAGAAAGG - Intronic
1127077320 15:55339848-55339870 CTGGTGACTCAGGGTGGGGAAGG + Intronic
1127160519 15:56179743-56179765 GTGTTGAGACAGAGAGAGGAGGG - Intronic
1127166510 15:56249436-56249458 CTGGGGAGAGAGAGAGAGGGAGG + Intronic
1127372690 15:58355751-58355773 ATGTTGAGTCAGAGGGATGATGG - Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1128686681 15:69691525-69691547 CATGTGAACCAGAGAGAGGATGG + Intergenic
1128806189 15:70532859-70532881 CTGGCGAGTCCAGGAGAGGAGGG + Intergenic
1128864474 15:71103808-71103830 CTGAAGAGTCAGAGAGAGAGTGG - Intronic
1129831505 15:78673971-78673993 ATGGTGAGCCAGGGAGAGAATGG + Intronic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131268807 15:90934412-90934434 CTGGAGAATCAGACAGACGAGGG - Intronic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1132250823 15:100334534-100334556 CCGGAGAGTCAGAGGCAGGACGG - Intronic
1133342714 16:5047137-5047159 AGGGGGAGACAGAGAGAGGAAGG - Intronic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1136537671 16:30910111-30910133 CACCTGAGTCAGAGAGAGGAGGG + Intergenic
1136989391 16:35142869-35142891 CTGGTGAGGCAGGGAGGGCATGG - Intergenic
1137490997 16:48932587-48932609 CGGGTGAGTGTGAGAGAGTACGG - Intergenic
1139002327 16:62527724-62527746 CAGGTGAGTCAGTGAGTGAATGG + Intergenic
1139659568 16:68411501-68411523 CTGGTGAGTGAGGGATGGGAGGG + Intronic
1140242604 16:73217139-73217161 CAGATGAGTCAGAGGGAGCAGGG + Intergenic
1140566690 16:76051035-76051057 CTGGTGAGTGGGAGAGAGTGGGG - Intergenic
1141005709 16:80349690-80349712 CTGGTGGGTCAGGGAGTGGAGGG - Intergenic
1142001725 16:87668151-87668173 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
1142534609 17:605642-605664 TTGGTGAGTCAGGGACAGAAAGG + Intronic
1142534645 17:605778-605800 TTGGTGAGTCAGGGACAGAAAGG + Intronic
1142848848 17:2694738-2694760 CCAGGGAGTCAGAGAGAAGAGGG - Intronic
1143090225 17:4445714-4445736 CTGGTGCGGCAGTGAGAGGTAGG - Intronic
1143371767 17:6444816-6444838 CGCCTGAGCCAGAGAGAGGAAGG + Intronic
1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG + Intronic
1143884988 17:10058625-10058647 CTCCTGAGTCTGGGAGAGGATGG - Intronic
1144143199 17:12370265-12370287 CGCGTGTGTCAGAGAGAGAAAGG + Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144655026 17:17029795-17029817 CTGTTGTGTCACAGAGAGGAAGG - Intergenic
1145159870 17:20567212-20567234 CTATTGTGTCACAGAGAGGAAGG + Intergenic
1145209531 17:21003074-21003096 CTGTGGAGGCAGAGAGAGGGAGG + Intronic
1145889055 17:28402237-28402259 CTGGTGAGAGAGACAGAGCAGGG - Exonic
1146057071 17:29586833-29586855 CTGGGGAGTCCAAGAGAGGAAGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147308308 17:39578657-39578679 GTGGGAAGTCGGAGAGAGGAAGG + Intergenic
1148386770 17:47239801-47239823 AGGGTGAGGCAGACAGAGGATGG + Intergenic
1148638215 17:49165434-49165456 GTGGGGAGTGAGAGAGAGGTGGG - Intronic
1148644347 17:49210697-49210719 CTGGGGAGCCAGACAGAGGCTGG + Exonic
1149370133 17:55985770-55985792 ATGGTGAGCCAGGGAGAGGCTGG - Intergenic
1149600242 17:57888823-57888845 CTGGAGGGGCAGAGAGATGATGG - Intronic
1149717601 17:58808541-58808563 TTTGTGAGACAGAGAGAGGGAGG + Intronic
1150227118 17:63530250-63530272 CCGGTGAGGCAGAGTGAGGGTGG + Exonic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151179635 17:72317602-72317624 CTTCTGACTCAGAGTGAGGAGGG + Intergenic
1151459467 17:74245964-74245986 TGGGTGAGGCAGGGAGAGGAGGG + Intronic
1151624452 17:75267901-75267923 CCTGTGAGCCAGGGAGAGGAAGG + Exonic
1151758925 17:76089866-76089888 CTGGTAAGTCCCAGAGAGGAGGG + Intronic
1151959983 17:77400716-77400738 CTGGTGAGGCAGGGAGCGGCTGG + Intronic
1152256535 17:79243276-79243298 CTGGAGTGTCAGAGTGAGCAGGG + Intronic
1152318360 17:79594050-79594072 CTGATGAGTCAGACAGAGGCAGG - Intergenic
1153001853 18:463029-463051 CGGGGGAGTCAGGGAGAGGGTGG + Intronic
1153899982 18:9609691-9609713 CTGGAGAATGATAGAGAGGATGG - Intronic
1154024742 18:10696658-10696680 ATCCTGAGGCAGAGAGAGGAAGG - Intronic
1154262923 18:12853635-12853657 GAGATGGGTCAGAGAGAGGAGGG + Intronic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1154472852 18:14721847-14721869 CTGGTGCAGCAGAGAGAGGGAGG + Intergenic
1155087659 18:22473523-22473545 CTGGTCAGAGAGTGAGAGGAGGG - Intergenic
1155439708 18:25849635-25849657 CTGGTGAGTCAGTGAGTGAGTGG - Intergenic
1156544083 18:37946420-37946442 CTGGTGAGTCAGGGAGTAGAAGG + Intergenic
1156717437 18:40028058-40028080 CTGGTGAGTCATTGAGAAGTTGG + Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157743870 18:50117778-50117800 CTGAGGGGTCTGAGAGAGGAGGG - Intronic
1158201411 18:54945897-54945919 CTTGGAAGCCAGAGAGAGGATGG + Intronic
1158898743 18:61940995-61941017 GTGGTGAGAGAGAGAGAGGAAGG + Intergenic
1159442913 18:68504761-68504783 CTGTTGAGAGAGAGAGAGGAAGG + Intergenic
1160082227 18:75738976-75738998 CTGGTGTGTCAGAGAGGTCAAGG - Intergenic
1160888906 19:1366564-1366586 TGGGTGAGTCAGACAGAGGCTGG + Intronic
1160956257 19:1693405-1693427 CTGGGGAGTCAGAGAGAGACTGG - Intergenic
1161359307 19:3838405-3838427 CCGATGAGCCAAAGAGAGGAAGG + Intronic
1161613095 19:5254582-5254604 TTGGGGAGGCAGAGAGAGCAGGG + Intronic
1161743850 19:6042757-6042779 CTGATGTTTCAGAGAGGGGAGGG - Intronic
1163162719 19:15475164-15475186 AGGGTGAGGGAGAGAGAGGAGGG + Intronic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163622673 19:18370073-18370095 GTGCTGAGTGAGCGAGAGGAGGG + Intergenic
1164441249 19:28282287-28282309 CAGGGGAGTCAGAAAGAAGATGG - Intergenic
1164484929 19:28647203-28647225 CTGGGGAGGCTGAGACAGGAGGG - Intergenic
1164859891 19:31554621-31554643 CTGATGAGTGAAAGAGAGAATGG + Intergenic
1164889865 19:31814199-31814221 AGGGTGAGAGAGAGAGAGGAAGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165824096 19:38695804-38695826 CTGGTGAGGCAGACACAGAAAGG - Intronic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166305476 19:41934862-41934884 CTGCTGGGTCTGAGAGAGGAGGG + Intergenic
1166306610 19:41939519-41939541 CTAGTGGGTCTGAGGGAGGAGGG - Intergenic
1166388645 19:42396693-42396715 CTCCTGGGTCAGAGGGAGGAGGG - Intergenic
1166391036 19:42409054-42409076 CCTGAAAGTCAGAGAGAGGATGG + Intronic
1166449329 19:42884674-42884696 CAGCTGAGGCAGAGAGAGGGAGG + Intronic
1166453744 19:42922909-42922931 CAGGTGAGGCAGAGAGAGGGAGG + Intronic
1166523188 19:43495062-43495084 CTCCTGGGTCTGAGAGAGGAGGG + Intronic
1166523200 19:43495098-43495120 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1166523938 19:43499327-43499349 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1166525401 19:43507246-43507268 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166525546 19:43507636-43507658 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166525630 19:43507863-43507885 CTCCTGGGTCTGAGAGAGGAGGG - Intronic
1166525640 19:43507900-43507922 CTTCTGGGTCTGAGAGAGGAGGG - Intronic
1166531619 19:43546501-43546523 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166531630 19:43546537-43546559 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166532651 19:43552330-43552352 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1166546106 19:43635675-43635697 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166546116 19:43635713-43635735 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166546127 19:43635751-43635773 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166546149 19:43635826-43635848 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166546159 19:43635863-43635885 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166569572 19:43785035-43785057 CTCCTGAGTCTGAGGGAGGAGGG + Intergenic
1166679078 19:44756558-44756580 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1166686725 19:44800755-44800777 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1166688862 19:44811030-44811052 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1167265042 19:48478969-48478991 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167276639 19:48543895-48543917 CTCCTGGGTCTGAGAGAGGAGGG - Intergenic
1167276767 19:48544259-48544281 CTCCTGGGTCTGAGAGAGGAGGG - Intergenic
1167276849 19:48544481-48544503 CTCCTGGGTCTGAGAGAGGAGGG - Intergenic
1167367897 19:49064473-49064495 CTTCTGGGTCTGAGAGAGGAGGG - Intronic
1167367963 19:49064672-49064694 CTCCTGGGTCTGAGAGAGGAGGG - Intronic
1167413801 19:49360270-49360292 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1167426938 19:49434298-49434320 CTCCTGTGTCTGAGAGAGGAGGG - Intronic
1167426970 19:49434407-49434429 CTCCTGGGTCTGAGAGAGGAGGG - Intronic
1167432113 19:49461118-49461140 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1167432238 19:49461478-49461500 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1167435511 19:49476354-49476376 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1167460320 19:49621228-49621250 CTCTTGGGTCAGAGAGAGGAGGG + Intronic
1167464128 19:49641189-49641211 CTCCTGAGTCGGAGGGAGGAGGG + Intergenic
1167489248 19:49782238-49782260 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167489283 19:49782346-49782368 CTCGTGGGTCTGAGGGAGGAGGG + Intronic
1167489298 19:49782384-49782406 CTTGTGGGTCTGAGGGAGGAGGG + Intronic
1167560790 19:50225799-50225821 CTCTTGAGTCTGAGGGAGGAGGG + Intronic
1167560819 19:50225873-50225895 CTCTTGAGTCTGAGGGAGGAGGG + Intronic
1167560903 19:50226096-50226118 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167560931 19:50226170-50226192 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167561015 19:50226393-50226415 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167561044 19:50226467-50226489 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167599234 19:50444435-50444457 CAGGTGAGTGAGTGAGTGGATGG - Intronic
1167644686 19:50699529-50699551 CTGGGGAGGCAAAGAGAGCATGG + Intronic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167668964 19:50838910-50838932 CTCCTGGGTCTGAGAGAGGAGGG + Intergenic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167688103 19:50969000-50969022 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1167690102 19:50980034-50980056 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167738579 19:51311375-51311397 CTCCTGGGTCTGAGAGAGGAGGG + Intergenic
1167752904 19:51391147-51391169 CTACTGAATCTGAGAGAGGAAGG - Intergenic
1167793008 19:51692373-51692395 CTCATGAGTCTGAGGGAGGAAGG + Intergenic
1167959812 19:53096760-53096782 CGGGTGATTGAGGGAGAGGACGG - Intronic
1167963611 19:53126601-53126623 CGGGTGATTGAGGGAGAGGAGGG - Intronic
1168056648 19:53868294-53868316 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168077817 19:53990724-53990746 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168077928 19:53991017-53991039 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168077967 19:53991125-53991147 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168155643 19:54472177-54472199 CTCATGAGTCTGAGGGAGGAGGG - Intronic
1168155698 19:54472326-54472348 CTCATGAGTCTGAGGGAGGAGGG - Intronic
1168155917 19:54472923-54472945 CTCATGAGTCTGAGGGAGGAGGG - Intronic
1168236063 19:55063709-55063731 CTGCTGAGTCTGAGGGAGGAGGG + Intronic
1168238640 19:55078599-55078621 CTCCTGAGTCAGAGGGAAGAGGG + Intronic
1168238696 19:55078747-55078769 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1168246172 19:55114083-55114105 CTCGTGGGTCTGAGGGAGGAGGG - Intronic
1168255295 19:55161554-55161576 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1168263082 19:55207661-55207683 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263118 19:55207770-55207792 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263155 19:55207880-55207902 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263218 19:55208063-55208085 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263272 19:55208209-55208231 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263336 19:55208392-55208414 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263387 19:55208539-55208561 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263441 19:55208685-55208707 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263492 19:55208832-55208854 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168266084 19:55224806-55224828 CTCTTGAGTCTGAGGGAGGAGGG - Intergenic
1168266120 19:55224909-55224931 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168266172 19:55225048-55225070 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168266198 19:55225122-55225144 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168266209 19:55225157-55225179 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168266220 19:55225192-55225214 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168266242 19:55225262-55225284 CTTCTGAGTCTGAGGGAGGAGGG - Intergenic
1168277399 19:55285270-55285292 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168291565 19:55360057-55360079 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1168291577 19:55360093-55360115 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1168291605 19:55360167-55360189 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1168291628 19:55360240-55360262 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1168306349 19:55438152-55438174 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1168446008 19:56414438-56414460 CTGGTGAGTGAGAGAGAAATAGG + Exonic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
925444582 2:3916619-3916641 CGAGTGAGTCACAGAGAGGATGG - Intergenic
925768741 2:7262331-7262353 CTTGTGAGACAGAGACATGATGG - Intergenic
925901489 2:8512322-8512344 TTGGTGAGTCACAGTCAGGAAGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
930379761 2:50613224-50613246 TTAGTGACTCAGAGAGAGGCTGG - Intronic
932090712 2:68803845-68803867 CTGTTGAGACAGAGAAGGGAGGG + Intronic
932296108 2:70624610-70624632 CAGGTGGATCAGAGAGATGAAGG - Intronic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932481050 2:72039567-72039589 CTGCTGTGTTAGACAGAGGAAGG + Intergenic
933073792 2:77896599-77896621 TGGGTGAGTTAGAGAGTGGAAGG - Intergenic
933232941 2:79830066-79830088 CTGGAGACTGAGAGAGACGAGGG + Intronic
933841790 2:86292830-86292852 CTGCTGTGTGAGAGCGAGGAGGG - Intronic
934301917 2:91781469-91781491 TTCGTTAGGCAGAGAGAGGAAGG + Intergenic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934474293 2:94582969-94582991 TTGGTGAGACAGAGAAAGGTCGG + Intergenic
934474603 2:94586121-94586143 GGGGTGAGGCAGGGAGAGGAAGG - Intergenic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
934707996 2:96498101-96498123 GAGGTGCGGCAGAGAGAGGAAGG - Exonic
934729410 2:96647153-96647175 AAGGTGAGGCAGAGAGAGGCAGG + Intergenic
934796930 2:97109274-97109296 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
934836483 2:97594157-97594179 CTGGTGACTCAAAGAGAGAAAGG + Intergenic
935147439 2:100405465-100405487 AAGGTGGGGCAGAGAGAGGATGG + Intronic
935224940 2:101045336-101045358 ATGGGGAGACAGAGAGAGAAAGG - Intronic
935397343 2:102621846-102621868 CTGGTCAGTTAGAGAGAAAAGGG + Intronic
935902871 2:107811274-107811296 CTGGGGAGGGAGAGAGAGGCAGG - Intergenic
936259502 2:110946920-110946942 TTGGTGAGTCAAGGAGAGGCTGG + Intronic
936288855 2:111202405-111202427 CTGGTGAGTCAGTGAGTGAGTGG + Intergenic
936502296 2:113075607-113075629 AGGGAGAGTCAGAGAGAGAATGG + Exonic
936545321 2:113387303-113387325 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
937206621 2:120240797-120240819 CTGCTGAGTCAGTGTGAGGTTGG + Intronic
937870569 2:126783106-126783128 CTGGGGAGGCAAAGAGGGGAAGG + Intergenic
939223854 2:139339856-139339878 GAGGTGAGAGAGAGAGAGGAGGG + Intergenic
939279867 2:140049472-140049494 CGGGTGAGTCAGTGAGTGAAGGG - Intergenic
939936381 2:148298389-148298411 CTGGTGAGTGGGAGTGAGGAAGG + Intronic
941023533 2:160436132-160436154 CTGGTGAGTACCAGAAAGGAAGG - Intronic
941883218 2:170502542-170502564 CTGAAGAGCCAGAGAGGGGACGG - Intronic
942135486 2:172920874-172920896 CAGGTCTGTCAGAAAGAGGAAGG - Intronic
942181266 2:173383351-173383373 AGGGTGAGTATGAGAGAGGAAGG + Intergenic
942276981 2:174330263-174330285 CTGGTGTGTCAAAGGAAGGAAGG - Intergenic
943450368 2:188036926-188036948 CTGATGAGTCAGGGAGAGTTAGG - Intergenic
943506508 2:188767091-188767113 CTGATGAGTAAGAGAGAAAAGGG - Intronic
943960143 2:194254061-194254083 CTTTTGAGTCTGTGAGAGGAGGG - Intergenic
944717891 2:202393272-202393294 TTGGGGAGTCTGGGAGAGGAAGG + Intronic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946179629 2:217941775-217941797 CTGGTGGGTCAGCAGGAGGATGG - Intronic
946555131 2:220847920-220847942 CTGGTGAGTCATAAAGTTGATGG - Intergenic
946613174 2:221481059-221481081 CTGGAGAGTTAGAGAGGAGAAGG - Intronic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
947174419 2:227348752-227348774 CTGTTGAGAAATAGAGAGGAAGG + Intronic
947821471 2:233074235-233074257 GTGGTGAGACACACAGAGGATGG + Intronic
948184295 2:236007786-236007808 CTGGTGATGCCGAGAGGGGAAGG - Intronic
1168795583 20:608590-608612 CTGATGAGCCAGACAGAGGGTGG + Intronic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1169674266 20:8135866-8135888 CTGGTGAGGTAGACAGTGGAAGG + Intronic
1169681606 20:8220531-8220553 ATGGGGAGTCACAGAGAAGAAGG + Intronic
1170032685 20:11959282-11959304 CTGGTGAGAGAGGGAGAGGAGGG + Intergenic
1170403762 20:16014657-16014679 CTGGGGAGCCAGGGACAGGAAGG - Intronic
1171823620 20:29876214-29876236 CTGGAGTGTCAGCGAGAGGGTGG + Intergenic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171896469 20:30814131-30814153 CTGGAGTGTCAGCGAGAGGGTGG - Intergenic
1171985961 20:31661600-31661622 CTGGTGAGTAGGGTAGAGGATGG + Intergenic
1172697470 20:36832447-36832469 CTGGGGAATCATGGAGAGGATGG - Intronic
1173167528 20:40696111-40696133 CTGCTAACTCAGGGAGAGGAGGG - Intergenic
1173209320 20:41019868-41019890 CTGGTGGGTGAGACAGAGAAGGG - Intergenic
1173853036 20:46230984-46231006 TAGGTGAGACAGAGAGAGGGAGG + Intronic
1174582464 20:51581724-51581746 CTGTGGAGTCAGAGAGAGGGAGG - Intergenic
1174617403 20:51846518-51846540 TTGGTAGGTCAAAGAGAGGAGGG - Intergenic
1175901362 20:62361145-62361167 CTGCTGTGCCAGAGAGATGAGGG + Intronic
1175956928 20:62616115-62616137 GTGGTGGGTAAGAGTGAGGAGGG + Intergenic
1176047226 20:63099247-63099269 CAGGTGGGTCTGAGGGAGGAAGG - Intergenic
1176517854 21:7799678-7799700 CATGTGAGGAAGAGAGAGGAAGG + Intergenic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1176801633 21:13436002-13436024 CTGGTGCAGCAGAGAGAGGGAGG - Intergenic
1177536213 21:22431557-22431579 CTGGGGAGAGAGAGAGATGAGGG - Intergenic
1178478545 21:32958690-32958712 ATGGTCAGACAGAGAGAGAAAGG + Intergenic
1178602807 21:34009538-34009560 CTGGTGAGGTAGAGAGAGAAGGG + Intergenic
1178651882 21:34429691-34429713 CATGTGAGGAAGAGAGAGGAAGG + Intergenic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1180624231 22:17183402-17183424 CTGTGGGGTCAGAGAGACGAAGG - Intronic
1180814513 22:18781250-18781272 TTCGTTAGGCAGAGAGAGGAAGG - Intergenic
1180949107 22:19713358-19713380 CTGGTGATTCAGAGATGGAAAGG + Intergenic
1180991421 22:19939442-19939464 CTGGTGAGACAGAAAGTGTAAGG - Intronic
1181200701 22:21215586-21215608 TTCGTTAGGCAGAGAGAGGAAGG - Intronic
1181682279 22:24503736-24503758 ATGAAGAGTCAGAGAGAGTATGG - Intronic
1181701040 22:24621387-24621409 TTTGTTAGGCAGAGAGAGGAAGG + Intronic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1184200258 22:42963739-42963761 CGGGTGTGGTAGAGAGAGGAGGG - Intronic
1184539076 22:45107804-45107826 CTGGTGAGTGAGGGAGAGAGGGG - Intergenic
1184644176 22:45887171-45887193 CTGGAGAGTCAGGGAGATGGAGG + Intergenic
1184877205 22:47283325-47283347 AGGGTGAGTCAGACAGAGGTGGG - Intergenic
1185056422 22:48580971-48580993 CTGGAGGGTCAGGGAGAGGCAGG - Intronic
1185369483 22:50454451-50454473 CTGGTGTCTGAGCGAGAGGAGGG + Intronic
1185417194 22:50716681-50716703 GTGGTGAGGCACAGAGGGGAAGG - Intergenic
1203226216 22_KI270731v1_random:79849-79871 TTCGTTAGGCAGAGAGAGGAAGG + Intergenic
1203264612 22_KI270734v1_random:6937-6959 TTCGTTAGGCAGAGAGAGGAAGG - Intergenic
949328835 3:2898524-2898546 CAGGTGAGGCAGAGAAGGGAGGG - Intronic
949876545 3:8629622-8629644 CTGGTGAGTCAGTGAGGGTGTGG - Intronic
950257535 3:11518064-11518086 ATGGTGAGTGGGAGAGAGGAAGG + Intronic
950280703 3:11705363-11705385 CTTGGCAGGCAGAGAGAGGAGGG + Intronic
950496733 3:13338288-13338310 CTGCTCAGTCAGAGACAGGCAGG - Intronic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
952078750 3:29731382-29731404 ATGGTGATTCAGTTAGAGGAAGG - Intronic
952590255 3:34944314-34944336 CAGATGGGACAGAGAGAGGAAGG - Intergenic
952735010 3:36680777-36680799 CTGGTGAATCTGTGAGAAGAGGG - Intergenic
953236859 3:41114452-41114474 AGGGAGAGTCAGAGAGAGGGAGG + Intergenic
953712954 3:45290464-45290486 CTGGGTAGTGAGAGTGAGGAAGG + Intergenic
954003267 3:47574155-47574177 CTTGTGAGGCAGTGAGAGGCTGG + Intronic
954412067 3:50375101-50375123 CTTGTGGGTCAGAGGGAGGTTGG - Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955075777 3:55611689-55611711 CTGGTGATGGAGAGAAAGGAGGG - Intronic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG + Intronic
955222436 3:57034332-57034354 ATGGTGAGTCAAAGAGAAGACGG + Intronic
955871042 3:63438723-63438745 GTGCTCAGTCAGAGAAAGGAAGG + Intronic
957254009 3:77813405-77813427 GTAGTGAGTCAGGGAGTGGACGG - Intergenic
957512636 3:81209144-81209166 CTTGAGAGTAAGAGAGAGGTGGG - Intergenic
958123115 3:89319215-89319237 ATTGAGAGTAAGAGAGAGGAGGG + Intronic
959417434 3:106092982-106093004 TGGGTGAGTCAGAGAGTGGGTGG + Intergenic
960086832 3:113600379-113600401 CTGGTCACTCTGAGAGTGGATGG - Intronic
960436110 3:117628798-117628820 GTGGTGAGAGAGAGAGAAGAAGG - Intergenic
961349488 3:126290539-126290561 CTTGTGAGACAGAGGAAGGAAGG - Intergenic
961516934 3:127443867-127443889 CTGGGGAGTCAGACAGAGGCAGG + Intergenic
961793410 3:129392700-129392722 CTGGTGACTCAGAGAGGGCATGG + Intergenic
961807407 3:129499318-129499340 CTGGTGACTCAGAGAGGGCATGG + Intronic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
962423540 3:135249313-135249335 CTGGTGAGACAGAGATGGGCAGG - Intronic
962809895 3:138950757-138950779 CTGGTGAGTGTGAGAGAAGTAGG - Exonic
963933751 3:151031557-151031579 GTGGTAAGTCAGAAAGAAGAAGG + Intergenic
964256988 3:154786618-154786640 CAGGTGAATGGGAGAGAGGAAGG + Intergenic
964272581 3:154973987-154974009 CTGGTGTCTCAGAGATATGAGGG + Intergenic
965082222 3:164048976-164048998 TGGGTGAGTCAGTGAGAGGTGGG + Intergenic
965990617 3:174813080-174813102 CTGGTGAGTCAGTGAGTGAGCGG - Intronic
966266743 3:178055113-178055135 CTTGGGAGTCAGAGAGATGGGGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
968521747 4:1037378-1037400 CCTGTGAGCCAGAGAGAGTAGGG + Intergenic
968735086 4:2291151-2291173 CTGGCGAGTCTCAGAGAGGTGGG + Intronic
968817963 4:2831548-2831570 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
968908574 4:3465457-3465479 CTGGTGTGAGGGAGAGAGGAAGG + Intronic
970337171 4:15060367-15060389 CTAATGATTCAGAGAGAGGGGGG + Intronic
971197076 4:24479716-24479738 CTGTTGAGAGAGAGAGAGGGAGG - Intergenic
973012990 4:45100654-45100676 CTGGAGAGTCAGAGAGCCAATGG - Intergenic
973152056 4:46900453-46900475 CTGGTGAGACAGTGAGAGCCAGG - Intronic
974407442 4:61493210-61493232 GTTGTGAGTAAGAGAGAGGCAGG + Intronic
974444220 4:61958621-61958643 GTGGTGAGAGAGAGAGAGCAGGG + Intronic
975832119 4:78380342-78380364 CTGGCGACAGAGAGAGAGGATGG + Intronic
976444566 4:85116023-85116045 CTGGGGGGACAGAGAGAGGCAGG - Intergenic
978509655 4:109502547-109502569 GTGGTGGGTGAGAGAAAGGAAGG + Intronic
980535308 4:134113293-134113315 CTGGTGAGTCAGTGAGTGAGTGG - Intergenic
981029042 4:140105535-140105557 CTGTTTTGTCAGACAGAGGATGG - Intronic
982081368 4:151793452-151793474 ATGGTGGGTCAGAGAGAGGAAGG + Intergenic
982775324 4:159435695-159435717 CAGGTGAGAGGGAGAGAGGAAGG + Intergenic
982979336 4:162112348-162112370 CTGGGGAGGCTGAGACAGGAGGG - Intronic
983531450 4:168813700-168813722 CTGGTGAGGCTGAGGCAGGAGGG - Intronic
984752083 4:183287789-183287811 CTTGTGAGCCAGCGTGAGGAGGG - Intronic
984924356 4:184793659-184793681 AGGGAGAGTGAGAGAGAGGAGGG + Intronic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
986263141 5:6166653-6166675 CTGGAGAGTGAGAGGTAGGAAGG - Intergenic
986676100 5:10187212-10187234 CTCGTGAGTCAGAGATAGGAGGG + Intergenic
986774607 5:11002412-11002434 CTGCTGAATCACAGAAAGGATGG + Intronic
988738418 5:34045448-34045470 CTTTTGAGTCAATGAGAGGATGG - Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989191939 5:38678869-38678891 CTGGTCACTCAGAAAGAGGGAGG - Intergenic
989447147 5:41543168-41543190 CTGGGGATTCCAAGAGAGGAGGG + Intergenic
990280595 5:54246591-54246613 GTGTTGAGTCAGGGAGATGAAGG - Intronic
990865048 5:60370794-60370816 CTTGTGTGTAAGAGAGAGGGAGG + Intronic
991018815 5:61958967-61958989 CTGCTGAGTGGGAGCGAGGAGGG + Intergenic
992001522 5:72441125-72441147 ATGTTGAGACAGAGAGAGTATGG - Intergenic
992018548 5:72599721-72599743 CTGGTCAGTAAGGGTGAGGATGG + Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993479450 5:88405956-88405978 CTGGTGAGTAAGACTAAGGAGGG - Intergenic
994820053 5:104637705-104637727 TTGGTGAGTCAGAGAGTGAGTGG - Intergenic
995673634 5:114636519-114636541 GTGGTGAGAGAGAGAGAAGAGGG + Intergenic
996863894 5:128095824-128095846 CTGGTGATTCTTAGAGAGGCTGG + Intronic
997211444 5:132079385-132079407 CTGGTGAGTGAGAGTCATGATGG + Intergenic
997610118 5:135209915-135209937 CTGGTGGGACAGACAGAGAATGG - Intronic
998524398 5:142829085-142829107 CTGTTGAGTCAGGGAAAGGCTGG + Intronic
999274753 5:150322395-150322417 CTGGTGAGTCAGTGAGTCAATGG + Intronic
999797905 5:155005242-155005264 CTGGGGAGTGAGAGGTAGGAGGG + Intergenic
1002551353 5:179995197-179995219 CTGGAGAGAGAGAGAGAGGCAGG - Intronic
1003003134 6:2355903-2355925 CTGCTGAGTGAGAAAGAAGAGGG + Intergenic
1003762762 6:9198908-9198930 CTGGTGACTCAGCAAGAAGAGGG - Intergenic
1004287901 6:14339613-14339635 CAGGTGGGTCAGGGGGAGGAGGG - Intergenic
1005275394 6:24211582-24211604 CTTGTGAGTGAAAAAGAGGAAGG + Intronic
1005422816 6:25670484-25670506 TTGGAGAGTCAGATAGATGAAGG + Intronic
1005454224 6:26003653-26003675 CTGGAAACTCAGAGAGATGATGG + Intergenic
1006324700 6:33344909-33344931 GTGGAGAGTCAGACACAGGAAGG + Intergenic
1006511692 6:34525149-34525171 CGGGTGGGTGAGAGGGAGGACGG - Intronic
1006798880 6:36747008-36747030 CTGGCGAGTGACAGGGAGGAGGG - Intronic
1007345057 6:41222998-41223020 CTGAGGAGTGAGAGAAAGGACGG - Intergenic
1007545483 6:42690404-42690426 CTGATTAGTGAGTGAGAGGATGG + Intronic
1007753101 6:44081842-44081864 ATGATGAGTCAGAGTGAGGCTGG - Intergenic
1007757140 6:44107220-44107242 CTGATGGGTCAGAGGGAGGCAGG - Intergenic
1007823410 6:44579156-44579178 AGGTTGAGACAGAGAGAGGAGGG - Intergenic
1010831104 6:80530612-80530634 AAGGTGAGTGAGAGAGAGAAAGG - Intergenic
1011345369 6:86363783-86363805 TGGGTGAGTCAGTGAGAGAATGG + Intergenic
1011460247 6:87595619-87595641 CTGGTGCTTCCGAGAGATGATGG - Intronic
1011482280 6:87807157-87807179 ATGGTGGGTAAGAGAGAGGGAGG - Intergenic
1011706123 6:90003208-90003230 GAGGTGAGTCAGAGAGGTGATGG - Intronic
1012649233 6:101732894-101732916 CTGGAGAGAAAGAGAGAGCAAGG + Intronic
1013400722 6:109793894-109793916 TTTGTGTGTCAGAGTGAGGAGGG - Intronic
1013667181 6:112360751-112360773 CATGTGAGGCAGAGAGACGAGGG + Intergenic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1015869429 6:137760960-137760982 CTGGTGAATCTGAAACAGGAAGG + Intergenic
1016183317 6:141173110-141173132 ATGGTGAGTGAGAGAGAGAGAGG + Intergenic
1017251526 6:152285201-152285223 CTGGTGAGTGAAGGAGAGGAAGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017798408 6:157869186-157869208 CTCGTGAGGCAGAGAGGGGAGGG - Intronic
1018083381 6:160277980-160278002 CTGGTAATTCACAGAAAGGAAGG - Intergenic
1018342057 6:162861635-162861657 GTGGTGAGGCAGAGGGAGGTGGG - Intronic
1018435127 6:163752433-163752455 CTGGTGAGGGAGAGAGAGGCCGG - Intergenic
1018754873 6:166840358-166840380 GTGGGGAGGTAGAGAGAGGAAGG - Intronic
1018808221 6:167277547-167277569 CAGGTCAGGCAGAGAGTGGACGG + Intronic
1018839334 6:167507450-167507472 CAGGGGGGTCAGACAGAGGACGG - Intergenic
1019137731 6:169921897-169921919 CTGGTGAGTGACAGACAGGGTGG + Intergenic
1019989416 7:4681705-4681727 CTTGTGAGGCAGAGGCAGGAGGG + Intergenic
1021659943 7:22909739-22909761 CAGGTGAGTAAGGGAGAGAAGGG - Intergenic
1021668774 7:23014072-23014094 GTTGTCAGTCAGTGAGAGGAGGG - Exonic
1023113516 7:36838105-36838127 CTGTTGAGTCAGAAAAAGGATGG + Intergenic
1023198076 7:37663856-37663878 GTGGTAAGTGAGAGAGAGGGCGG - Intergenic
1023775785 7:43605566-43605588 CAGGTGAGTACCAGAGAGGAGGG - Intronic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024094254 7:45971807-45971829 CTGATGATTCAGAGTGAGGAGGG - Intergenic
1024212424 7:47217409-47217431 ATGGTCAGTGAGAGAGGGGAGGG + Intergenic
1024478633 7:49840841-49840863 CTCGGGGGTCAGAGAAAGGATGG - Intronic
1024619921 7:51148474-51148496 CCGCTGTGTCAGAGAGAAGATGG - Intronic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024945845 7:54806644-54806666 CTGGGGAGTCAAAGAAAGGGGGG + Intergenic
1026019234 7:66694960-66694982 CTGGTGACCCAGGGAGAGTATGG + Intronic
1027894463 7:84023659-84023681 CTGTTGATTCAGAGAGAGAGGGG - Intronic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1029193215 7:98786352-98786374 CTGCTGAGTCAGAGAGGAGAAGG - Intergenic
1029435604 7:100562483-100562505 AGGGTGAGTAAGGGAGAGGAGGG - Intronic
1029518601 7:101044990-101045012 TTCTTGAGTCAGAGAAAGGAAGG - Intronic
1030244211 7:107363159-107363181 CTGGAAAGTCAGAGAGACAATGG + Intronic
1031125740 7:117771670-117771692 TTGCTGAGTCAGTGAGAGAATGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1032984031 7:137317166-137317188 TGGGTGAGTCAGGGAGAGCAGGG + Intronic
1034424916 7:151009351-151009373 ATGGGGAGTCAGAGAGGGGTGGG - Intronic
1034820946 7:154215794-154215816 CTGGCGACCCAGAGAGGGGAAGG - Intronic
1035354669 7:158270015-158270037 CAGGTCAGGCAGAGAGTGGACGG - Intronic
1035366987 7:158355434-158355456 CAGGAGAGTGAGAGAGAGGCAGG - Intronic
1036074240 8:5476882-5476904 CAGGTGTGACAGAGAGAAGAAGG + Intergenic
1036605936 8:10305745-10305767 CTGGTAAGTGAGAGATTGGAAGG + Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036741200 8:11363190-11363212 CTGGGGAGTCTGAGGCAGGAGGG + Intergenic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1036793651 8:11740243-11740265 CTAGGGAGACACAGAGAGGAGGG + Intronic
1037522486 8:19693360-19693382 CTGGTAGAACAGAGAGAGGATGG - Intronic
1037605121 8:20431760-20431782 ATGGTGAGTGAGAGAAAGAATGG - Intergenic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1037914548 8:22764929-22764951 CCAGTGGGTCAGAGAGAGGAGGG + Intronic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1039191830 8:34984995-34985017 CTGATGATTCAGAGACAGCATGG + Intergenic
1039379743 8:37074097-37074119 CTGATGAGGAAGAGAGAGAAAGG + Intergenic
1039634065 8:39144019-39144041 CTGCTGAGGCAGACACAGGAGGG + Intronic
1039820286 8:41128629-41128651 CTGGTGAGAGAGACAGAGGCAGG - Intergenic
1040830543 8:51671824-51671846 CTGGTGAGTGTGAGATAGGGAGG - Intronic
1041175739 8:55194146-55194168 CTGATGAGTCAGAGAAAGAGTGG + Intronic
1041192004 8:55364268-55364290 CTCGCGCGTCAGATAGAGGAGGG - Intronic
1041755145 8:61305338-61305360 GTGGTTAATCAGAGAGGGGAAGG - Intronic
1041835751 8:62212835-62212857 CTGATGAGTCAGTGAGTGCACGG + Intergenic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042387001 8:68188273-68188295 ATGATGAGAGAGAGAGAGGATGG + Intronic
1042822355 8:72944203-72944225 CTGGTCAGTCTGAGAGAAGGTGG + Intergenic
1043517115 8:81005108-81005130 CTGGTGAGGAAAAGAGGGGAAGG + Intronic
1043917630 8:85940874-85940896 CCTGTGTGTCAGAGACAGGAAGG + Intergenic
1044778711 8:95721556-95721578 GTGGTGAGTGAGAAAGAGAAGGG + Intergenic
1046099188 8:109594827-109594849 CAAGTGAGAAAGAGAGAGGAGGG - Intronic
1046137237 8:110044255-110044277 CTGGAGTGTCAGGGAGAGAATGG - Intergenic
1046330233 8:112704646-112704668 CTTGAGAGAGAGAGAGAGGATGG - Intronic
1047197772 8:122736938-122736960 TTGGAGAGGCAGAGAGAGTAAGG + Intergenic
1048194820 8:132323622-132323644 ATGGGAAGTCAGAGAGAGGATGG - Intronic
1048808266 8:138261175-138261197 CTGGTGATTCAGACAGAGGTGGG - Intronic
1048872950 8:138813796-138813818 CTGGTGACCTGGAGAGAGGATGG - Intronic
1049020957 8:139957428-139957450 CTCTGGAGTCAGAGAGAGGCAGG + Intronic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051634239 9:19167080-19167102 CTGGGGACTATGAGAGAGGAGGG - Intergenic
1051807350 9:21010403-21010425 CTGGTGCATAAAAGAGAGGAAGG + Intronic
1052855451 9:33403637-33403659 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053471310 9:38347584-38347606 CTTCTGAGTCAGAGAGAGTGGGG - Intergenic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053683465 9:40499980-40500002 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1053933444 9:43128295-43128317 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1054280250 9:63124948-63124970 GGGGTGAGGCAGGGAGAGGAAGG - Intergenic
1054296569 9:63335478-63335500 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054394586 9:64639983-64640005 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1054429235 9:65145182-65145204 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1054501149 9:65876353-65876375 GGGGTGAGGCAGGGAGAGGAAGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1054725517 9:68646285-68646307 ATGGTGAGTGAGGGAGAAGAGGG - Intergenic
1054775664 9:69121733-69121755 CCGGGGAGGGAGAGAGAGGAGGG - Intronic
1055820190 9:80252990-80253012 AAGGTGAGGCAGAGAGGGGAAGG + Intergenic
1056117613 9:83456427-83456449 CTGTTGAGTCAGAGAGAGAGAGG + Intronic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057055135 9:91954588-91954610 ATGGTGATAGAGAGAGAGGACGG - Intergenic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057385012 9:94599208-94599230 CTGTTGAGCCTCAGAGAGGAGGG - Intergenic
1057569199 9:96190980-96191002 TTGGTGAGTTGGAGAGAGGAAGG - Intergenic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057824292 9:98360252-98360274 CTGTTGTGTCTGACAGAGGAGGG + Intronic
1057836073 9:98446545-98446567 CTGGTTAGCCAGAGAATGGAGGG + Intronic
1058261190 9:102834657-102834679 CTTGAGAGTCAGAAACAGGAGGG - Intergenic
1059198711 9:112394999-112395021 CTGGTGAGACAGAAAGTGTAAGG + Intronic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059702150 9:116785678-116785700 CTGATGAGGGAGAGAAAGGAGGG - Intronic
1060045429 9:120336711-120336733 GTGGGGAGTCAGAAAGATGAGGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060592761 9:124829366-124829388 GTGGAGAGAGAGAGAGAGGAAGG - Intergenic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1203376689 Un_KI270442v1:382730-382752 CTGGAGTGTCAGCGAGAGGGTGG + Intergenic
1185740177 X:2525797-2525819 AGGGTGAGAGAGAGAGAGGAAGG - Intergenic
1186093471 X:6074676-6074698 CTTGAGAGTCATAGAGAGGAAGG + Intronic
1186093476 X:6074840-6074862 ATTGAGAGTCAGAGAGAGAAAGG + Intronic
1186519770 X:10195081-10195103 CTGGTGAATCAGTCAGAGGTGGG + Exonic
1186541689 X:10407757-10407779 CTGTTTATTCAGAGAGAGAACGG - Intergenic
1186626391 X:11298525-11298547 CTGGTGAGAAACAGAGAGGCAGG - Intronic
1186886121 X:13915405-13915427 CTGCTGAGAGAGAGAGAGAATGG - Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1189328034 X:40124985-40125007 GTGTTGGGTCAGACAGAGGATGG + Intronic
1190496646 X:51033412-51033434 CTGAGGAGTCTGAGGGAGGATGG - Intergenic
1190509326 X:51160525-51160547 CTGAGGAGTCTGAGGGAGGATGG + Intergenic
1191617210 X:63182145-63182167 GTGGTGGCTCAGAGAAAGGAAGG - Intergenic
1191619088 X:63196778-63196800 GTGGTGGCTCAGAGAAAGGAAGG + Intergenic
1191843976 X:65532753-65532775 CTGGTGTGTCAGCCAGAGCAGGG + Intronic
1192084057 X:68078073-68078095 CTGGAGAGAGAGAGAGAGAAGGG - Intronic
1192218981 X:69184184-69184206 CTGCTGAGTCCAGGAGAGGATGG - Intergenic
1192468027 X:71371655-71371677 CTGTTGAGTGAGAGGCAGGATGG + Intronic
1193428368 X:81368949-81368971 AAGGTGAGTAAGAGTGAGGAAGG - Intergenic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1195413658 X:104596896-104596918 TGGGTGAGTGAGAGAGAGGCAGG + Intronic
1196847387 X:119907075-119907097 CTGCTCAATCAGAGAGAGGTTGG - Intronic
1198672891 X:139100348-139100370 ATGGTGGGAGAGAGAGAGGAGGG + Intronic
1198703169 X:139418628-139418650 CTGGGGACTGAGAGAGAGGTTGG + Intergenic
1198997398 X:142589527-142589549 CTGATGAGTCAGAGATGAGATGG - Intergenic
1199718828 X:150527189-150527211 ATGGTGAGGCAGAGAGGGGTTGG - Intergenic
1199743962 X:150760283-150760305 CAGGTGAGGCAGAGAGAAGGAGG + Intronic
1200835101 Y:7725265-7725287 CTGGGGACTCAGACACAGGATGG + Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic