ID: 917479594

View in Genome Browser
Species Human (GRCh38)
Location 1:175400563-175400585
Sequence ACAATTGAATAGTGTTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917479594_917479597 1 Left 917479594 1:175400563-175400585 CCTTGGCAACACTATTCAATTGT 0: 1
1: 0
2: 0
3: 13
4: 139
Right 917479597 1:175400587-175400609 CTTAAGTGCTGCAGACCTAGGGG 0: 1
1: 0
2: 2
3: 8
4: 106
917479594_917479602 28 Left 917479594 1:175400563-175400585 CCTTGGCAACACTATTCAATTGT 0: 1
1: 0
2: 0
3: 13
4: 139
Right 917479602 1:175400614-175400636 CAGAATGCAATCCACACAATGGG 0: 1
1: 0
2: 1
3: 30
4: 230
917479594_917479596 0 Left 917479594 1:175400563-175400585 CCTTGGCAACACTATTCAATTGT 0: 1
1: 0
2: 0
3: 13
4: 139
Right 917479596 1:175400586-175400608 GCTTAAGTGCTGCAGACCTAGGG 0: 1
1: 0
2: 1
3: 8
4: 69
917479594_917479601 27 Left 917479594 1:175400563-175400585 CCTTGGCAACACTATTCAATTGT 0: 1
1: 0
2: 0
3: 13
4: 139
Right 917479601 1:175400613-175400635 TCAGAATGCAATCCACACAATGG 0: 1
1: 0
2: 1
3: 17
4: 218
917479594_917479595 -1 Left 917479594 1:175400563-175400585 CCTTGGCAACACTATTCAATTGT 0: 1
1: 0
2: 0
3: 13
4: 139
Right 917479595 1:175400585-175400607 TGCTTAAGTGCTGCAGACCTAGG 0: 1
1: 0
2: 2
3: 10
4: 111
917479594_917479598 2 Left 917479594 1:175400563-175400585 CCTTGGCAACACTATTCAATTGT 0: 1
1: 0
2: 0
3: 13
4: 139
Right 917479598 1:175400588-175400610 TTAAGTGCTGCAGACCTAGGGGG 0: 1
1: 0
2: 1
3: 12
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917479594 Original CRISPR ACAATTGAATAGTGTTGCCA AGG (reversed) Intronic
905122874 1:35695296-35695318 ACATTTAAAAAGTGTTGCCGGGG - Intergenic
907336129 1:53700796-53700818 AAAATAGATTAGTGTTGCCAGGG - Intronic
909602545 1:77475733-77475755 ACATCTGACTAGTCTTGCCAAGG - Intronic
910339517 1:86169704-86169726 ACACTTGTATAGTCATGCCAGGG + Intergenic
910447735 1:87315913-87315935 ACAACTTCATAGTATTGCCAGGG + Intergenic
910475789 1:87605123-87605145 ACAAATGATAAGTGTTGGCAAGG - Intergenic
912171584 1:107107208-107107230 ACCACTGAATATTTTTGCCAAGG - Intergenic
917479594 1:175400563-175400585 ACAATTGAATAGTGTTGCCAAGG - Intronic
919276802 1:195428713-195428735 ACAATTTATTAGTTTTGCAAAGG + Intergenic
919507067 1:198412502-198412524 ACAAAAGATAAGTGTTGCCAAGG - Intergenic
921486529 1:215721767-215721789 ACAACTAAAAAGTTTTGCCATGG + Intronic
921660756 1:217798847-217798869 AAAATAGAATGCTGTTGCCAGGG - Intronic
924089552 1:240488112-240488134 ACAAATGAATAGATTTGCCCTGG - Intergenic
924406349 1:243751582-243751604 ACAATGGACTAGATTTGCCAGGG - Intronic
1063273884 10:4542267-4542289 AGAATTGAATAGTATTAACATGG + Intergenic
1063395310 10:5681736-5681758 ACAATTCAAAAGTATTGGCAGGG + Intergenic
1063862052 10:10321372-10321394 ACAGTAGAATGGTGTTGCCAGGG + Intergenic
1067187928 10:44045737-44045759 ACAAAAGAATGGTGTTTCCAGGG + Intergenic
1068372437 10:56134876-56134898 ACAGTGGAGTGGTGTTGCCAAGG + Intergenic
1069460118 10:68586674-68586696 GCAATTGAATATTGTTTCTATGG + Intronic
1071818785 10:89259410-89259432 AAAATTAAAAAGTGTTGGCAAGG + Intronic
1072865256 10:99053258-99053280 ACAATGGAAAAGTTTTGCAACGG - Intronic
1075609568 10:123841530-123841552 AAATTAGAATGGTGTTGCCAGGG - Intronic
1082126647 11:48439781-48439803 GCAATTAACTAGTGTTGGCAAGG - Intergenic
1085920612 11:80951074-80951096 TCAAATGGATAGTTTTGCCAGGG - Intergenic
1086910398 11:92465333-92465355 AAAATTGAATTGAGTTTCCAGGG + Intronic
1088341145 11:108768684-108768706 AAAAGTGAATAGTGTTCCAAGGG - Intronic
1090098087 11:123763777-123763799 AAAGTGGAATAGTGTTTCCAGGG + Intergenic
1091053358 11:132395323-132395345 AGAATTGAAGAGTTTTGCCAGGG + Intergenic
1093116474 12:15218047-15218069 AAAATTGAATTGTGTTGCATTGG - Intronic
1094557973 12:31521978-31522000 AGAATTGAAGAGGGTAGCCAAGG - Intronic
1101220183 12:102630841-102630863 GCATTTGAATAGAGTAGCCATGG - Intergenic
1101967533 12:109291650-109291672 ACAACTGAGCAGTGTGGCCATGG - Intronic
1102008270 12:109602562-109602584 ACAAATGAATTTTGATGCCAAGG + Intergenic
1105592593 13:21808248-21808270 AAAATTGACAAGTGTTGGCAAGG + Intergenic
1106825426 13:33515102-33515124 ACATTTGAATAATTTGGCCAAGG - Intergenic
1110095849 13:71519435-71519457 ACAATTTAATAATGTAGACATGG - Intronic
1111401678 13:87745258-87745280 ACAATTGAATTGATTTGGCAAGG - Intergenic
1111510976 13:89262367-89262389 ACAATTAAATAAATTTGCCAGGG - Intergenic
1111619301 13:90703251-90703273 AAAAATAAAAAGTGTTGCCAAGG - Intergenic
1112880641 13:104102650-104102672 ACAATGGAATAGTAGTGACATGG - Intergenic
1115051187 14:29065488-29065510 ACAACTGAAGATTGTTGTCATGG + Intergenic
1116146462 14:41076763-41076785 ATAACTGAATTTTGTTGCCAAGG - Intergenic
1118225906 14:63899045-63899067 ACAGTAGAATGGTGCTGCCAGGG - Intronic
1119271459 14:73308797-73308819 CCAAATGAATAGTGTTTCAAAGG + Intronic
1119283170 14:73428120-73428142 ACAATTGAAAAGTTTTGAAAAGG + Intronic
1120202926 14:81557380-81557402 TCCAAAGAATAGTGTTGCCATGG + Intergenic
1122243010 14:100381665-100381687 ACCACTGAATGGTGTTGACAGGG - Exonic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1125078126 15:35644355-35644377 AAAGTAGAATAATGTTGCCAGGG + Intergenic
1125343969 15:38700376-38700398 ACATTTGAATAGACTTGTCAAGG + Intergenic
1127174535 15:56339433-56339455 ACAAATGAATGGTTTTGCCCAGG - Intronic
1131765714 15:95673676-95673698 ACAGTTGAATAATGTTGCTGTGG - Intergenic
1134421021 16:14089785-14089807 ATCATGGAAAAGTGTTGCCAAGG - Intronic
1138046849 16:53733771-53733793 ATAACTCAAGAGTGTTGCCATGG - Intronic
1140610215 16:76589705-76589727 ACAATTGAAAAATTTTGCTACGG + Intronic
1146802996 17:35842377-35842399 ACACTTTAATGATGTTGCCATGG - Exonic
1148501874 17:48097833-48097855 AAAATTGAATAGCCTTTCCAAGG - Intronic
1150706376 17:67490998-67491020 ACAGTGGAATTGTGATGCCAGGG + Intronic
1154002922 18:10499593-10499615 GCAATTGAATAGTGATGATAAGG + Intergenic
1155089230 18:22489950-22489972 AGAATGCATTAGTGTTGCCATGG - Intergenic
1155128821 18:22909300-22909322 TCTTTTGATTAGTGTTGCCATGG + Intronic
1155241772 18:23870802-23870824 AAATTAGAATAGTGGTGCCAGGG + Intronic
1156173052 18:34509269-34509291 ACATCTGATTAGTATTGCCATGG - Intronic
1159382253 18:67675412-67675434 ACAGTTGCATAGTGTTACCAGGG + Intergenic
1159498241 18:69233915-69233937 AAAATTGAAGACTTTTGCCAGGG + Intergenic
1163135231 19:15306025-15306047 AGAATTGAATAGAGTTACTACGG + Intronic
1164824194 19:31272477-31272499 AAAATAGAATAGAGATGCCAGGG + Intergenic
1168255675 19:55163584-55163606 AAAATTGTATAGTATTGCCAGGG - Intronic
928262861 2:29783320-29783342 ATAATTGAACATTGTTGCCTAGG - Intronic
930963882 2:57295830-57295852 ACTATTGAACACTGTTGCAAGGG + Intergenic
933535437 2:83566909-83566931 ACAATGGAAGAGTGTTGACAGGG - Intergenic
936582405 2:113713068-113713090 GCATTTGAATACTGTAGCCATGG - Exonic
936858971 2:116993363-116993385 ACAGTTGGATAGTGTTACCCTGG + Intergenic
936959992 2:118062848-118062870 ACCATTGTATAGCTTTGCCAAGG - Intergenic
938823911 2:134985677-134985699 ACAATTAAATAGTTTTTTCAAGG - Intronic
940543501 2:155052707-155052729 AAAATGGATTAGTTTTGCCATGG + Intergenic
941453379 2:165687025-165687047 AGAGCTGAATTGTGTTGCCAAGG - Exonic
942725285 2:178999805-178999827 ACTTCTGAATAGTGTTGCGAAGG - Intronic
945035918 2:205703914-205703936 ACAATTAAATAGTATTGCTCAGG - Intronic
945557856 2:211301400-211301422 TAAATTGAATAGTTTTGACAAGG + Intergenic
945656203 2:212627216-212627238 ACTTTTGGATAGGGTTGCCAAGG + Intergenic
1168857730 20:1020562-1020584 GTAATTGAAAACTGTTGCCAGGG - Intergenic
1170864933 20:20145693-20145715 ACTTTTGATTAGTGTTGGCATGG - Intronic
1171790471 20:29518508-29518530 ACAATTTGATAGTGTTGAGATGG - Intergenic
1175969487 20:62677107-62677129 AAAATGGACTAGTGGTGCCAGGG + Intronic
1179120806 21:38544038-38544060 ACTATTCAATAGTGTTCCCCAGG - Intronic
1179120809 21:38544048-38544070 ACTATTGAATAGTGTGGTCAGGG + Intronic
1184542429 22:45135714-45135736 ACAAGTGAATATTGTTGGCCAGG - Intergenic
949470963 3:4396139-4396161 AAAGTTGAATAGTGTGCCCAAGG + Intronic
950209475 3:11110361-11110383 ATAATTGACAAGTGCTGCCAAGG - Intergenic
951446419 3:22785770-22785792 ACAATTTTATATTGTTTCCAAGG + Intergenic
952055497 3:29440125-29440147 ACAATTTAAATGTGTTTCCAGGG - Intronic
952245884 3:31592139-31592161 AAATTTGAATGGTGGTGCCAGGG - Intronic
953128983 3:40119564-40119586 ATAATTGAATAGATATGCCACGG - Intronic
956751878 3:72350001-72350023 CCAATTGCATGGTGTTCCCAAGG - Intergenic
957263680 3:77932547-77932569 ACAATAGGATAGTGTGGCCATGG - Intergenic
957590003 3:82184552-82184574 ACAATTTATTAGTGCTGTCACGG + Intergenic
962068838 3:132012061-132012083 AAAATTGAATAGTTGTGACAGGG - Intronic
967122867 3:186399347-186399369 GCAATTTAATGGGGTTGCCATGG - Intergenic
967770833 3:193331885-193331907 ACAATTAAATAATTTTCCCAAGG + Intronic
967850390 3:194078113-194078135 ACATTTTAATATTGTTCCCAAGG + Intergenic
969106997 4:4814611-4814633 AATACTGAATAGTGTTGCCTAGG - Intergenic
970175851 4:13338679-13338701 ACCATTGTATAGTGTCCCCATGG + Intergenic
970804307 4:20012632-20012654 TCATTTGGATAGTGTTTCCATGG + Intergenic
972052309 4:34753154-34753176 AGACTAGAATGGTGTTGCCAGGG + Intergenic
972618899 4:40726792-40726814 AAAAGTAAATAGTGTTGCCAGGG - Intergenic
974211608 4:58783907-58783929 ACAAGTGGATAGAGTTGGCAGGG - Intergenic
975606091 4:76155895-76155917 AGAATTGAATAGTTGTGACAGGG + Intergenic
976021198 4:80629278-80629300 AAAGTAGAATAGTGTTACCAGGG + Intronic
978938453 4:114408663-114408685 AGTATTGTAGAGTGTTGCCATGG + Intergenic
990075004 5:51833173-51833195 ACAATTAAATACTGTGGCCAGGG - Intergenic
991372712 5:65936222-65936244 AAAAATGAATCTTGTTGCCAAGG + Intronic
993870111 5:93242568-93242590 ACAGTTAAATAATGTTCCCAAGG - Intergenic
994206600 5:97043004-97043026 AGAAGTGAAGGGTGTTGCCAGGG + Intergenic
995292493 5:110473421-110473443 ACAAAAGATAAGTGTTGCCAAGG + Intronic
995846480 5:116499373-116499395 ACCACTGAATTGTGTTGCCATGG + Intronic
996264942 5:121527936-121527958 ACTACTGAATAGTGTTACTATGG - Intergenic
996930065 5:128875630-128875652 AAAGTTGAATGGTGTTGTCAGGG + Intronic
998055481 5:139073046-139073068 ACAAAAGAAAAGTGTTGGCAAGG + Intronic
1000149424 5:158485194-158485216 ACAATTGCAGATTATTGCCATGG - Intergenic
1006163603 6:32051893-32051915 AGAGTAGAATGGTGTTGCCAGGG + Intronic
1008878470 6:56355214-56355236 GCTATGGAATAGTGCTGCCAAGG + Intronic
1009023250 6:57968042-57968064 GCAATTAACTAGTGTTACCAAGG - Intergenic
1009198818 6:60719576-60719598 GCAATTAACTAGTGTTGCCAAGG - Intergenic
1016051055 6:139530524-139530546 ACCATTCAAGAGTGATGCCAGGG + Intergenic
1021255726 7:18390241-18390263 ACAATTCAGTAGTGTTTGCATGG + Intronic
1022852811 7:34282502-34282524 ACAATGGAAAAATGTTTCCAGGG - Intergenic
1025109770 7:56204256-56204278 ACAAAAGAATAGAGGTGCCAGGG + Intergenic
1026308138 7:69160363-69160385 ACAAAAGAATAGAGGTGCCAGGG - Intergenic
1026641453 7:72129823-72129845 ACAATGGAAGAGTATTGCTATGG + Intronic
1028387695 7:90276123-90276145 ACTTGTGAATATTGTTGCCAAGG - Intronic
1030186250 7:106765047-106765069 ACATCTTAATAGTGTTGCAATGG - Intergenic
1033072623 7:138218303-138218325 ACAGTTGAGTAGGGTTGCTAGGG - Intergenic
1033230093 7:139590290-139590312 ACAATTGCATTATGTTGTCATGG + Intronic
1035415823 7:158684884-158684906 ACACTTGATTTGTATTGCCAAGG - Intronic
1036057502 8:5273382-5273404 AAAATTCAAAAGTTTTGCCATGG - Intergenic
1038898543 8:31815265-31815287 ACAGTAGAATAGTGGTGCCCGGG - Intronic
1040738948 8:50548108-50548130 ACAATTTATTACTTTTGCCAGGG + Intronic
1043197259 8:77312065-77312087 ATAATAGAATGGTATTGCCAGGG - Intergenic
1043341119 8:79240864-79240886 ACAATTTTATAGATTTGCCATGG - Intergenic
1045708515 8:104956344-104956366 ACTACAGAGTAGTGTTGCCATGG - Intronic
1047036642 8:120946915-120946937 CCAACTGAATAGTGTCGACATGG - Intergenic
1047147098 8:122214695-122214717 AAAATTCAGTTGTGTTGCCATGG - Intergenic
1051086990 9:13361416-13361438 ACCATTTAATAAAGTTGCCAAGG + Intergenic
1056026257 9:82498641-82498663 ACTGTTGAATAGTATTGCAAAGG + Intergenic
1059763050 9:117357483-117357505 ACATTTGAATGGAGTTTCCATGG + Intronic
1059814385 9:117895334-117895356 TCAATTGAATTGTTTTGCCATGG + Intergenic
1188429519 X:30090320-30090342 AAAATTAAAAAGTGTTGGCAAGG - Intergenic
1195409389 X:104553206-104553228 ACAATCACACAGTGTTGCCAGGG + Intergenic
1195609046 X:106843410-106843432 ACAATTAAGAAGTGTTGTCAAGG - Intronic
1198401948 X:136277279-136277301 ACATGTGAATAGTGTAGTCAGGG + Intergenic
1201518852 Y:14850051-14850073 ACATTGGAATAGTATTTCCAGGG - Intergenic