ID: 917484658

View in Genome Browser
Species Human (GRCh38)
Location 1:175444751-175444773
Sequence GGTATCCAACAGCAGCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917484658_917484665 15 Left 917484658 1:175444751-175444773 CCAACAGGCTGCTGTTGGATACC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 917484665 1:175444789-175444811 TGGGGAGGTGATGTTTCATCCGG 0: 1
1: 0
2: 0
3: 26
4: 241
917484658_917484660 -4 Left 917484658 1:175444751-175444773 CCAACAGGCTGCTGTTGGATACC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 917484660 1:175444770-175444792 TACCACTGCAGAGCCTTGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 135
917484658_917484663 0 Left 917484658 1:175444751-175444773 CCAACAGGCTGCTGTTGGATACC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 917484663 1:175444774-175444796 ACTGCAGAGCCTTGCTGGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 245
917484658_917484661 -3 Left 917484658 1:175444751-175444773 CCAACAGGCTGCTGTTGGATACC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 917484661 1:175444771-175444793 ACCACTGCAGAGCCTTGCTGGGG 0: 1
1: 0
2: 0
3: 18
4: 211
917484658_917484666 16 Left 917484658 1:175444751-175444773 CCAACAGGCTGCTGTTGGATACC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 917484666 1:175444790-175444812 GGGGAGGTGATGTTTCATCCGGG 0: 1
1: 0
2: 4
3: 17
4: 232
917484658_917484659 -5 Left 917484658 1:175444751-175444773 CCAACAGGCTGCTGTTGGATACC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 917484659 1:175444769-175444791 ATACCACTGCAGAGCCTTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917484658 Original CRISPR GGTATCCAACAGCAGCCTGT TGG (reversed) Intronic