ID: 917484661

View in Genome Browser
Species Human (GRCh38)
Location 1:175444771-175444793
Sequence ACCACTGCAGAGCCTTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917484658_917484661 -3 Left 917484658 1:175444751-175444773 CCAACAGGCTGCTGTTGGATACC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 917484661 1:175444771-175444793 ACCACTGCAGAGCCTTGCTGGGG 0: 1
1: 0
2: 0
3: 18
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917484661 Original CRISPR ACCACTGCAGAGCCTTGCTG GGG Intronic
901027605 1:6286894-6286916 ACCGCTGGAGAGGCTTGCAGGGG + Intronic
901454243 1:9354123-9354145 CCCACTGCAGAGCCTGGCCCTGG + Intronic
901528174 1:9836967-9836989 CCCTCTGCAGAGCCTTGCAACGG - Intergenic
903909979 1:26716604-26716626 AAAACAGAAGAGCCTTGCTGAGG - Intronic
905016418 1:34781688-34781710 ACCACTGCTGAGCCCAGCTCCGG + Exonic
905381151 1:37562447-37562469 TCCACTGGAGAGCCAGGCTGAGG - Intronic
906536256 1:46552451-46552473 ACCACTGCCCAGCCTTGGGGTGG - Intergenic
907102653 1:51850894-51850916 ACCACTGCAAAATCTTGGTGTGG + Intronic
908333935 1:63100506-63100528 GCCCCTGCAGAGCCATGCCGAGG - Intergenic
910792860 1:91069225-91069247 AAGACTGCAGAGCAGTGCTGAGG + Intergenic
915363922 1:155303112-155303134 GCTACTGCACATCCTTGCTGTGG - Intergenic
917484661 1:175444771-175444793 ACCACTGCAGAGCCTTGCTGGGG + Intronic
918072569 1:181143696-181143718 ACCACTTCAGAGGCAGGCTGGGG - Intergenic
918322041 1:183373553-183373575 ATAAGTGCAGACCCTTGCTGTGG - Intronic
922698042 1:227741520-227741542 ACCACTACACAGCTCTGCTGGGG - Intronic
924406531 1:243753695-243753717 ACAACTGGAGAGTCTTGATGAGG - Intronic
1062851522 10:746400-746422 ACCACTGCCCAGGCTTGCTTAGG + Intergenic
1063754848 10:8995678-8995700 GGCATTGGAGAGCCTTGCTGTGG + Intergenic
1064023922 10:11831611-11831633 ACCAGAGCAGAGTCTAGCTGGGG - Intronic
1064418497 10:15169843-15169865 ACCACTGCGGAGACTTCCGGTGG - Intergenic
1066137935 10:32469619-32469641 ACCAGTGCAGAGCCTCCCTTAGG - Intronic
1068225436 10:54102281-54102303 GCCACTGCAGCACATTGCTGGGG - Intronic
1071602330 10:86964452-86964474 TCCACTGCAGAGGCTGGATGGGG - Intronic
1073176593 10:101560852-101560874 GGCACACCAGAGCCTTGCTGTGG + Intergenic
1073319228 10:102604192-102604214 AGCCCTGCAGAGTCTGGCTGGGG - Intronic
1074689646 10:115992615-115992637 TCAACTGCAGACACTTGCTGAGG + Intergenic
1075649206 10:124116647-124116669 ACCACTGTAGAGCATTGGGGTGG + Intergenic
1076132091 10:128020474-128020496 ACAACTGCTGAGTCTTACTGTGG + Intronic
1076657084 10:132031883-132031905 ACCACTACTGTGCCTGGCTGAGG + Intergenic
1077220459 11:1413322-1413344 ACCCCTGCAGCCCCTTGCAGGGG + Intronic
1077489193 11:2852721-2852743 TCCACTGTGGAGCCTTGGTGAGG + Intergenic
1078538956 11:12198374-12198396 ACCCCTGCAGGGCAGTGCTGGGG - Intronic
1079088168 11:17461887-17461909 ACAACCCCAGATCCTTGCTGGGG - Intronic
1080516490 11:33026515-33026537 ACCACTGCACAGTTTAGCTGAGG - Intronic
1081494730 11:43597293-43597315 ACCACTCCAGACCTTTACTGTGG - Intronic
1081691820 11:45083498-45083520 TTCTCTGCAGATCCTTGCTGGGG + Intergenic
1082151935 11:48750246-48750268 ACCACTGCCCAGGCTTGCTTAGG - Intergenic
1082629168 11:55520760-55520782 ACCATTGCCTAGCCTTGCTTAGG - Intergenic
1083026924 11:59559048-59559070 ACCACGGTAGAGCATTCCTGTGG + Intergenic
1084539374 11:69776478-69776500 ACCCCTTCAGAACCCTGCTGGGG + Intergenic
1088430675 11:109755241-109755263 ACCACTGGAGTACCTTGATGTGG + Intergenic
1089376695 11:117999771-117999793 AGCCCTGCAGGGCCTGGCTGGGG - Exonic
1090189415 11:124758733-124758755 ACAACTGCAGAGGCTGGCGGTGG - Intronic
1090605938 11:128422933-128422955 ACCACTGCTGAGCCCTCCTGTGG - Intergenic
1091649849 12:2301809-2301831 ACCACTGCAGGGCCAGGCTGGGG - Intronic
1092029119 12:5269136-5269158 CCCACTGCAGAGCCTCGCCTTGG - Intergenic
1093018855 12:14184537-14184559 ACCACTGGAGATTCTAGCTGGGG + Intergenic
1093180925 12:15966210-15966232 CTCACTCCAGAGCGTTGCTGCGG - Intronic
1093332103 12:17855989-17856011 ACCATTGCCCAGGCTTGCTGAGG + Intergenic
1095066741 12:37787358-37787380 ACCATTGCAGAGACTTGATTCGG + Intergenic
1096148037 12:49292953-49292975 ACAGCTCCAGAGCCCTGCTGTGG + Intergenic
1098186353 12:67900656-67900678 ACCATTGCCCAGGCTTGCTGAGG + Intergenic
1100140484 12:91612719-91612741 AGCAATGCAAAGCCTTTCTGGGG - Intergenic
1100270442 12:93019638-93019660 GACAGTGCAGAGCCATGCTGAGG + Intergenic
1101636922 12:106551600-106551622 ACCACTGCTGAGGCTTGACGAGG - Intronic
1103894718 12:124265301-124265323 ACCACTGCAGAGTCAGGGTGGGG - Intronic
1104689893 12:130818001-130818023 CCCACTGCAGGGCCTTCCTGGGG - Intronic
1104831255 12:131753314-131753336 ACCACAGCAGAGACTAGCAGCGG + Exonic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1105934043 13:25081978-25082000 AACACTGTCAAGCCTTGCTGGGG - Intergenic
1106890699 13:34242416-34242438 ACAACCACAGAGACTTGCTGGGG - Intergenic
1109826657 13:67730240-67730262 ACCACTGCAGAGTCTAGCCTGGG + Intergenic
1111825685 13:93264188-93264210 ACCACTGCAGAAAATAGCTGTGG + Intronic
1113586155 13:111467606-111467628 ACCACTGCAGAGCCGTTCAGGGG + Intergenic
1113962189 13:114132344-114132366 CCCTCCGCAGATCCTTGCTGGGG - Intronic
1116864902 14:50024088-50024110 ACCCCTGCAGAGCTGAGCTGGGG - Intergenic
1117543852 14:56774680-56774702 ACCTCTGCAGGGCCTTCCTGGGG + Intergenic
1117999681 14:61511337-61511359 CCCACTGCAGAGCCTGCCTGGGG + Intronic
1119344466 14:73911233-73911255 ATCAGAGCAGAGGCTTGCTGAGG + Intronic
1119677333 14:76565694-76565716 ACCACTGCAGAGACTCTGTGTGG + Intergenic
1119677545 14:76567056-76567078 ACCACTGCAGAGACTCTGTGTGG - Intergenic
1122155199 14:99746586-99746608 ACCACTCCAGAGAGATGCTGGGG - Intronic
1123967582 15:25474351-25474373 AACACTGCAGATCCTTCCAGAGG - Intergenic
1128247341 15:66142109-66142131 ACCACTGTTCTGCCTTGCTGGGG - Intronic
1128334036 15:66774576-66774598 GCCACTGTGGAGCCCTGCTGGGG + Intronic
1128452772 15:67815816-67815838 ACCTATGCTGGGCCTTGCTGAGG + Intergenic
1128790165 15:70427454-70427476 AGGACTGCAGAGCAATGCTGGGG - Intergenic
1129173707 15:73823999-73824021 ACCACTGCCCAGCTCTGCTGTGG - Intergenic
1129461301 15:75701365-75701387 ACCAGTGCTGGGACTTGCTGTGG - Intronic
1130446045 15:84002995-84003017 GCCACTGCAGTGCCATGCAGTGG + Intronic
1134851381 16:17481728-17481750 ACCACCCCAGAGACTTGGTGGGG - Intergenic
1137248674 16:46727409-46727431 AGCCCTGAAGAGCCTTGCTTAGG - Intronic
1140480982 16:75262769-75262791 ACCACTGCTGGGGCTGGCTGGGG + Intronic
1140939358 16:79707134-79707156 AACCCTGCAGAGGCCTGCTGGGG + Intergenic
1141688230 16:85582339-85582361 TCCACTGCAGAAGCTGGCTGCGG + Intergenic
1141782693 16:86174496-86174518 GCCACGGCAGAGCATTGATGTGG - Intergenic
1142027630 16:87823042-87823064 ACCTCTGCAAAGGCTGGCTGGGG - Intergenic
1143447766 17:7019118-7019140 ACCTCGGCAGAGCCTTTGTGGGG + Intergenic
1145781238 17:27564875-27564897 ATCTCTGCAGACCCTTCCTGTGG - Intronic
1146475984 17:33163121-33163143 ACCACTGGATAGACTTGGTGGGG + Intronic
1146967442 17:37044905-37044927 ATCACTACAGAGCCCTGCTGGGG - Intronic
1149545596 17:57501236-57501258 ACCACTGCAGGGCCTTAGTCTGG + Intronic
1149581844 17:57756221-57756243 ACCACTGCCGAGCCTGACTTTGG + Intergenic
1151485034 17:74393743-74393765 ACCACTGGAGGCTCTTGCTGGGG - Intergenic
1152288407 17:79425310-79425332 CCCACTGCAGAGGGTTACTGCGG - Intronic
1152464318 17:80457224-80457246 TCCACTGCAGCGCGTTCCTGGGG - Intergenic
1152664263 17:81558255-81558277 CCCACTGCACCGCCTGGCTGAGG - Exonic
1152924764 17:83081703-83081725 ACACCTGCAGAGCCTGGCAGAGG + Intronic
1153641122 18:7158028-7158050 AGCACTGCAAAGCCCTGCTGGGG - Intergenic
1153727012 18:7966889-7966911 ACCATTGCCCAGGCTTGCTGAGG + Intronic
1155542504 18:26883174-26883196 CCAACTGCAGAGCCTTACTAAGG - Intergenic
1155635109 18:27943500-27943522 ACAACTACAGCACCTTGCTGGGG + Intergenic
1160107267 18:75989594-75989616 CCCACTGCATAGCCTAACTGGGG + Intergenic
1160260643 18:77291050-77291072 ACCACTGCTGAGGCTTGAGGAGG - Intergenic
1160385665 18:78494867-78494889 ACGACGGCAGCGCTTTGCTGTGG - Intergenic
1160415716 18:78709392-78709414 AGCACCTCCGAGCCTTGCTGTGG + Intergenic
1161393643 19:4033668-4033690 CCCACTGCTGTGTCTTGCTGGGG - Intronic
1163690461 19:18735756-18735778 AGCACTGGGGAGCCTTGCAGGGG - Intronic
1163863004 19:19752087-19752109 CCCACTCCAAAGCCTGGCTGAGG - Intergenic
1163866253 19:19775995-19776017 ACAACTTCAGAGCTTTGCAGGGG - Intergenic
1164935496 19:32207364-32207386 GTCACTGCTGAGCCTTGTTGTGG - Intergenic
1166852495 19:45767332-45767354 ACCACTGCAGAGAAGCGCTGGGG + Intronic
925153398 2:1632824-1632846 ACCTCAGCTGGGCCTTGCTGCGG + Exonic
927092504 2:19722735-19722757 AACACTGCGGAGCCTGGATGGGG + Intergenic
927218319 2:20682835-20682857 ACCACTGAGGTGCCTTGCTAAGG - Intergenic
927430928 2:23025618-23025640 ACCACCTCACAGGCTTGCTGGGG + Intergenic
927454877 2:23240808-23240830 ACCACTGCATTCACTTGCTGTGG + Intergenic
928161017 2:28924592-28924614 TACACTCCAGAGGCTTGCTGAGG + Intronic
928376982 2:30783366-30783388 GCTACTGCGGAGCCTGGCTGGGG + Intronic
930442444 2:51426073-51426095 AACTCTGCAGGGCATTGCTGTGG + Intergenic
932466452 2:71927284-71927306 ACCACTGAAGTGTCTTTCTGAGG + Intergenic
932481209 2:72040492-72040514 CCCACTGCAGAACCATGCTGTGG + Intergenic
937198110 2:120178250-120178272 AACACTGCAGAACCTATCTGAGG - Exonic
938053380 2:128195205-128195227 AGCAGTGCAGAGGCTAGCTGTGG + Exonic
938138185 2:128775994-128776016 CCCCCTGGAGAGCCTGGCTGGGG - Intergenic
1169122815 20:3107452-3107474 AGGACCTCAGAGCCTTGCTGTGG - Intergenic
1170797071 20:19557263-19557285 ACCACTGCACAGACATGCTGGGG - Intronic
1173774572 20:45693511-45693533 ACCATTGCACAGGCTTGCTTAGG - Intronic
1174409514 20:50325165-50325187 AACACTGCAGTTCCTTGATGTGG + Intergenic
1174689117 20:52485609-52485631 ACTACTGCAGAGGCTTGGTGAGG - Intergenic
1175690888 20:61065419-61065441 ACCCCTCCACTGCCTTGCTGGGG - Intergenic
1176092390 20:63325054-63325076 AGCTCTGCAGACCCCTGCTGTGG + Intronic
1179160387 21:38891422-38891444 ACCACTCCAGGGTGTTGCTGAGG + Intergenic
1179160404 21:38891600-38891622 ACCACTGCAGAAATTTGCAGAGG - Intergenic
1179902377 21:44400865-44400887 ACCTCCTCAGAGGCTTGCTGGGG + Intronic
1181938158 22:26453760-26453782 ACCACTGCAGAGCTTATGTGAGG - Intronic
1182534056 22:30986864-30986886 AGCACTGCAGCGCCTTGGTCAGG + Intergenic
1183041131 22:35178701-35178723 ACCTCAGCAGAGCCTTGCGCCGG - Intergenic
1184415246 22:44348415-44348437 ACCTCTGCAGAGCCAAGCTGAGG + Intergenic
1185056945 22:48586099-48586121 GCCTCTGCAGAGGCTTCCTGAGG + Intronic
1185340965 22:50290916-50290938 AGCACTTGAGAGCCTTTCTGGGG - Intronic
950250007 3:11457018-11457040 AACCCTGCAAAGCCTTGCAGAGG - Intronic
950321503 3:12059097-12059119 ACCACTGCAAAACCTTGGTGTGG - Intronic
950576960 3:13837797-13837819 ACCTGGGCAGGGCCTTGCTGGGG - Intronic
950915220 3:16637736-16637758 ACCACAGCAGAGCCATGCATAGG + Intronic
952755905 3:36866546-36866568 CACACTCCAGAGCCTTCCTGTGG - Intronic
954456769 3:50603852-50603874 ACCTCTTCAGAGCCTAGCAGGGG - Intergenic
955778037 3:62454697-62454719 ACCACTGCAGAGCTTCACAGAGG + Intronic
956686229 3:71830677-71830699 CCCAGTGCAGAGCATTTCTGTGG - Intergenic
956970458 3:74517375-74517397 CCCACTGCAAAGCCTTGGTGTGG + Intronic
957085770 3:75675259-75675281 ACCAGTGCACTACCTTGCTGTGG + Intergenic
960618358 3:119616319-119616341 TCCTCTACAGAGCCTTGCTGTGG + Intronic
961360048 3:126361287-126361309 GCCAGTGCCGAGCATTGCTGCGG + Intergenic
961519725 3:127460028-127460050 AGGGCTGCAGAGCCTGGCTGTGG - Intergenic
961807354 3:129499002-129499024 ACCACTTCAGAGGTATGCTGAGG + Intronic
963870683 3:150410368-150410390 CCCACTGCAGGGCCCGGCTGCGG - Exonic
965818939 3:172665669-172665691 ACCATTGCTGAGGCTTGATGAGG - Intronic
967700936 3:192591570-192591592 CCCACTGTAGGGCCTTGTTGAGG - Intronic
967894823 3:194387389-194387411 TCCACTGCAGGGCCTACCTGAGG - Intergenic
969131516 4:4994114-4994136 ACCCCCCAAGAGCCTTGCTGAGG + Intergenic
969141420 4:5077543-5077565 CCCATTGCACAGCCTTCCTGTGG + Intronic
969164943 4:5299361-5299383 ACTACTGCAGCACGTTGCTGGGG - Intronic
969512127 4:7624195-7624217 ATCACTGCAGACCCTGACTGGGG + Intronic
975382351 4:73716147-73716169 ACCACTGTGATGCCTTGCTGTGG + Intergenic
978455623 4:108887297-108887319 TCCATTGCAGAACCATGCTGGGG - Intronic
978699084 4:111621342-111621364 ACCCTTGCAAAGACTTGCTGTGG - Intergenic
978818300 4:112934283-112934305 CCAACTGCAGAGCCGTGCTAAGG + Intronic
980341004 4:131547387-131547409 ACCACTGCACTCCCTTCCTGGGG - Intergenic
982116854 4:152105200-152105222 CCCTCTGCAGAGCCAGGCTGGGG + Intergenic
986009523 5:3699778-3699800 TCAACTCCAGAGCCTTGCAGTGG + Intergenic
986892532 5:12326976-12326998 ACCACTACACAACCTTCCTGGGG + Intergenic
993524262 5:88945014-88945036 ACCACTCCAGAGCTTTGATCTGG + Intergenic
994197243 5:96935122-96935144 AGCGCCGCGGAGCCTTGCTGCGG + Intronic
998193338 5:140044776-140044798 GCCCATGAAGAGCCTTGCTGAGG - Intergenic
999958640 5:156729791-156729813 TTCACTTCAGGGCCTTGCTGAGG - Intronic
1001847459 5:174934877-174934899 AGCCCTGCAGAGGGTTGCTGTGG - Intergenic
1002096900 5:176836730-176836752 ACCTCTCCTGAGCTTTGCTGGGG - Intronic
1002473595 5:179451891-179451913 GCCACTGCAGGGCAGTGCTGGGG - Intergenic
1002480506 5:179497860-179497882 GCCACTGCAGGGCAGTGCTGGGG + Intergenic
1004074909 6:12336232-12336254 TCCAGGGCAGAGCCTGGCTGAGG + Intergenic
1004515980 6:16322654-16322676 CCCTCTGCAGTGCCTTCCTGAGG - Intronic
1004900309 6:20187457-20187479 ACCACAGCAGAGACTTGCCCTGG - Intronic
1005056813 6:21737029-21737051 ACCACTGACGTGCCTTGCAGGGG - Intergenic
1006406921 6:33850860-33850882 ACCTCTGGAGACCCTTCCTGCGG + Intergenic
1007055305 6:38877219-38877241 ACCATGGCAGAGCCTTGGTTAGG + Intronic
1016021366 6:139239400-139239422 AGCACTGCAGAGCCAGGCAGAGG + Intergenic
1017956623 6:159183603-159183625 AGCACTGCAGAGCCCAGCTCTGG - Intronic
1018804445 6:167248119-167248141 TCCACTGAAAAGCCCTGCTGGGG - Intergenic
1019058678 6:169240862-169240884 ACCAGTGCAGAGCAACGCTGGGG + Intronic
1020153780 7:5704960-5704982 TCCACTGCAAAACGTTGCTGAGG + Intronic
1023713126 7:43015659-43015681 ACATCAGCAGAGGCTTGCTGAGG - Intergenic
1023995287 7:45155937-45155959 CCCACTGCAGAGCCAGGGTGGGG + Intergenic
1024345575 7:48310171-48310193 ACCACAGCAGAGTCCTGCAGAGG - Intronic
1030024407 7:105308947-105308969 ACCACTGCAGAATCCTGCTTAGG + Intronic
1032335477 7:131020872-131020894 GGCACTGCTGAGCCTTGCAGAGG + Intergenic
1032553479 7:132807198-132807220 ACCACTGCAGGGCCAGGCAGCGG - Intronic
1035320204 7:158024106-158024128 ACTACCCCAGAGCTTTGCTGGGG - Intronic
1035382032 7:158446464-158446486 TCCATTGCAGAGCCTGGGTGGGG - Intronic
1037718741 8:21422716-21422738 CACACTGCAGCTCCTTGCTGTGG + Intergenic
1039566847 8:38558047-38558069 ACCACTGCAGAGCCTGGGGGAGG - Intergenic
1040582034 8:48705948-48705970 ACCACCGCAGAGGGATGCTGAGG + Intergenic
1041032401 8:53751119-53751141 ACCAATGCAGAGTCATGCAGTGG - Intronic
1042711374 8:71720990-71721012 ACCACTTCAGAGCCTAGCCCAGG + Intergenic
1042957232 8:74264078-74264100 ACCTGTGCTGAGCCTTGCAGAGG - Intronic
1044480540 8:92682181-92682203 GGGACTGGAGAGCCTTGCTGCGG - Intergenic
1044486356 8:92759070-92759092 AGCAGTGCACACCCTTGCTGCGG - Intergenic
1044724471 8:95181738-95181760 CCCATTGCAATGCCTTGCTGGGG - Intergenic
1045066061 8:98445803-98445825 ATGTCTGCAGAGGCTTGCTGAGG - Intronic
1046014483 8:108589329-108589351 ACCACTGCTGAGCCTTGAATAGG + Intergenic
1048170051 8:132097571-132097593 CCCAGTGCAGGGCCTTGCAGAGG + Intronic
1048493299 8:134914208-134914230 ACCACTCCAGTCTCTTGCTGTGG + Intergenic
1048998522 8:139809547-139809569 CCCACAGCAGGGCCTTTCTGTGG + Intronic
1050918335 9:11165954-11165976 ACCTCTGCAAAACCTTGGTGTGG - Intergenic
1051434647 9:17018158-17018180 ACCCCTGCAGTCCCTGGCTGTGG - Intergenic
1052407820 9:28084783-28084805 AGCACTGCTGGGCCTTACTGAGG + Intronic
1052762071 9:32602779-32602801 GCCACTGCAGACCCTTGCTAAGG - Intergenic
1055318067 9:75053994-75054016 TCCACTGCAGCGGCTGGCTGTGG + Intergenic
1056931740 9:90883447-90883469 ACCACTGCTGAGGGCTGCTGTGG + Intronic
1057704778 9:97388787-97388809 ACCACGGCTGGGCCTGGCTGGGG - Intergenic
1057826575 9:98376762-98376784 AGTACAGCAGAGCCTTTCTGGGG + Intronic
1060906156 9:127307895-127307917 ACCACTGTGGAGTCTGGCTGAGG + Intronic
1061134822 9:128727710-128727732 GCTACAGCAGAGCCTTGATGTGG + Intergenic
1189338516 X:40186459-40186481 ACCACTGCACAGGCTGGGTGCGG - Intergenic
1191674016 X:63776223-63776245 ACCATGGCAGTGCCTTGGTGAGG - Intronic
1192695892 X:73415736-73415758 CCCAATTCAGAGCCTTGTTGAGG - Intergenic
1192907466 X:75566834-75566856 ACCACTGCCCAGGCTTGCTTAGG - Intergenic
1195667991 X:107448194-107448216 TCCACTGCTGAGCCCAGCTGTGG + Intergenic
1196037703 X:111164924-111164946 ACCTCTGCAGAGCCTCCCTGTGG - Intronic
1196845834 X:119896297-119896319 ACCACTGCAAGTCCTTTCTGTGG - Intronic
1199868131 X:151872676-151872698 ACCAGTGCAGAGCCCAGATGGGG + Intergenic