ID: 917484661

View in Genome Browser
Species Human (GRCh38)
Location 1:175444771-175444793
Sequence ACCACTGCAGAGCCTTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917484658_917484661 -3 Left 917484658 1:175444751-175444773 CCAACAGGCTGCTGTTGGATACC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 917484661 1:175444771-175444793 ACCACTGCAGAGCCTTGCTGGGG 0: 1
1: 0
2: 0
3: 18
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917484661 Original CRISPR ACCACTGCAGAGCCTTGCTG GGG Intronic