ID: 917487579

View in Genome Browser
Species Human (GRCh38)
Location 1:175468852-175468874
Sequence ATTTCTGAAGGGCTCTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917487576_917487579 21 Left 917487576 1:175468808-175468830 CCTGGTAGTCAGGATGGGGACTT 0: 1
1: 0
2: 0
3: 7
4: 94
Right 917487579 1:175468852-175468874 ATTTCTGAAGGGCTCTCATAAGG 0: 1
1: 0
2: 1
3: 18
4: 153
917487574_917487579 25 Left 917487574 1:175468804-175468826 CCAGCCTGGTAGTCAGGATGGGG 0: 1
1: 0
2: 1
3: 19
4: 218
Right 917487579 1:175468852-175468874 ATTTCTGAAGGGCTCTCATAAGG 0: 1
1: 0
2: 1
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917487579 Original CRISPR ATTTCTGAAGGGCTCTCATA AGG Intronic
901068830 1:6507383-6507405 ATTTCTGAAGGGCTGCCCCATGG - Intronic
903939564 1:26920174-26920196 ATTTTTTAAAGGCTCTGATATGG - Intronic
904891940 1:33785856-33785878 ATATCTGAAGGGCTTTCATGTGG - Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
909012469 1:70350464-70350486 ATATCTAAAGGGCTATCATGTGG + Intronic
909091600 1:71232851-71232873 ATTTCTAATGTGCTCTAATAAGG + Intergenic
909154092 1:72048642-72048664 ATTTCTCTAGGGATCTAATAAGG + Intronic
912554827 1:110508405-110508427 AGCTCTGAAGGTCTCTCAGAAGG - Intergenic
913355023 1:117911039-117911061 ATATCTGAAGGAATCTCATTTGG - Intronic
916192153 1:162190221-162190243 GTATCTGAAGGGCTATCATGGGG - Intronic
916788523 1:168104422-168104444 ATTACTGACGGGCGCTCATCTGG - Intronic
917487579 1:175468852-175468874 ATTTCTGAAGGGCTCTCATAAGG + Intronic
922547724 1:226471153-226471175 CTTTCTGCAGGGCTCTTAGAGGG + Intergenic
922920524 1:229298685-229298707 CTTTCTGATGGGCTGTCATTTGG + Intronic
924091901 1:240509932-240509954 ATATTTGAAGGGCTGTCATGTGG + Intronic
924669954 1:246114114-246114136 ATTTCAGATGGGCTCTGACAGGG + Intronic
1063374708 10:5547261-5547283 ATTTCTGGGGGGCTCTCATGGGG - Intergenic
1065856427 10:29834286-29834308 ATATTTGAAGGGCTGTCACAGGG + Intergenic
1065875369 10:29993289-29993311 GTGCCTGAAGGGCTCACATAAGG - Intergenic
1065926973 10:30443391-30443413 ATTTTGGAAGGACTGTCATAAGG - Intronic
1068605215 10:58997839-58997861 ACTTCTGAAGGGCTCTGCTTTGG - Intergenic
1070617558 10:77980546-77980568 ATTTCTGAAGAGATTTCTTATGG + Intronic
1070665070 10:78336979-78337001 ATCTCTGAATGGCTGTCATAAGG + Intergenic
1072767713 10:98109226-98109248 ATGTTGGAAGGGCTGTCATATGG - Intergenic
1072850281 10:98883086-98883108 AGCTCTGAAGGGCTATCATATGG + Intronic
1073730985 10:106287412-106287434 ATTTCTGAAGGGCTAGCATTTGG - Intergenic
1074031633 10:109694865-109694887 ATATCTGAAGAGCTGTCAAATGG + Intergenic
1074784355 10:116826009-116826031 ATGTGTGAAGGGCTGTCACATGG + Intergenic
1078304055 11:10164982-10165004 AACTCTGAAGGTCCCTCATATGG + Intronic
1080007751 11:27427804-27427826 TTTTCCCAAGGGCTCTAATAAGG - Intronic
1081001092 11:37672933-37672955 ATTTTTGAAGGACTTTCATTTGG - Intergenic
1082180975 11:49119247-49119269 ATTTCTGCATGGCTCACCTAAGG - Intergenic
1086035262 11:82406994-82407016 GTATTTGAAGGGCTGTCATAAGG - Intergenic
1086414792 11:86577785-86577807 GTTTCTAAAATGCTCTCATATGG + Intronic
1086684518 11:89715627-89715649 ATTTCTGCATGGCTCACCTAGGG + Intronic
1086737701 11:90327596-90327618 ATTTCTGAAGGGAACTAATTAGG + Intergenic
1089073984 11:115722331-115722353 ATATTTGAAGAGCTGTCATATGG - Intergenic
1089501787 11:118936382-118936404 ATACCTGAAGGGCTATCATGGGG - Intronic
1092663207 12:10763033-10763055 ATATCTGAAGGGCAGTCTTAGGG + Intergenic
1093115669 12:15207789-15207811 TTTTGTGAAGGGCTGTCATAAGG + Intronic
1093897479 12:24591017-24591039 ATATCTGAAGGGCTATTAAATGG - Intergenic
1098814644 12:75143074-75143096 ATTTCTAAAGGCCTCTGAGACGG - Intronic
1098968826 12:76826183-76826205 GTTTGTGAAGGGCTCTTACATGG + Intronic
1101518358 12:105458797-105458819 CTGTCTCAAGGGATCTCATAAGG + Intergenic
1106769913 13:32952039-32952061 AGTTCTCAGGGCCTCTCATAGGG - Intergenic
1110084875 13:71365189-71365211 CATTCTGATGGGCTCTCAGATGG - Intergenic
1112878084 13:104070268-104070290 ATTTTTGACAGGCTGTCATAGGG + Intergenic
1118382258 14:65227179-65227201 ATTTCTAAAGAGCTCTCAGCAGG + Intergenic
1118650279 14:67884247-67884269 ATTGCTGAAGGCCTCACAAAAGG - Intronic
1120657933 14:87217860-87217882 ATTTCTGATGGGCTCGTATATGG + Intergenic
1124356863 15:29002096-29002118 ACTTCTGAAGGCCTTTTATATGG - Intronic
1125339474 15:38660759-38660781 ATTTCTGAATTGCTATCTTAGGG - Intergenic
1125575468 15:40752388-40752410 ATTCCTGAAGGGCCCTGGTATGG - Intronic
1126224171 15:46250786-46250808 TTTTCTGAAGGGTTTTTATATGG - Intergenic
1126955125 15:53925221-53925243 ATTTCAGATAGTCTCTCATAGGG + Intergenic
1127534529 15:59877804-59877826 ATTTCTGAGGGTCTCTGAAAAGG - Intergenic
1130149613 15:81301333-81301355 AGCTCTGAAAGGCTTTCATAAGG - Exonic
1140253129 16:73312265-73312287 ATATTTGGAGGGCTGTCATAAGG + Intergenic
1142885116 17:2907745-2907767 ATTTCTAAGGGGCTCGCAAATGG - Intronic
1146414939 17:32623032-32623054 ATTTGTGAAAGGCTATCAGAGGG + Intronic
1148855911 17:50579258-50579280 ATATTTGAAGGGCTGTCATGTGG + Intronic
1149307315 17:55360935-55360957 TTTTTTGAAGAGCTCTCATGTGG + Intergenic
1149389575 17:56175521-56175543 ATTTCTGAAGATGTCTCACAAGG - Intronic
1150151856 17:62816169-62816191 ATGTCTGTTGGGCTTTCATAGGG + Intergenic
1155088731 18:22485160-22485182 ATTTCTACAGTGCTCTCTTATGG + Intergenic
1156215855 18:34997430-34997452 TTTCCTGAAGAGCTCTCATGTGG - Intronic
1156386269 18:36607888-36607910 AATTCTGAAGAGGTCTCAGATGG - Intronic
1156807031 18:41197145-41197167 ATTTCAGAAGGGCCTTAATATGG - Intergenic
1157986984 18:52449294-52449316 ATTTTCAAAGGGCTCTGATATGG - Intronic
1160344333 18:78120409-78120431 ACATCTGAAGGGATCTCATTTGG - Intergenic
926831792 2:16971227-16971249 ATTTCTTAAGGCCTCTGATATGG + Intergenic
928165910 2:28971685-28971707 TTTTCTGAAGGGCAGTCATGAGG + Intronic
928859918 2:35845577-35845599 ATTTCTGAAGTACTCTGTTAGGG + Intergenic
931977893 2:67663619-67663641 ATTTCCCAAGGATTCTCATATGG - Intergenic
935512279 2:103991081-103991103 ATTTCTGAGGGTCTCTCAGTGGG + Intergenic
937381368 2:121380407-121380429 ACTCCAGAAGGGCTCTCTTAGGG + Intronic
940432348 2:153607788-153607810 ATTTCTGGAAGACTCTCTTAAGG - Intergenic
940864169 2:158800647-158800669 AGATCTGAAGGGCTGTCATGAGG - Intronic
942094361 2:172523545-172523567 AATTCTGAGGGGCTCTCATTAGG + Intergenic
944170765 2:196774128-196774150 ATTCCTTAAGGGCTATCAAAGGG - Intronic
947701114 2:232234868-232234890 CTTTCTGAAGAGCTCTGGTAGGG - Intronic
949065265 2:241986403-241986425 CTTTCTGAAGAGCCCTCATGGGG - Intergenic
1169145221 20:3248170-3248192 AATGGTGAAGGGCTCTCAGAGGG - Intergenic
1170529135 20:17272067-17272089 ATGTTTGAAGGGTTCTCACATGG - Intronic
1171329116 20:24321889-24321911 ATAACTGAAGGTCTGTCATATGG + Intergenic
1172361771 20:34317676-34317698 CTTGCTCAAGGTCTCTCATATGG + Intergenic
1174735223 20:52959833-52959855 ATTTCTGACAGGCTCTAACAGGG - Intergenic
1176762538 21:12969894-12969916 GTTTCAAAAGTGCTCTCATAAGG + Intergenic
1177205073 21:18000750-18000772 ATTATTAAAGGGGTCTCATATGG + Intronic
1178147737 21:29759050-29759072 ATTTCTGAAGGTCTCACAGAGGG - Intronic
1178510475 21:33201098-33201120 ATATCTGAAGGGTTGTCTTAAGG + Intergenic
1182807896 22:33091053-33091075 ATATTTGAAGGGCTGTCATGAGG - Intergenic
949733986 3:7149288-7149310 ATTTCTGTGGGCCTCTCATAAGG + Intronic
949871911 3:8596293-8596315 ATATCTGAAGGGCTGTCACAAGG + Intergenic
951120116 3:18916780-18916802 ATTTCTCAGGGTGTCTCATAAGG + Intergenic
952893625 3:38061533-38061555 CTTTCTGAAGAGCTCACAGAAGG - Intronic
954962525 3:54578899-54578921 ATTTCTGCAGGGCCCCCAGAGGG + Intronic
959190589 3:103105553-103105575 CTTTCTTAAGGGCTTTCTTAAGG - Intergenic
959835062 3:110908740-110908762 ATGTCTGAACGGCTGTCAAATGG + Intergenic
961921317 3:130429198-130429220 ATTGCTGAATGACTCTCAGAAGG + Intronic
965834757 3:172838973-172838995 TTTTCTGAAGGTCTCTAAAAGGG - Intergenic
966103112 3:176299832-176299854 ATATTTGAAGGACTCTCATGTGG + Intergenic
968973138 4:3806664-3806686 ATTTCTGGAGGACTATCATGGGG - Intergenic
971565900 4:28141188-28141210 TTTTCTGGAGGCTTCTCATAGGG - Intergenic
971695435 4:29896312-29896334 ATTTCTGAAGGGCTTAGATATGG - Intergenic
973296133 4:48522627-48522649 ATCACTGAAGGCCTCTAATAGGG + Intronic
974643393 4:64663006-64663028 AGTTCTGAAAGGCTAACATAAGG + Intergenic
982781533 4:159496269-159496291 ATTTGTGGTGGGCTCTCATCAGG + Intergenic
984264265 4:177477660-177477682 CTTTCTGAAGACATCTCATATGG - Intergenic
985426024 4:189831333-189831355 ATTTCTTAAGGGCTGTCCTGTGG + Intergenic
986509952 5:8493815-8493837 ATTTCAGAATGACCCTCATATGG - Intergenic
987444540 5:18001398-18001420 ATTTCTGAATTTCTCTCAGAGGG + Intergenic
988140681 5:27235272-27235294 ATTTCTTTAGGCCTCTTATATGG - Intergenic
989550736 5:42733098-42733120 ATTTCTGAATGGTGCTCAGATGG + Intergenic
990834959 5:60008153-60008175 ATATCTGGAGAGCTTTCATAGGG - Intronic
991978247 5:72204141-72204163 ATTCCTCAGGAGCTCTCATATGG - Intronic
993739128 5:91515681-91515703 CTTGCTGATGGGCTCTCATGTGG - Intergenic
994321336 5:98398470-98398492 ATTTCTAAAAGTATCTCATATGG + Intergenic
994551594 5:101240894-101240916 ATTTCTGAATTTCTCTCAGATGG - Intergenic
994662301 5:102668768-102668790 CTTTCTCAAGGGCTCTCAACTGG - Intergenic
999122719 5:149221488-149221510 CTTTCTGATGGGCTCTAATTGGG + Intronic
999482297 5:151959847-151959869 ACTTCTGAAGGGCTGCCATAGGG + Intergenic
1001125158 5:169012692-169012714 ATTTCTGAAGATATCTGATATGG - Intronic
1002934318 6:1658893-1658915 ATACCTGAACGGCTCTCACAAGG + Intronic
1003941075 6:11027633-11027655 ATATCTGAAGGGCTCTCGTGTGG - Intronic
1005217610 6:23549878-23549900 TTTTCTGTAGTGCTCTCAAAAGG - Intergenic
1005319372 6:24637664-24637686 CTTTCTGAAGTGCCCTCTTATGG + Intronic
1006795257 6:36728276-36728298 ATTTCTGGAATTCTCTCATAGGG + Intronic
1009484680 6:64205779-64205801 ATTTGTGAAAGGCTTTCAAAGGG + Intronic
1012050565 6:94337661-94337683 ATTTCTGATGGGATCTCCTAAGG + Intergenic
1013615542 6:111839756-111839778 GGTACTGAAGGGCTCTCAAATGG + Intronic
1014709413 6:124788774-124788796 AATTCTGAATGTCTCTGATATGG - Intronic
1016821568 6:148351211-148351233 TTTTCTGAAAGGCTCTTCTATGG + Intronic
1017111354 6:150936097-150936119 ATATTTGAAGGACTGTCATATGG + Intronic
1018130428 6:160725919-160725941 ATATCAGAAGGGCTCTTATGAGG - Intronic
1021629965 7:22635170-22635192 TTTTTTGAAGGGCTCTCAATCGG - Intergenic
1022635838 7:32134162-32134184 ATTTCAAAAGGTCTATCATAAGG + Intronic
1024296137 7:47843802-47843824 ATTTGTGATGGGATCTCAGAGGG + Intronic
1024452352 7:49562249-49562271 ATATCTTAAGGTCTCTAATAAGG + Intergenic
1024565051 7:50673872-50673894 ATTTCTGAACGGATGTCAAAGGG - Intronic
1024585483 7:50838303-50838325 GTTTCTCAAGGGCTCCAATATGG + Intergenic
1024652569 7:51418115-51418137 ATTTTTGAATAGCTATCATAAGG + Intergenic
1027735824 7:81931792-81931814 ATTTCTGGTGGTCTCTCCTAAGG + Intergenic
1028696959 7:93725287-93725309 ATGTTTGTAGGGCTATCATAGGG + Intronic
1031273430 7:119685611-119685633 ATTACACAAGGGCTCTGATAAGG + Intergenic
1033329304 7:140404853-140404875 ATATCTGATGGGCTGTCATGTGG + Intronic
1036116592 8:5966619-5966641 ACTTTTCAAGTGCTCTCATATGG + Intergenic
1038921336 8:32088144-32088166 GTTTGTGAAGGGCTATCATGAGG - Intronic
1042296135 8:67220384-67220406 TTCTTTGAAAGGCTCTCATAAGG + Intronic
1043797613 8:84564483-84564505 AATTCTGAATGGCTATCATATGG - Intronic
1045163112 8:99571680-99571702 ACATCTGATGTGCTCTCATAGGG - Intronic
1046430638 8:114122612-114122634 ATTTCTGAAGTGTACTAATAAGG + Intergenic
1049136713 8:140908706-140908728 CCTTCTGAGGGGCTGTCATATGG - Intronic
1051133119 9:13884879-13884901 ATTTCTGCAGGTCTTTCTTATGG - Intergenic
1056898809 9:90579401-90579423 TTTTCTGTAGAGCTCTCATGGGG + Intergenic
1060111956 9:120912921-120912943 ATCCCTGAAGGGCTGTCATGGGG + Intronic
1060253496 9:122004975-122004997 ATTTCTAAAGGGTTCTCATAGGG + Intronic
1060781137 9:126414165-126414187 ATAACTGAAGGGCTTTTATATGG + Intronic
1186257005 X:7732832-7732854 ATTTCTGACAAGCTCTCAGATGG - Intergenic
1186367986 X:8915477-8915499 ATTTTTGCATTGCTCTCATATGG + Intergenic
1186731017 X:12409580-12409602 AATTCTGAAGTAATCTCATAGGG - Intronic
1187795121 X:22995038-22995060 ATTTTTAAAGGTCTCTCCTAGGG - Intergenic
1188667024 X:32836672-32836694 ATTTCTCATGGGTTTTCATATGG + Intronic
1191006965 X:55719648-55719670 AATTCTGTAGGGCTGTGATAGGG - Intronic
1192207605 X:69106608-69106630 AAGTCTGAAAGGCTGTCATAGGG - Intergenic
1193928283 X:87518142-87518164 AATTCTGAACGGCTCTCTGATGG - Exonic
1194075887 X:89393326-89393348 ATTACATAAGGGCTCTTATATGG - Intergenic
1195772139 X:108362768-108362790 ATATTTGAAGGGCTGTCATGGGG - Intronic
1195967841 X:110445142-110445164 GTCTCTGAAGGGCTGTCATATGG - Exonic
1196104155 X:111878447-111878469 ATTTCTGAAGGTCTTTCTTGTGG - Intronic
1196179741 X:112676898-112676920 GTTGATGAAGGGCTCTCATTTGG - Intronic
1198747693 X:139906892-139906914 CTTTCTGATGGGGTCTGATAAGG + Intronic
1200731493 Y:6747486-6747508 ATTACATAAGGGCTCTTATATGG - Intergenic