ID: 917478318

View in Genome Browser
Species Human (GRCh38)
Location 1:175387750-175387772
Sequence CTGGAGACAGAGTAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 1, 2: 3, 3: 91, 4: 661}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917478318_917478328 20 Left 917478318 1:175387750-175387772 CCCACCTCCTACTCTGTCTCCAG 0: 1
1: 1
2: 3
3: 91
4: 661
Right 917478328 1:175387793-175387815 GCCGTCTTAGGCTGACCTTGAGG 0: 1
1: 0
2: 0
3: 0
4: 51
917478318_917478325 8 Left 917478318 1:175387750-175387772 CCCACCTCCTACTCTGTCTCCAG 0: 1
1: 1
2: 3
3: 91
4: 661
Right 917478325 1:175387781-175387803 TTCTCCCTCAGGGCCGTCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 139
917478318_917478323 -3 Left 917478318 1:175387750-175387772 CCCACCTCCTACTCTGTCTCCAG 0: 1
1: 1
2: 3
3: 91
4: 661
Right 917478323 1:175387770-175387792 CAGAATGAAGTTTCTCCCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 190
917478318_917478324 -2 Left 917478318 1:175387750-175387772 CCCACCTCCTACTCTGTCTCCAG 0: 1
1: 1
2: 3
3: 91
4: 661
Right 917478324 1:175387771-175387793 AGAATGAAGTTTCTCCCTCAGGG 0: 1
1: 0
2: 5
3: 17
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917478318 Original CRISPR CTGGAGACAGAGTAGGAGGT GGG (reversed) Intronic
900630192 1:3631009-3631031 CTGGAGACAGAGGCAGTGGTCGG - Exonic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901150233 1:7096431-7096453 GGGGAGACAGAGTCGGATGTGGG - Intronic
901616159 1:10541434-10541456 CGGGAGAAAGAGCAGGAAGTGGG - Intronic
901681696 1:10916508-10916530 CTGGTGACAGAGGAGCAGGGTGG - Intergenic
902545526 1:17187230-17187252 CTGCATACAGAGGAGGAGTTGGG + Intergenic
902657880 1:17881983-17882005 CTGCAGGCAGAGGAGGAGGGTGG + Intergenic
903274213 1:22210521-22210543 CTGGACACAGAGTCTGAGCTGGG - Intergenic
903510625 1:23872186-23872208 ATGAAGACAGAGTCAGAGGTAGG + Exonic
903878233 1:26490856-26490878 CTGGAGACTGGGGTGGAGGTTGG + Intergenic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
904357329 1:29948821-29948843 CTGAAGACAGCGTAGGATGGTGG + Intergenic
904696421 1:32334310-32334332 GTGGGGACAGGGAAGGAGGTAGG + Exonic
905263891 1:36738149-36738171 CTGGAGGCAGAGGGGGAGTTAGG + Intergenic
905343999 1:37299167-37299189 CTGAAGACAGAACAGGAGGGAGG - Intergenic
905792796 1:40799177-40799199 CTGCTCACAGAGTAGGAGGGTGG - Intronic
905855278 1:41307278-41307300 CTGTCGACAGAGTGGGCGGTGGG + Intergenic
906268118 1:44450288-44450310 CTGTAGATATAGCAGGAGGTTGG + Intronic
906547325 1:46629049-46629071 CTGGAGCCAAAGGAGTAGGTAGG + Intergenic
906675436 1:47690139-47690161 GGGGAGACAGAAAAGGAGGTCGG - Intergenic
907303498 1:53502060-53502082 GTGGAGACAGAGGAGGATGAAGG + Intergenic
907525394 1:55050982-55051004 GTGGAGACAGAGGTGGAGATTGG + Intronic
907941557 1:59093229-59093251 CTGGAGACAGGGTAAGGGGGAGG + Intergenic
908571690 1:65418138-65418160 CTGGAGACAGAATGGGTGGTTGG + Intergenic
908604042 1:65774160-65774182 CTGGAGATGGAGTAGGATCTGGG - Intergenic
911502332 1:98703483-98703505 CTGTAGACAGAGTAGGAGAAAGG + Intronic
912469222 1:109895192-109895214 CTGGGGAGTGAGTAGGAGGTAGG - Intergenic
912487695 1:110042058-110042080 CTTGAGTCAGAGTAGGCTGTTGG + Intronic
912771061 1:112464725-112464747 CTGGAGCAAGGGTAGGAGGGGGG + Intergenic
912859779 1:113203359-113203381 ATGGACACAGAGTAGAAGGATGG - Intergenic
913220294 1:116654580-116654602 CAGGAGGCAAAGTATGAGGTGGG + Intronic
913232715 1:116755155-116755177 CTGAAGACAGAGTTGTAGGCAGG - Intronic
913381685 1:118217822-118217844 CAAGAGCCAGAGTAGGTGGTGGG + Intergenic
914951161 1:152115556-152115578 GTGGAGACAGAGGTGGAGCTGGG - Intergenic
915058306 1:153157907-153157929 CAGGAGACAGAGAGGGGGGTGGG + Intergenic
915118691 1:153615533-153615555 CTGGAGGCCGAGCAGGGGGTGGG - Intronic
915148283 1:153808605-153808627 CTGGAGCCAGAGAGGCAGGTGGG + Exonic
915177849 1:154031558-154031580 ATGGAGACAGAGTAGAATGATGG - Intronic
915289817 1:154875984-154876006 CAGGACACAGAGCAAGAGGTGGG - Intergenic
915490274 1:156246757-156246779 CTAGAGACAGAGTGGGAGGTAGG + Intronic
915906492 1:159881894-159881916 CTGGAAACAGTGTGGGAGGTGGG - Intronic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
917224240 1:172764603-172764625 CTAGAGACAGAGCAGCAGGTGGG - Intergenic
917422897 1:174883408-174883430 CTGGAGACGCAGGAGGAGTTGGG + Intronic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
917857158 1:179110107-179110129 CTGGAGCCAGAGTTGTATGTTGG + Intronic
918080515 1:181204364-181204386 CTGGAGTCAGAGTAGCAGGCAGG + Intergenic
919739943 1:200975336-200975358 ATGGAGACAGAGGAGGAAGAGGG + Intronic
920057392 1:203202499-203202521 CTGGAGGCGGACTAGGAGGTGGG - Intergenic
920387999 1:205581553-205581575 CTGGAGCCAGAGTGTCAGGTGGG + Intronic
921079223 1:211725407-211725429 GTGGAGAGAGAGGAGGAGGAGGG - Intergenic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
921849259 1:219917464-219917486 CTGCAGGCAGAGCAGGTGGTGGG - Intronic
922015121 1:221637496-221637518 CTGGAGAAATAGTAGGAAGTGGG - Intergenic
922926083 1:229347677-229347699 ATGGGGACAGAGTGGGAGGCTGG - Intergenic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063447293 10:6127462-6127484 CAGGAGACAGAAGAGGAGGTGGG + Intergenic
1063447305 10:6127506-6127528 CAGGAGACAGAAGAGGAGGTGGG + Intergenic
1063447316 10:6127550-6127572 CAGGAGACAGAAGAGGAGGTGGG + Intergenic
1063447328 10:6127594-6127616 CAGGAGACAGAAGAGGAGGTGGG + Intergenic
1063447351 10:6127682-6127704 CAGGAGACAGAAGAGGAGGTGGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1064259373 10:13772768-13772790 ATGGAGACAGAATAGAAGGATGG + Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064688534 10:17890084-17890106 CTGGAGACAGAATTCTAGGTTGG + Intronic
1065048746 10:21768663-21768685 CTGTAGAGAGAGTGGAAGGTAGG - Intronic
1065257020 10:23880413-23880435 ATGGAGATAGAGTAGAAGGATGG + Intronic
1065879190 10:30025124-30025146 CTGGAGACTGGGTAGGAAGAGGG + Intronic
1066376483 10:34861901-34861923 CTGGAGAGAGAGAGGGCGGTAGG - Intergenic
1067221015 10:44344420-44344442 CTTGAGGCAGAGCAGGTGGTTGG - Intergenic
1067567781 10:47350744-47350766 CTGGAGACAGTGAAGGCCGTGGG + Exonic
1068208839 10:53893790-53893812 CGGGGGACAGAGTGGGAGGAAGG + Intronic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1068352844 10:55871363-55871385 TTGAAGACAGAGCAGGAGATAGG + Intergenic
1068405471 10:56583005-56583027 CTGGAGTCAGAGTAGGAAGAAGG - Intergenic
1069251441 10:66272042-66272064 CTGAAAACAGAGTATAAGGTAGG - Intronic
1069539871 10:69285903-69285925 CAGGAGACGGAGTAGGAGGAGGG - Intronic
1069773865 10:70915649-70915671 TAGGAGGCAGAGTGGGAGGTCGG - Intergenic
1070692071 10:78534245-78534267 GAGGAGACAGAGGAGGAGGAGGG - Intergenic
1070728016 10:78805172-78805194 CCGGAGACAGAGGACAAGGTTGG + Intergenic
1070838337 10:79465682-79465704 TTTGAGACTGAGTATGAGGTTGG - Intergenic
1071593284 10:86897142-86897164 CTGGAGACAGTATATGAGGAAGG - Intronic
1072434673 10:95404179-95404201 CTGGGGCCAGAGAATGAGGTGGG + Intronic
1072447544 10:95512639-95512661 CTGCAGATACAGTAGCAGGTGGG - Intronic
1072569760 10:96648236-96648258 CTGGAGGCAGGTGAGGAGGTGGG + Intronic
1072680182 10:97500113-97500135 TTTGACACAGAGTAGGAGATGGG - Intronic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1073503667 10:103966001-103966023 CTGGAGGCAGATCAGGAAGTGGG + Intergenic
1074158921 10:110821341-110821363 CTGGTGACAGTGGACGAGGTTGG + Exonic
1074619428 10:115103718-115103740 ATGGAGACAGAGTAGAATGATGG - Intronic
1075660967 10:124195989-124196011 TTGGGGAAAGGGTAGGAGGTGGG + Intergenic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1077065096 11:637540-637562 CAGGAGAGCGAGGAGGAGGTCGG - Exonic
1077828716 11:5839389-5839411 ATGGAGACAGAGTAGAATGATGG + Intronic
1078338325 11:10481491-10481513 CAGGAGACACAGGAGGAGTTAGG - Intronic
1079411292 11:20190226-20190248 CTGAAGAAAGAGTAGGAGTGAGG - Intergenic
1080057097 11:27917528-27917550 CGGGAGGCAGAGTAGGAGAATGG + Intergenic
1080795840 11:35562431-35562453 ATGGAGACTGAGTAGGGGCTGGG + Intergenic
1081365972 11:42235501-42235523 AGGGAGACAGAATAGGTGGTAGG - Intergenic
1081625423 11:44652466-44652488 CTGGAGACAGGTTTGGAGGGTGG + Intergenic
1081777465 11:45685334-45685356 CTGGAGACAGGGTGGGAGCAAGG - Intergenic
1081927353 11:46841972-46841994 CTGGAGAAAGAGTAAGACTTTGG + Intronic
1081961075 11:47137948-47137970 CTGAAGATAGAGTTGGAGGGTGG + Intronic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1082029199 11:47592675-47592697 CTGGAGACAGCCTGGGATGTGGG + Intronic
1083281674 11:61630501-61630523 GTGGAGACGGAGGTGGAGGTGGG + Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083470610 11:62881503-62881525 CTGGGGACAGGGGAGGGGGTCGG - Intronic
1083640296 11:64141769-64141791 CTGGGCACAGGGTAGGAGGCAGG + Intronic
1083757959 11:64801595-64801617 CTGGAGAGTGAGGAGAAGGTTGG + Exonic
1084092515 11:66887977-66887999 GTGGAGACAGAGCCAGAGGTGGG - Intronic
1084148981 11:67279305-67279327 CTGGAGAAAGGGGAGGAGGTTGG + Intronic
1084502985 11:69545816-69545838 GTGAAGACAGAGGAGGAGATTGG + Intergenic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1084942808 11:72622687-72622709 CTGGAGACAGAGGAGGATGGGGG + Intronic
1085191984 11:74634626-74634648 GTGGAGACGGAGGAGGAGGTGGG - Exonic
1085445405 11:76597823-76597845 GTGGGTACAGAGGAGGAGGTGGG - Intergenic
1086457556 11:86974303-86974325 CTGGAGTAAAAGGAGGAGGTTGG - Intergenic
1086598658 11:88606149-88606171 CAGCACAGAGAGTAGGAGGTAGG + Intronic
1087722911 11:101687224-101687246 ATGGAGCCAGAGGAGGAAGTGGG - Intronic
1087817916 11:102679380-102679402 CAAGAGAGAGAGTAGGAGGAGGG + Intergenic
1087930647 11:103973805-103973827 CTGGAGACAGAGTAAAACATGGG + Intronic
1089693077 11:120198665-120198687 CAGGAGACAGAGCAGTAGGGTGG + Intergenic
1090024087 11:123152931-123152953 CTGGAGGGAGAGAAGGATGTTGG + Intronic
1090201723 11:124862469-124862491 CTGGAGAAAGAGTCAGAGTTGGG - Intergenic
1090612108 11:128480452-128480474 CTGGAGGTAAAGGAGGAGGTAGG + Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090959601 11:131544379-131544401 CTGGAGAAAGAAGAGGAGGTAGG - Intronic
1091654244 12:2333661-2333683 CTGCAGAGAGAGATGGAGGTTGG + Intronic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1091840093 12:3614626-3614648 CTGGAGTCAGGGTTGTAGGTGGG + Intronic
1092117381 12:6019004-6019026 CGGGGGGCAGAGTAGGAGGAGGG + Exonic
1092479552 12:8847711-8847733 CTGCTGACAGAGTGGGAGGAGGG + Intronic
1093654352 12:21677537-21677559 AGGGAGACAGAGTAGGAAGATGG - Intronic
1093675927 12:21940773-21940795 CTTAAGACAGTGTAGGAAGTCGG - Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094449550 12:30570059-30570081 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1095330423 12:40955128-40955150 CTGGTCATAGAGTAGGAGTTGGG - Intronic
1095945059 12:47749054-47749076 GTGGAGCCAAAGTCGGAGGTGGG - Intronic
1096681736 12:53260123-53260145 CTGGAGGCTGAGGTGGAGGTGGG - Intergenic
1096828134 12:54294848-54294870 CGGGAGGGAGAGCAGGAGGTGGG + Intronic
1097065045 12:56314992-56315014 CAGGGGACAGGGTAGGGGGTAGG + Intronic
1098003538 12:65970771-65970793 CTGAAGACTGAGGAGGAGGTTGG - Intergenic
1098237643 12:68433093-68433115 TTGGAGAGAGAGTGGGAGGGAGG - Intergenic
1098584012 12:72134784-72134806 CTGGGTGCAGAGGAGGAGGTGGG + Intronic
1098672132 12:73244771-73244793 CTAGTCACAGAGTAGGAGATGGG + Intergenic
1099384850 12:82001827-82001849 GTGAAGTCAGAGGAGGAGGTAGG + Intergenic
1099788971 12:87305802-87305824 ATGGAGTGAGAGTAGGAGGGTGG + Intergenic
1099922506 12:88976981-88977003 AGGGAGGCAGAGGAGGAGGTCGG + Intergenic
1100580905 12:95939621-95939643 ATGGAGACAGAGAAGGCAGTGGG + Intronic
1101117480 12:101546465-101546487 ATGGAGACAGAGTAGAAGGATGG + Intergenic
1101177086 12:102164119-102164141 ATGGAGACAGAGTATTAAGTTGG - Intronic
1102372437 12:112393404-112393426 CAAGAGAGAGAGTAAGAGGTGGG - Intergenic
1102526825 12:113518541-113518563 CTGCATACAGTCTAGGAGGTAGG - Intergenic
1102542217 12:113629506-113629528 CTGAAGACAGAAAAGCAGGTGGG + Intergenic
1103219816 12:119234378-119234400 CTGGAGGCAGAGAAAGAGGCCGG - Intergenic
1103701236 12:122849722-122849744 CTAGAGACAGAGAGGGTGGTTGG + Intronic
1104463560 12:128973080-128973102 ATAGAAACAGAGTAGGAGGTTGG - Intronic
1104598524 12:130136704-130136726 GTGGAGACAGAGGCGGAGATGGG + Intergenic
1104674022 12:130700561-130700583 GTGGAGACAGAGGCAGAGGTGGG + Intronic
1105264960 13:18807880-18807902 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1105726461 13:23167075-23167097 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1106570663 13:30924493-30924515 CTGGGGGGAGGGTAGGAGGTGGG + Exonic
1106760508 13:32862937-32862959 GTGGAGACAAAGTGGGAGATTGG + Intergenic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1108493230 13:51001375-51001397 CTGGAGCCTGAGAAGCAGGTTGG + Intergenic
1109649653 13:65309732-65309754 CTGGCGACAGAGGAATAGGTGGG - Intergenic
1110237768 13:73234342-73234364 CTGGAAAGGGAGGAGGAGGTGGG - Intergenic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1111055995 13:82952456-82952478 ATGGAGACAGAGTAGAAGCAGGG + Intergenic
1111467837 13:88640844-88640866 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1111767553 13:92551700-92551722 ATTGAGAAACAGTAGGAGGTAGG + Intronic
1112433537 13:99373889-99373911 CTGGACACAGAGGAGGGGGCAGG + Intronic
1112496711 13:99911060-99911082 TTGGAGACAGAGTCAGAGGGAGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112655638 13:101449951-101449973 CTGGGGACACAGCAGTAGGTTGG - Intergenic
1112809767 13:103204144-103204166 CTGGAAACAAAATAGGAGATGGG - Intergenic
1113737386 13:112688768-112688790 CTGCAGACCGGGTAGGAGGGAGG - Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114648419 14:24268421-24268443 CTGGGGAAAGAGTAGGTGGTTGG + Intronic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1117154894 14:52929024-52929046 CTGGCGTCTGAGTAGAAGGTTGG - Intronic
1117402686 14:55372181-55372203 CCCCAGACAGAGTGGGAGGTGGG - Intronic
1117943375 14:60992619-60992641 CTGGGGACTGAGTGTGAGGTGGG + Intronic
1117963489 14:61184911-61184933 TGGGAGAGAGAGTAGGGGGTTGG + Intergenic
1118106462 14:62665680-62665702 CTAGTGAGAGAGTAGAAGGTGGG - Intergenic
1118882612 14:69842200-69842222 CTGGAGACAGAGTAGAGGTAGGG - Intergenic
1119266454 14:73265527-73265549 CTGGAGGCAGAATAGGAGGAAGG - Intronic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1121080412 14:91103397-91103419 ATGGAGACGGAGGAGGAGGGAGG - Intronic
1121845109 14:97165745-97165767 CTGGAGACAGTTCAGAAGGTAGG + Intergenic
1122778578 14:104134085-104134107 CTGGAGAGAGAGTAGGAGTGGGG - Intergenic
1122797969 14:104215929-104215951 CTGGAGCCACATGAGGAGGTAGG - Intergenic
1122935810 14:104955584-104955606 CTGAAGACAGAGGTGGAGGCAGG - Exonic
1122984794 14:105207119-105207141 CTTGAGCCAGAGTTGGAGGGTGG - Intergenic
1202833504 14_GL000009v2_random:60234-60256 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1123753956 15:23381873-23381895 CTGCATACAGGGTATGAGGTTGG - Intergenic
1124070443 15:26388037-26388059 CTGAAAACAGAGCAGGAGGTTGG - Intergenic
1124199589 15:27667089-27667111 TTGGACTGAGAGTAGGAGGTAGG - Intergenic
1124898198 15:33797215-33797237 CTGTAGGCAGAGAAGAAGGTTGG - Intronic
1125605929 15:40939885-40939907 CAGGAGACAGGGCAGGAGGGAGG + Intergenic
1126127159 15:45305623-45305645 GGTGAGGCAGAGTAGGAGGTTGG - Intergenic
1126196397 15:45936649-45936671 ATGGAGAAATAGTAGGAGGCAGG - Intergenic
1126383036 15:48067520-48067542 CTGGTGGCAGAGTAAGACGTGGG + Intergenic
1126704783 15:51397107-51397129 GTGGAGAGGGCGTAGGAGGTTGG + Intronic
1126904893 15:53353972-53353994 ATGGAGATAGAGTAGAAGGATGG - Intergenic
1127771260 15:62232642-62232664 TTGTAGCAAGAGTAGGAGGTGGG + Intergenic
1128192405 15:65714931-65714953 CTGGAGAGAGAGGAGGTAGTAGG - Intronic
1128291721 15:66483237-66483259 CTGGAGTCACAGTGGGGGGTAGG - Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128568138 15:68714656-68714678 CTGGAAAGGTAGTAGGAGGTGGG + Exonic
1128809347 15:70559378-70559400 CTGGAGACAGAAGGGGAGGGAGG + Intergenic
1129003841 15:72355802-72355824 CTGGGGCCAGAGTGGGAGGGTGG + Intronic
1129113014 15:73349129-73349151 CTGGAGACCAGGAAGGAGGTGGG - Intronic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129444443 15:75606918-75606940 CTGGAGAGAGATAAGGGGGTGGG + Intronic
1129601523 15:77001542-77001564 TTGCAGACAGTGCAGGAGGTGGG + Intronic
1129660748 15:77551502-77551524 GTGGCGACAGAGCAGGAGGCAGG + Intergenic
1129834952 15:78696578-78696600 ATGGAGATAGAGTAGAAGGATGG - Intronic
1129903024 15:79166222-79166244 CTGGGGACAGAGTAGGTTGTGGG + Intergenic
1129904766 15:79178713-79178735 CTGGAAAAAGAGTAGGGGATGGG - Intergenic
1130031886 15:80322970-80322992 CTGGAGACAGAGTGGGGTGGAGG - Intergenic
1130894947 15:88162776-88162798 CTGGAGAAAGAGGAGGAAGCTGG - Intronic
1131284332 15:91044602-91044624 CTGAAGACAGAGGCAGAGGTGGG - Intergenic
1131945302 15:97613591-97613613 CTGGAGACATAGAATGAGTTTGG - Intergenic
1132237362 15:100232283-100232305 ATGGAGCCAGGGTGGGAGGTGGG + Intronic
1132342455 15:101087044-101087066 CTGGAGACAGAGGAGAAGGAGGG + Intergenic
1132484402 16:182885-182907 CTTGAACCAGAGTCGGAGGTTGG + Intergenic
1132851190 16:2025744-2025766 TTGGAGACAGAGGAAGAGCTGGG + Intronic
1132936452 16:2483702-2483724 CTGGAGAGAGAGGAGGCGGGTGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1133284126 16:4682800-4682822 CTGGGGACAGAGGAGAGGGTGGG - Intronic
1133514096 16:6490743-6490765 CTGGAGACAGTTTAGGAACTGGG + Intronic
1133718196 16:8469515-8469537 CTGGAGGCAGAGAGGCAGGTGGG - Intergenic
1133772574 16:8875899-8875921 CTGGGGACAGGTGAGGAGGTGGG + Intergenic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1134462423 16:14441154-14441176 CTGCATACAGGGTATGAGGTTGG + Intronic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1136062819 16:27738261-27738283 CTGGAGCCAGGGAAGGAGGAAGG + Intronic
1136711098 16:32237917-32237939 CTGCTGACAGAATAGGAGGCAGG - Intergenic
1136756809 16:32691490-32691512 CTGCTGACAGAATAGGAGGCAGG + Intergenic
1136811300 16:33178885-33178907 CTGCTGACAGAATAGGAGGCAGG - Intergenic
1136817776 16:33288965-33288987 CTGCTGACAGAATAGGAGGCAGG - Intronic
1136824340 16:33345494-33345516 CTGCTGACAGAATAGGAGGCAGG - Intergenic
1136829406 16:33444265-33444287 CTGCTGACAGAATAGGAGGCAGG - Intergenic
1137305536 16:47195988-47196010 CTGGATACAGAATTGTAGGTTGG + Intronic
1137634776 16:49976285-49976307 CTGGAGACAGGGACGGGGGTTGG + Intergenic
1137836446 16:51597028-51597050 CTGGGGACAATGTTGGAGGTGGG + Intergenic
1138542416 16:57696373-57696395 GTGGAGATAAAGTGGGAGGTGGG - Intronic
1138574992 16:57901830-57901852 CTGAAGAATGAGTAGGAGTTTGG - Intronic
1139264307 16:65624696-65624718 CTGGAGACAGAGGAGAAAGAGGG - Intergenic
1139296040 16:65901755-65901777 ATGGACACACAGTAGGAGCTGGG + Intergenic
1139477782 16:67211285-67211307 GTGGAGACAGAGTGGGGAGTTGG + Intronic
1139580181 16:67868475-67868497 CAAGAGAGAGAGTGGGAGGTGGG - Intronic
1139956255 16:70694427-70694449 CTGGAGACAGAAGAGCAGGGGGG - Intronic
1141221924 16:82078835-82078857 ATGGAGATAGAGTAGAAGGATGG + Intronic
1141788709 16:86218530-86218552 GTGGAGACAGAGGCAGAGGTTGG + Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1202989878 16_KI270728v1_random:1854-1876 CTGCTGACAGAATAGGAGGCAGG - Intergenic
1203058959 16_KI270728v1_random:951842-951864 CTGCTGACAGAATAGGAGGCAGG + Intergenic
1142904637 17:3033736-3033758 TCAGAGACAGAGTAGGGGGTGGG + Exonic
1143159356 17:4859007-4859029 CAGGAAACAGGGCAGGAGGTGGG - Intronic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143626186 17:8111354-8111376 CTGCAGACAGAGCTAGAGGTGGG - Exonic
1143704263 17:8686245-8686267 AAGGAGACAGTGTAGGAGGGAGG - Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144134811 17:12283486-12283508 CGAGAGACTGAGTAGGAGGCAGG - Intergenic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144267637 17:13586450-13586472 CTGGAGGCAGAGTCAGAGGAGGG - Intronic
1144406616 17:14958055-14958077 CTGGAAAAAGAATAGGAGGAAGG + Intergenic
1144490413 17:15704164-15704186 TTAGAGACAGAGTTGGAGGGAGG + Intronic
1144873628 17:18385071-18385093 AGAGAGACAGAGCAGGAGGTCGG + Intronic
1144910554 17:18677805-18677827 TTAGAGACAGAGTTGGAGGGAGG - Intronic
1145158837 17:20560710-20560732 AGAGAGACAGAGCAGGAGGTCGG - Intergenic
1145369941 17:22299782-22299804 AGGGAGACAGAGTAAGAGGGAGG - Intergenic
1147443445 17:40461217-40461239 CTGAAGACAGAGGTTGAGGTTGG + Intergenic
1147470205 17:40651352-40651374 ATGGAGACAGAGTTAGGGGTAGG + Intergenic
1147861136 17:43524243-43524265 CTGGAGACGGGGTGGGAAGTGGG - Exonic
1147962448 17:44176418-44176440 GTGGAGACAGAGTAGACTGTGGG + Intronic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148239726 17:45992362-45992384 CTGGAGACAGAGCAGCAGCCTGG + Intronic
1148511850 17:48177783-48177805 TTAGAGTCAGAGTTGGAGGTGGG - Intronic
1148737099 17:49871016-49871038 CTGGGTACAGAGGAGGAGTTGGG + Intergenic
1148944619 17:51249234-51249256 TGGGAGACAGAGTTGGGGGTGGG + Intronic
1149311003 17:55393636-55393658 CTGAATTCAGAGTAAGAGGTTGG + Exonic
1149386860 17:56150995-56151017 CTGGGGACAGAGTGAGAGGCAGG + Intronic
1149568637 17:57656702-57656724 GTGGAGACAGAAAGGGAGGTCGG + Intronic
1149934198 17:60787639-60787661 AAGGAGATAGAGTAGGAGGGAGG + Intronic
1150075058 17:62185206-62185228 CTGGAGACAGAAAATCAGGTGGG + Intergenic
1150146422 17:62773416-62773438 CTGAGGAGTGAGTAGGAGGTGGG + Intronic
1150234255 17:63579863-63579885 CTGGAGACAGGGCAGGTGTTAGG + Exonic
1150826653 17:68482009-68482031 CCAGAGACAGACTAGGAGATGGG + Intergenic
1151197957 17:72445391-72445413 ATGGGGCCAGAGTGGGAGGTTGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151514422 17:74583140-74583162 CTGGGGACAGAGTAAGGGGGAGG - Intronic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151955386 17:77377613-77377635 CTGGAGGCAGAGCAGGCTGTGGG + Intronic
1152008118 17:77695091-77695113 TTGAAGCCAGAGTAGGAGGCAGG - Intergenic
1152037134 17:77880421-77880443 CTGGAGCCCAAGTAGGAGGGAGG - Intergenic
1152133057 17:78488825-78488847 GTGGAGACAGAGGCGGAGATGGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152508482 17:80769600-80769622 TTGGAGACAGAGGAGGGAGTAGG + Intronic
1152583720 17:81180093-81180115 CTGGAGACAGGGTGGGAGGCAGG - Intergenic
1152777978 17:82213943-82213965 CTAGACACAGAGTGGGGGGTGGG - Intergenic
1152819553 17:82429791-82429813 CTAGAGAGAGAGTGGGAGGTGGG - Intronic
1152856488 17:82667605-82667627 CAGGAGACAGAGGAGGATGCGGG - Intronic
1152946181 17:83198828-83198850 CTGCCCACAGAGTAGGAAGTGGG - Intergenic
1153909827 18:9696968-9696990 CTAGACACTGAGAAGGAGGTTGG - Intergenic
1154423433 18:14253663-14253685 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1155070514 18:22311615-22311637 CTTGAGAAAGTGTGGGAGGTAGG + Intergenic
1155092857 18:22528145-22528167 GTGGAGACAGAGGAAGAGGATGG - Intergenic
1155317201 18:24583849-24583871 ATGCAGACAGAGTAGAAGGATGG - Intergenic
1155815815 18:30307962-30307984 CTGGAGAAAAAGGAAGAGGTGGG + Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156472846 18:37388353-37388375 AGGGAGACAGAGGAGGAGCTGGG - Intronic
1156624105 18:38887812-38887834 CTGGATACAGTGTAGAAGATAGG + Intergenic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157779752 18:50427768-50427790 CTGGGGACATAGTGGGAGGCAGG + Intergenic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1161075296 19:2282333-2282355 CTGGACAGAGACCAGGAGGTGGG + Intronic
1161115244 19:2493091-2493113 CTGGAGACAGACACAGAGGTGGG + Intergenic
1161824870 19:6556528-6556550 CGGGAGACAGAGGAAGAGATAGG - Intergenic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1162959114 19:14115927-14115949 CTGATGACAGAGGAGCAGGTGGG - Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165100071 19:33434049-33434071 CTGGTGACAGAGGAGGAGAGGGG - Intronic
1165230312 19:34382635-34382657 CTGGAGCCTGAGCAGGTGGTGGG + Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166211459 19:41309235-41309257 CTGAAGAACGAGTAGGAGCTGGG - Intronic
1166283228 19:41808957-41808979 CTGGAGTCAGCCTAGGGGGTGGG - Intronic
1166549776 19:43657539-43657561 CTGAAGAATGAGTAGGAGTTAGG - Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1167283997 19:48588680-48588702 CTGGAGATAGAGTTAGAGGTGGG + Intronic
1167574889 19:50313152-50313174 CTTGAGCCAGGATAGGAGGTGGG + Intronic
1167901025 19:52622388-52622410 CTGGGGAAAGGGTAGAAGGTAGG - Intronic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168300329 19:55401368-55401390 TTAGAGACAGAGTTGGAGGGAGG + Exonic
1168424423 19:56227419-56227441 CAGGAGGCAGAGGCGGAGGTGGG + Intronic
1168684166 19:58337929-58337951 CTGGAGACAGAGAGAGAGGGAGG - Intronic
1202639166 1_KI270706v1_random:67461-67483 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
925198681 2:1948631-1948653 CTGGAAAGAGAGGAGGATGTGGG + Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925657892 2:6168940-6168962 CTGGAGAGAGGGAAGGAGGGAGG - Intergenic
926005873 2:9373185-9373207 CTGGAGCCGGAGCAGGAGGGAGG + Intronic
927258496 2:21061890-21061912 CTGGAGAAACAATAGGAAGTGGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927454945 2:23241317-23241339 CTGGAGACAGAGCAGAAGGTGGG + Intergenic
927537067 2:23871789-23871811 GTAGAGAAGGAGTAGGAGGTGGG - Intronic
928454711 2:31409104-31409126 ATGGAGATAGAGTAGAAGGATGG + Intronic
928738333 2:34319155-34319177 CTGGAGACAGATAAGAAGGGTGG - Intergenic
928756636 2:34534191-34534213 GTGGAGGCACAGTAGGAGTTGGG - Intergenic
929346222 2:40887758-40887780 CTACAGACAGAGTCGGGGGTGGG - Intergenic
930099164 2:47589745-47589767 CTGGGGAGAGAGTAGAAGTTAGG + Intergenic
930831205 2:55745187-55745209 CTGGAGAAAGAAAAGGAGCTTGG - Intergenic
931474237 2:62571341-62571363 CTGGAGATGGAGTTGGAGGTGGG - Intergenic
931784861 2:65609469-65609491 CTAGAAACAAAGAAGGAGGTGGG - Intergenic
931854634 2:66289010-66289032 ATGGATAGAGAGTAGGAGGATGG - Intergenic
933107504 2:78350549-78350571 CTGAAGAGATAGTTGGAGGTGGG + Intergenic
933388670 2:81643749-81643771 ATGGAGACAGAGTATAAGGATGG + Intergenic
933438656 2:82281929-82281951 TTGCAGAAAGAGCAGGAGGTAGG + Intergenic
935296739 2:101656386-101656408 CTGGAAACAGACCTGGAGGTGGG - Intergenic
935702571 2:105825093-105825115 CTGGAGGGAGAGGAGGAGGCAGG - Intronic
936885486 2:117306269-117306291 ATGGAGAGAGAGTAGAAGGATGG + Intergenic
937214847 2:120305847-120305869 CATGAGACAGAGCAGGATGTTGG - Intergenic
937345874 2:121124961-121124983 GGGGAGACAGGGCAGGAGGTTGG + Intergenic
937384333 2:121413863-121413885 CTGGGGACAGAGTGGCAGGAAGG + Intronic
938218984 2:129549444-129549466 CTGGAGGCAGGGGAGGAGTTAGG - Intergenic
939248942 2:139661711-139661733 CCAGAGACAGAGTAAGAGTTTGG + Intergenic
939489291 2:142857467-142857489 CTGGAGGCTGAGGAGGAGGATGG + Intergenic
939896133 2:147793243-147793265 CTGGAGACTGAGTAAGAAATTGG + Intergenic
940015082 2:149095786-149095808 CAGGAGACAGAGAAAGAGATGGG + Intronic
940195611 2:151091155-151091177 GTGGAGACAGGAAAGGAGGTTGG + Intergenic
940922256 2:159321721-159321743 ATGGAAACAGAGTAGAAGGATGG + Intronic
943802785 2:192083266-192083288 CTGGGGACAGACTAGGAAGGGGG - Intronic
943805624 2:192121429-192121451 GTGGAGACAAAGTAGAAGGAGGG + Intronic
944016954 2:195051982-195052004 CTGGAGACAGAGTGGAATTTAGG - Intergenic
944148982 2:196537298-196537320 ATGGGGACAGGGTGGGAGGTGGG + Intronic
946320024 2:218947597-218947619 GTGGGGACAGAGTAAGGGGTGGG + Intergenic
946602889 2:221371467-221371489 CTGGCGACGGAGCAGGAGGAAGG - Intergenic
946787981 2:223268169-223268191 CTGAGAACAGAGTAGGTGGTGGG - Intergenic
946952524 2:224892690-224892712 CTGGAAACAGTGCAGGAGGGAGG + Intronic
947107138 2:226679364-226679386 GTGGAGACAGAATAGTAGGCAGG - Intergenic
947301998 2:228698033-228698055 CTGAAGACAAAGCAGGAGGAAGG + Intergenic
947779160 2:232741962-232741984 CTGGAAAGAGAGTCGGAGGAAGG - Intronic
948691220 2:239706337-239706359 GGGGAGACAGAGGAGGAGGGAGG - Intergenic
1168961363 20:1872163-1872185 CTGGAGGCAGCGTAAGAGGAAGG - Intergenic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1170317276 20:15056132-15056154 CTGCATACAGAGGAGGGGGTCGG - Intronic
1170493729 20:16904162-16904184 CTGGAGAGAGAGGGTGAGGTGGG + Intergenic
1171016253 20:21544559-21544581 CAAGAGAGAGAGTAGGAGGGAGG + Intergenic
1171087074 20:22247345-22247367 CTGGAGCCACAGTAGCAGGTGGG + Intergenic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1171885758 20:30651576-30651598 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1172022803 20:31926081-31926103 CAGGAGACAGGGTATGAGATAGG + Exonic
1172132622 20:32665489-32665511 CCGGAAACACTGTAGGAGGTGGG + Intergenic
1172227811 20:33316929-33316951 CTGAAGGCAGAGTAGGTGCTGGG - Intergenic
1172876779 20:38169291-38169313 CTGGAGAAAGAATAGAAGGAAGG + Intergenic
1173833775 20:46111589-46111611 CTGGAGACAGTGCAGGGGGTGGG + Intergenic
1174784874 20:53423073-53423095 CAGGAGACAGTGTAGGTGTTGGG - Intronic
1175126245 20:56754014-56754036 CTGGAGACAGAATTGGTGTTTGG - Intergenic
1175304165 20:57964631-57964653 GAGGAGACAGAGGAGGAGGTGGG + Intergenic
1175438266 20:58971116-58971138 ATGGAGAGAGAGTAGAATGTTGG + Intergenic
1175765358 20:61588662-61588684 CTGGAGACAGAGGAGAAAGGGGG - Intronic
1175943090 20:62546859-62546881 CTGGGGACAGACAAGGATGTAGG + Intergenic
1176058562 20:63161618-63161640 CTGGAGGCGGAGGAGGTGGTGGG - Intergenic
1176647489 21:9365070-9365092 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1176787974 21:13281874-13281896 CTGGACACAGAGAAAGAGATGGG + Intergenic
1176850036 21:13906346-13906368 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1176914433 21:14608242-14608264 CAGGAGATAGAGGAGGAGGGTGG - Intronic
1177024233 21:15902427-15902449 ATGGAGATAGAGTAGAAGGATGG + Intergenic
1177675744 21:24296096-24296118 ATGGAAACAGAGCAGGAGATTGG - Intergenic
1179101356 21:38357859-38357881 CTGGAGAGAGAGGAAGGGGTTGG - Intergenic
1179288042 21:39994988-39995010 CTGAAGACTGGGTAGGAGTTAGG + Intergenic
1179311366 21:40198742-40198764 CTGGAGAGGCAGTGGGAGGTGGG + Intronic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1180362784 22:11914403-11914425 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1180718450 22:17888591-17888613 CTGAGAAAAGAGTAGGAGGTGGG + Intronic
1180821595 22:18832599-18832621 CAGGAGGCAGAGTATGAGGTGGG + Intergenic
1181033595 22:20159535-20159557 CTGGAGCCAGAGTAGGAAAAAGG - Intergenic
1181191383 22:21143446-21143468 CAGGAGGCAGAGTATGAGGTGGG - Intergenic
1181207816 22:21267064-21267086 CAGGAGGCAGAGTATGAGGTGGG + Intergenic
1181318198 22:21984847-21984869 CTGGAGGGAGAGGAGGAGCTCGG - Intergenic
1181365730 22:22375835-22375857 CTGCAGACTGAGCAGGAGGAAGG - Intergenic
1181373133 22:22433714-22433736 CAGGAGAAAGGGTAGGAGGGGGG - Intergenic
1181479491 22:23189350-23189372 ATGGAGACAGAGTAGAACGGTGG - Intronic
1181513823 22:23400612-23400634 CTGCAGGCAGGGTAGCAGGTGGG - Intergenic
1181713468 22:24706673-24706695 ATGGAAACAGAGTAGAAGGGTGG - Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182256371 22:29041757-29041779 CTGGAGACACTGTCGGTGGTGGG - Intronic
1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG + Exonic
1182713655 22:32338479-32338501 GTGGAGACAGGGTGGGTGGTGGG - Intergenic
1182844915 22:33422475-33422497 CAGGAGACAGAGAACGAGCTTGG + Intronic
1183097719 22:35563354-35563376 CTGGAGACAGAGGAAGTGCTGGG + Intergenic
1183718798 22:39550164-39550186 ATGGAGACAGGGCAGGAGTTTGG + Intergenic
1183778541 22:39983796-39983818 GTGGAGACCGAGAAGGAAGTGGG - Intergenic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184518015 22:44975065-44975087 GTGGAGAGAGAGGAGAAGGTGGG - Intronic
1184816793 22:46878320-46878342 AGGGAGAGAGAGAAGGAGGTGGG + Intronic
1185009927 22:48307160-48307182 CCTGAGACAGAGCAGGAGGAAGG - Intergenic
1185244631 22:49766332-49766354 CAGGAGCCAGAGTGGGAGGCTGG + Intergenic
1203219105 22_KI270731v1_random:28352-28374 CAGGAGGCAGAGTATGAGGTGGG - Intergenic
1203271720 22_KI270734v1_random:58475-58497 CAGGAGGCAGAGTATGAGGTGGG + Intergenic
949216381 3:1574094-1574116 CTAGAGATAGAGAAGTAGGTGGG - Intergenic
949225876 3:1695240-1695262 GAGGAGAAAGAGTAGGAAGTGGG + Intergenic
949249815 3:1970368-1970390 CAGGAGACTGAGTTGGGGGTTGG - Intergenic
949499736 3:4668294-4668316 ATGGACACAGAGTAGAAGGATGG - Intronic
949531232 3:4957525-4957547 TAAGAGACAGAGTAGGAAGTAGG + Intergenic
949541759 3:5038062-5038084 CTGGATACAGAGGAGGTGGTGGG + Intergenic
949826845 3:8174565-8174587 ATGTAGCCAGAGTTGGAGGTGGG - Intergenic
950445943 3:13038505-13038527 CGGGGGACAGAGGGGGAGGTAGG + Intronic
950548394 3:13652569-13652591 CTGGAGCCAGAGTTGAAGGGAGG + Intergenic
952139330 3:30460428-30460450 ATGGAGATAGAGTAGAAGGATGG + Intergenic
952330786 3:32362805-32362827 CTGGAGACAGAGCAACAGGAAGG - Intronic
952331339 3:32367039-32367061 TTGGAGACAGAGGAAGGGGTAGG - Intronic
952557719 3:34552053-34552075 ACGGAGACAGAGAAGGAGGTAGG - Intergenic
954035597 3:47849386-47849408 CTGCAGACAGGGAAGGAGGCTGG - Intronic
954296073 3:49675063-49675085 CTGGAGACAGATTGAGAGATTGG + Intronic
954618944 3:51984977-51984999 CTGGACACAGGGTTGGAGGAAGG - Intronic
954752192 3:52819920-52819942 CAGGTGACAAAGTAGGAGGTGGG - Exonic
954795170 3:53157703-53157725 CTGGGGACAGTGTAGTAGGAAGG - Intronic
955292766 3:57707772-57707794 ATGGAGACAGAGTAGAAGGATGG + Intergenic
955485183 3:59427976-59427998 CTAGAGCCAGAGGTGGAGGTGGG + Intergenic
955506935 3:59641828-59641850 CTGCAGAGAAAGTAGGAGGAAGG - Intergenic
955514535 3:59713655-59713677 CAGGAGACAGAGAGGGAAGTAGG + Intergenic
955562195 3:60203905-60203927 GTGAAGACAGAGTAGAAGGATGG + Intronic
955805880 3:62733838-62733860 CTGGAGGAAGGGTAGGAGTTGGG - Intronic
955884964 3:63588332-63588354 CAGGAGACACAGTGGAAGGTTGG - Intronic
956169161 3:66419254-66419276 GAGGAGACAGAGGAGGAGGTGGG - Intronic
959490618 3:106984492-106984514 ATGAAAGCAGAGTAGGAGGTTGG - Intergenic
959585551 3:108022060-108022082 CTTGAGACAGAGTAGGAACAAGG + Intergenic
959731731 3:109611793-109611815 GAGAAGACATAGTAGGAGGTGGG + Intergenic
960581605 3:119283610-119283632 CAGGAGACAGAGAATGAGGGAGG - Intergenic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961091523 3:124116913-124116935 CTGGAGGCAGAGTCAGATGTTGG + Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
961951446 3:130753617-130753639 CTGGCTGCAGAGGAGGAGGTGGG + Intergenic
961967936 3:130925721-130925743 CTAGAGAAAGACTACGAGGTGGG + Intronic
962827007 3:139107654-139107676 CTGCTGATAGAGAAGGAGGTAGG + Intronic
962973077 3:140423323-140423345 CTGGAGACATAATAGCAGATGGG - Intronic
963060002 3:141217771-141217793 AAGGGGACAGAGTAGGAAGTGGG - Intergenic
963063260 3:141241855-141241877 CTGGAGGCTGAGTAGGAGAGGGG + Intronic
963823202 3:149922578-149922600 TGGGAGACAGAATAGGAGGAAGG - Intronic
964050143 3:152381972-152381994 CTGGGGACATAGTAGGTGTTTGG + Intronic
964620706 3:158717715-158717737 ATGTAGACAGAGCAGGAGGCTGG + Intronic
964891315 3:161539267-161539289 ATGGAGACAGAGTAGAATGGTGG - Intergenic
965892051 3:173526771-173526793 ATGAAGACAGAGTAGAAGGATGG - Intronic
966678534 3:182615911-182615933 CTGGAGACAGAGAAGAAGTAAGG + Intergenic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967225255 3:187285016-187285038 CTGGAGAGAGCTTAGAAGGTAGG + Intronic
967395339 3:189002245-189002267 GAGGAGACAAAGCAGGAGGTTGG - Intronic
967833676 3:193943253-193943275 CTGAAAACAGGGTAGGAGGAGGG - Intergenic
968331965 3:197878524-197878546 CTGGTGACGGAGAAGGAGGGAGG - Intronic
1202739390 3_GL000221v1_random:39917-39939 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
968699397 4:2047471-2047493 CAGGAGACAGAGGCGGAGGTGGG + Intergenic
969241174 4:5898965-5898987 CTGAAGCCAGAGTAGGATTTAGG + Intronic
969664641 4:8550025-8550047 CAGGAGACAGAGCAGGAAATGGG - Intergenic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
970859272 4:20683156-20683178 CTGGAAGCAGACTGGGAGGTAGG - Intergenic
971394283 4:26214302-26214324 AAGGAGACAGAGAAGGAGGGAGG + Intronic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
972205350 4:36765476-36765498 CTTGAGACAGAGTACTAGGGAGG + Intergenic
972239750 4:37177631-37177653 CTGAAGACTGGGTAAGAGGTGGG + Intergenic
972445719 4:39141622-39141644 CTTGAGACAGGGTTGAAGGTGGG + Intergenic
972562416 4:40240420-40240442 CTGGAGACAGAGTACAATGGTGG - Intronic
972580172 4:40388192-40388214 CTTGACACAGAGGAGGAGCTGGG - Intergenic
972743965 4:41915147-41915169 CTAGAGAAAGAGGAGGACGTGGG + Intergenic
972827321 4:42774732-42774754 GTGGGGAAAGTGTAGGAGGTGGG + Intergenic
973307610 4:48670627-48670649 ATGGAGATAGAGTAGAAGGATGG - Intronic
973369403 4:49233821-49233843 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
974468601 4:62290673-62290695 CTGGGGGTAGAGTGGGAGGTAGG + Intergenic
975603571 4:76128925-76128947 GTGGAGAAAGAGTAGGAGTAGGG + Intronic
976406661 4:84667046-84667068 ATGGAGACAGAGTAGAATGATGG + Intergenic
976582112 4:86749259-86749281 GAGGAGACAGAGGAGGAGGGAGG - Intronic
977325519 4:95570936-95570958 CAGGAGACAGAGAAAGAGATAGG - Intergenic
978536780 4:109771009-109771031 CTGGAGAGAGAGTTAGGGGTGGG + Intronic
978718999 4:111883502-111883524 CTGGAAACAGAGTACGAGAAAGG - Intergenic
979086543 4:116417723-116417745 TTGGAGACAGAGTAGGAGGTAGG + Intergenic
979363799 4:119796262-119796284 CTTAAGAGAGAGTAGGAGGAAGG + Intergenic
979973057 4:127161576-127161598 TGGGAGACAGAGGAGGAGGCAGG - Intergenic
980251439 4:130320634-130320656 CTGGAGACAGACTAGTGGGTGGG - Intergenic
981130134 4:141149382-141149404 CTGGGGAAAGAGTGGGAGGGGGG - Intronic
981179317 4:141720275-141720297 TAAGAGACAGAGTTGGAGGTGGG + Intronic
983747989 4:171225254-171225276 CAGATGATAGAGTAGGAGGTAGG - Intergenic
983946703 4:173594110-173594132 CAGGAGAAAGAGTTGGGGGTGGG + Intergenic
984419111 4:179496850-179496872 AAGGAGAAAGAGGAGGAGGTGGG + Intergenic
984565867 4:181329511-181329533 CAGAAGACAGAGTTGGAAGTTGG - Intergenic
984662923 4:182392682-182392704 GTGGAAACAGAGAAGGAGGCAGG + Intronic
984872291 4:184336472-184336494 GGGGAGACAGAGTTGAAGGTTGG + Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1202766516 4_GL000008v2_random:153331-153353 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
987015216 5:13811044-13811066 ATGGAGATAGAGTAGAAGGATGG + Intronic
987258119 5:16178933-16178955 CTGGAGGCAAACTGGGAGGTAGG + Intronic
987725098 5:21687888-21687910 CAAGAGAGAGAGTAGTAGGTGGG - Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988490319 5:31700309-31700331 GTGGAGGCTGAGGAGGAGGTGGG + Intronic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
989534024 5:42542788-42542810 CTGGAGACTGAGGAGGGGGTAGG - Intronic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990903313 5:60777058-60777080 ATGGAGATAGAGTAGAAGGGTGG + Intronic
991018920 5:61959798-61959820 CTGAAGTAAGAGTAGGAGGCAGG - Intergenic
993031661 5:82713475-82713497 CTGGAGACAGAGAGCCAGGTTGG + Intergenic
993767588 5:91879907-91879929 ATGGAGACAGAGTAGAAGGATGG - Intergenic
993811445 5:92483057-92483079 ATAGAAACAGAGTAGAAGGTTGG + Intergenic
993852008 5:93022221-93022243 CTGGAGACAGATGAGGGGCTGGG + Intergenic
995063543 5:107837000-107837022 ATGGAGACAGAGTAGGAGAGAGG - Intergenic
995180998 5:109230127-109230149 CTGGAGAATGAATGGGAGGTAGG + Intergenic
995771131 5:115671652-115671674 ATGAAGACAGAGTAGAAGGATGG + Intergenic
997050569 5:130374858-130374880 CTGGAGACAGAGTAGACTATGGG - Intergenic
997658425 5:135572412-135572434 CTGGAGACAGAAGAGGTGGTTGG + Intronic
998399014 5:141838291-141838313 AAGGAGACAGAGTAGGAGTGAGG + Intergenic
998446733 5:142204645-142204667 CTGGAGACACAGTGTGGGGTTGG - Intergenic
998504482 5:142660907-142660929 CTGGAGCCAGAGAAGGAAGGAGG - Intronic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998976028 5:147648896-147648918 GAGGGGAGAGAGTAGGAGGTAGG + Intronic
999122664 5:149221110-149221132 CTTGAAAATGAGTAGGAGGTGGG + Intronic
999195002 5:149775819-149775841 GTGGAGAAAGAGAAGGGGGTAGG - Intronic
999919069 5:156297960-156297982 ATAGAGACAGAGTAGAAGGACGG - Intronic
1000015716 5:157273691-157273713 CTGGGGGTAGAGTAGGAGCTTGG - Intronic
1000061988 5:157666264-157666286 CTGGAGGCTGAGGTGGAGGTGGG - Intronic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1000288404 5:159847336-159847358 CTGGCGCCAGAGTGGGAGCTGGG - Intergenic
1000572979 5:162937580-162937602 CTGGATACAGAGTAAGAAGTGGG - Intergenic
1001422796 5:171600132-171600154 TTGGAGACTGAGTAGGAGTTTGG - Intergenic
1001756236 5:174172486-174172508 CTGGAGGCAGAGGAGGTGATAGG + Intronic
1002059147 5:176616159-176616181 GTGGGCACACAGTAGGAGGTAGG + Intergenic
1002439286 5:179256021-179256043 CTGGGGACAGAGAAGGAGACTGG - Intronic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1002979731 6:2124682-2124704 CTGGAGAAAGGCTATGAGGTGGG - Exonic
1003383369 6:5645450-5645472 GTGGGGACAGAGGAGGAGCTTGG - Intronic
1003978300 6:11365022-11365044 CTGGAGCAAGAGTTGGAGGTGGG + Intronic
1004370673 6:15049537-15049559 CTGGAGACAGACCAGGGGTTAGG + Intergenic
1004410094 6:15373242-15373264 CTTGAGACAGAGCAAGAGGTGGG - Intronic
1004443086 6:15672205-15672227 GTGGAGACTGAGGGGGAGGTGGG + Intergenic
1004447017 6:15709866-15709888 CAGGAAACAGAGCAAGAGGTGGG - Intergenic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005260887 6:24058030-24058052 CTGGAGCCAGGGTAAGGGGTTGG - Intergenic
1005516697 6:26561612-26561634 CGGGAGGCTGAGTAGGAGGATGG + Intergenic
1005568695 6:27123735-27123757 CTGAAGACAGAATAGGGAGTAGG + Intergenic
1005581199 6:27236962-27236984 CTGAAGACAGAGTAGGCATTCGG - Intergenic
1005624608 6:27651618-27651640 GCGGAGACAGAGAAGGAGGGAGG + Intergenic
1006119401 6:31795089-31795111 CTGGAGACAGATGCGGGGGTGGG + Exonic
1006130396 6:31865661-31865683 CTGGAGTCGGAGTAGGAGTCAGG - Intronic
1006180670 6:32151765-32151787 CTGGAGACAGTGGAGGGGGTGGG + Intronic
1006202950 6:32313086-32313108 AAGGAGGCAGAGCAGGAGGTAGG - Intronic
1006203607 6:32319566-32319588 AAGGAGGCAGAGCAGGAGGTAGG - Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006386323 6:33733081-33733103 CTGCAGGCAGAGTAGGTGGCCGG + Intronic
1006627552 6:35408108-35408130 CAGAAGACAGGGTAGGAGGGTGG - Intronic
1006644387 6:35505998-35506020 CTGGACACGGAGAAGAAGGTGGG - Exonic
1006729873 6:36228879-36228901 CTGGAGGCAGAATAGAAGATGGG - Intronic
1007598347 6:43065816-43065838 CTGGAGACAGGGCAGGGGCTGGG + Intronic
1008118012 6:47575599-47575621 CAGAAGACACAGTAGTAGGTAGG + Intronic
1008453150 6:51676038-51676060 CTGGTGGCAGAGGAGGAGGAAGG + Intronic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1011124545 6:83993172-83993194 CTAGAGCCAGGCTAGGAGGTAGG - Intergenic
1011817143 6:91205684-91205706 CAGGAGAAAGGGTGGGAGGTGGG - Intergenic
1012563211 6:100613243-100613265 AGGGTGACAGAGTAGGAGGGAGG - Intronic
1013318083 6:108960398-108960420 CTGGAGACTGAGTGGGAGGCAGG + Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013804478 6:113982267-113982289 CTGGACACAGAGTGGGAGGGTGG - Intronic
1013822150 6:114167373-114167395 CTGTAGACACAGTAGTAAGTAGG + Intronic
1013895116 6:115078717-115078739 CTGGAGCCAGAGAAGGGAGTGGG + Intergenic
1014247744 6:119084914-119084936 CTGGAGACAGAGCAGGGAGCAGG + Intronic
1015212845 6:130717586-130717608 GTGAAGACAGAGGAGGAGATTGG + Intergenic
1015578113 6:134694223-134694245 ATGGAGACAGAGTAGAAGAATGG - Intergenic
1015607757 6:134976738-134976760 CTGGAGACTCAGTAGCGGGTAGG + Intronic
1015802953 6:137078925-137078947 CCGGGGAAAGTGTAGGAGGTGGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016128480 6:140435278-140435300 TTGGAGATAGAGTAGTAGGTTGG + Intergenic
1016497622 6:144682176-144682198 ATGGAGATAGAGTAGAAGGATGG - Intronic
1016572788 6:145533519-145533541 ATGGAGGCAGAGAAGTAGGTGGG - Intronic
1016624536 6:146150737-146150759 ATGGAGATAGAGTAGAAGGATGG - Intronic
1016723114 6:147325792-147325814 CAAGAGACAGAATAGGTGGTGGG - Intronic
1016891422 6:149011276-149011298 ATGGAGATAGAGTAGAAGATTGG + Intronic
1017006080 6:150028875-150028897 CTGGAGAAAGAGCAGGTGGGTGG + Intergenic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1018047673 6:159979562-159979584 CTGGTGGCAGAGTCGGGGGTTGG + Intronic
1018377861 6:163230879-163230901 TTGGAGAGAGAGGAGGAGGTAGG + Intronic
1018739213 6:166714608-166714630 CTGGAGACAGAGGCAGAGGCGGG + Intronic
1018780043 6:167055007-167055029 CTGGAGACAGGGGAGGAGGAAGG + Intergenic
1019740453 7:2670409-2670431 GTGGAGGCAGAGTGGGAGGCGGG + Intergenic
1019779248 7:2929888-2929910 CTGGAGGGAGAGTGGGTGGTGGG + Intronic
1021281763 7:18728300-18728322 CTGTAGACAAAGGAAGAGGTTGG - Intronic
1021483705 7:21145334-21145356 CTGGAGAAAGACTAGGTGGCAGG - Intergenic
1022657263 7:32330950-32330972 AAGGAGACAGAGGAGGAGGGAGG - Intergenic
1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG + Intergenic
1024231735 7:47368429-47368451 CTCCAGACAGCGTGGGAGGTGGG - Exonic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1024978569 7:55136384-55136406 AGGGAGATAGAGGAGGAGGTGGG - Intronic
1024991070 7:55234819-55234841 CAGGAGACAGAGGAGGGGGTTGG + Intronic
1025295621 7:57773493-57773515 CGGGAGACAGAGCAAGAGGGAGG - Intergenic
1025944029 7:66092745-66092767 CTGGGGAGAGAGGAAGAGGTGGG - Intronic
1026225769 7:68439186-68439208 ATGGAGATAGAGTAGCAGGATGG + Intergenic
1026840768 7:73668859-73668881 CTGGAGGCAGAGGAAGGGGTGGG + Intronic
1026895944 7:74010177-74010199 CTGGAGGGAGAATAGGGGGTTGG + Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027878548 7:83802309-83802331 CTGGGGACAGGGTTGGGGGTAGG + Intergenic
1028071863 7:86460575-86460597 GTGGGGAGAGAGTAGGAGGAGGG - Intergenic
1029653973 7:101912244-101912266 ATGGAGATAGAGGAGGAGGAGGG - Intronic
1030658725 7:112196323-112196345 TTGGTGACAGAGAAGGAGGTAGG - Intronic
1033163167 7:139015265-139015287 CTGGTGACAGAGCAGGGGCTGGG + Intergenic
1033225697 7:139560511-139560533 ATGGAGACAGAGTAGAAGGGTGG + Intergenic
1033818453 7:145103913-145103935 CTAAAGACAGAGCAGGAGGTGGG + Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034158122 7:148972278-148972300 CCGGATACAGAATAGGAGGCTGG - Intergenic
1034929903 7:155153449-155153471 CTGGTGACAGTGTTGTAGGTGGG - Intergenic
1035582708 8:749919-749941 GTGGAGACAGAGAAGCAGGCTGG - Intergenic
1036649936 8:10635726-10635748 GTGGAGACAGTGGAGGATGTGGG + Intronic
1036916649 8:12810753-12810775 GGGGAGAAAGAGGAGGAGGTAGG - Intergenic
1037507044 8:19540952-19540974 CTGGGGACAGGGTAGGGGCTTGG - Intronic
1037786973 8:21909088-21909110 GTGGAAAAAGAGTAGGAGGAGGG + Exonic
1038346296 8:26735440-26735462 CTGTGGACAAAGTAGGATGTGGG + Intergenic
1038395261 8:27241728-27241750 TGGGAGACAGTGTAGGAGGAAGG - Exonic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1041170885 8:55141256-55141278 CTGGAGGCAGAGGAGGAGGGAGG - Intronic
1041174564 8:55181076-55181098 CTCGAGACATAGTAGGAGCTTGG - Intronic
1041406191 8:57501868-57501890 ATGAAGACAGAGTAAGAGATGGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1042717792 8:71793763-71793785 GTGGAGACAGACTTGGAGTTTGG - Intergenic
1043412981 8:80018956-80018978 ATGGAGACAGAGTAGAAGGATGG + Intronic
1044414355 8:91919296-91919318 CTGGAGTCAGAGTATGAGTCTGG + Intergenic
1044593590 8:93937722-93937744 CAGGAGACAGTGTAGGAGAGTGG + Intergenic
1045037326 8:98185757-98185779 ATGGAGACAGTCAAGGAGGTAGG - Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045995237 8:108354218-108354240 ATGGAGATAGAGTAGAAGGCTGG + Intronic
1046604958 8:116361245-116361267 CTGGTGACTGAGTAAGAAGTGGG - Intergenic
1046736483 8:117781677-117781699 ATGGAAACAGAGTAGGTAGTTGG - Intergenic
1047499372 8:125430123-125430145 GGGGAGAGGGAGTAGGAGGTGGG - Intergenic
1047893787 8:129342995-129343017 ATGGAGACACAGTAGGAAGGAGG + Intergenic
1048073399 8:131042624-131042646 CTGGAGACAGTGTATGTGGTTGG - Intergenic
1048319337 8:133386221-133386243 CTGAAGACAGACTCTGAGGTAGG - Intergenic
1048570956 8:135655558-135655580 CTGGAGACAGAGGAAGGGGCTGG + Intronic
1048926411 8:139276466-139276488 CTGGAGAAAGCAGAGGAGGTGGG + Intergenic
1049326224 8:142022897-142022919 CTGAAGACAGAGCAGCTGGTGGG + Intergenic
1049544120 8:143221605-143221627 CAGGAGACTGGGTAGGAGGAGGG + Intergenic
1049759069 8:144323756-144323778 CTGGAGACAGGGTGGCGGGTGGG - Intronic
1051339028 9:16094063-16094085 CAGGAGGCATAGTAAGAGGTTGG + Intergenic
1051530466 9:18096484-18096506 CTGTGGCCAGAGTAGGAGATGGG + Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052877287 9:33576370-33576392 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053373755 9:37586496-37586518 ATGGAGACAGAGTAGAATGATGG + Intronic
1053387101 9:37701414-37701436 CAGAAGACTGAGTAGGAGTTGGG + Intronic
1053498715 9:38568024-38568046 CTGGAGACAGGGCAAGAGGAAGG - Intronic
1053662477 9:40293281-40293303 CTGGAGACAGGGCAAGAGGAAGG + Intronic
1053912931 9:42923456-42923478 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1054374606 9:64439506-64439528 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1055693788 9:78861125-78861147 CTGGAGCCTGAGTAGCAGGATGG - Intergenic
1056400628 9:86223901-86223923 CCAGAGACAGAGTAGGGAGTGGG + Intronic
1056551505 9:87656782-87656804 CAAGGGACAGAGTGGGAGGTGGG + Intronic
1056889568 9:90478263-90478285 CCGGAGACAGAGTCTGGGGTAGG - Intergenic
1057161768 9:92894322-92894344 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1057494484 9:95550106-95550128 CTGGGGATGGAGTAGGAGATGGG + Intergenic
1057678166 9:97152517-97152539 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059269127 9:113061204-113061226 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059270263 9:113066653-113066675 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059271399 9:113072103-113072125 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059272530 9:113077547-113077569 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059273665 9:113082989-113083011 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059274801 9:113088435-113088457 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059591978 9:115671714-115671736 CTGGAGACAGAGAAAGCAGTTGG + Intergenic
1059616413 9:115956309-115956331 TTGGAGTCAGAGAAGGTGGTGGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059847683 9:118299171-118299193 AGGGAGACAGAGCAGGAAGTTGG + Intergenic
1060143307 9:121229174-121229196 CTGAAGACAAAGTAGGGGGAGGG - Intronic
1060190453 9:121589057-121589079 CTGGGGAGTGAGTAGGAGGCAGG - Intronic
1060559017 9:124527642-124527664 TTGGTGACAGAGTAGGAATTTGG + Intronic
1061486334 9:130922329-130922351 CTGGAGAGAGACTGGGAGGCCGG - Intronic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062131589 9:134897185-134897207 CTGGAGATGGAGTGGGAGGCAGG - Intergenic
1203708033 Un_KI270742v1:69866-69888 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1203547271 Un_KI270743v1:138209-138231 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1185499060 X:583999-584021 AGGGAGACAGAGGAGGAGGAGGG + Intergenic
1185667090 X:1774507-1774529 CGGGCCACAGAGCAGGAGGTGGG - Intergenic
1186414132 X:9368865-9368887 CTGGAGAGAGGCTAGGGGGTGGG + Intergenic
1187068496 X:15864658-15864680 CTAGAGAAAGTTTAGGAGGTTGG + Intergenic
1187096197 X:16151024-16151046 ATGGAGACAAAGCAGGAGGCTGG + Intronic
1187603359 X:20857987-20858009 TTGAATAGAGAGTAGGAGGTTGG - Intergenic
1188747390 X:33862798-33862820 ATGGAGACAGAGCAGAAGGATGG - Intergenic
1189224214 X:39398910-39398932 CTGGGGAGAGAGTGGGGGGTGGG + Intergenic
1190157302 X:48004400-48004422 GTGCACAAAGAGTAGGAGGTAGG + Exonic
1190173072 X:48127285-48127307 GTGCACAAAGAGTAGGAGGTAGG + Intergenic
1190894965 X:54608500-54608522 CGGGGGAAAGAGTAGGAGGGGGG - Intergenic
1190911527 X:54776060-54776082 CTGGGGGCAGAGTTGGAGGGTGG - Intronic
1190943008 X:55061773-55061795 ATGGAGATAGAGTAGAAGGGTGG - Intergenic
1191783661 X:64894692-64894714 CTGGAGTCAGAGTTGGGAGTAGG + Intergenic
1191970560 X:66810740-66810762 CTAGAGAAAGGGTAGGAGGGTGG - Intergenic
1192530665 X:71881049-71881071 CTGGACACAGAGTAGAAGGATGG + Intergenic
1193279904 X:79634965-79634987 ATGGAGACAGAGTAGAATGATGG - Intergenic
1193891229 X:87048209-87048231 TTGGAGATAGAGTAGAAGGATGG - Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195089807 X:101448019-101448041 ATGGAGATAGAGTAGAAGGATGG - Intronic
1195594686 X:106674244-106674266 TTGGAGGCAGAGCAGGAGGGCGG - Intronic
1195824030 X:108977796-108977818 CTGAAGATAGAGTAGAAGGATGG + Intergenic
1196074837 X:111564401-111564423 ATGGAGAAAGAGTAGAAGGATGG - Intergenic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1197526732 X:127573927-127573949 ATGGAGATAGAGTAGAAGGATGG - Intergenic
1198485725 X:137085672-137085694 CTGGAGAAACACTAGCAGGTAGG + Intergenic
1198530548 X:137547018-137547040 CTGGGGACAGAGGAGGTGGTAGG + Intergenic
1199616747 X:149661925-149661947 ATAGAGACAGAGTAGAAGGATGG - Intergenic
1199625894 X:149741323-149741345 ATAGAGACAGAGTAGAAGGATGG + Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200234965 X:154463781-154463803 CTGGAGAAAGTGGAGGAGGGCGG - Intronic
1200274295 X:154717368-154717390 CTGGAGATGGAGTGGGGGGTGGG + Intronic
1201365518 Y:13202335-13202357 GTGGAGGAAGAGTAGGAAGTGGG + Intergenic