ID: 917488862

View in Genome Browser
Species Human (GRCh38)
Location 1:175480155-175480177
Sequence CTGACTATGCAGCTGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917488862_917488868 15 Left 917488862 1:175480155-175480177 CCATTCTCCAGCTGCATAGTCAG 0: 1
1: 0
2: 1
3: 35
4: 340
Right 917488868 1:175480193-175480215 CTGAATCCTGTGCTCACTGCAGG 0: 1
1: 0
2: 0
3: 30
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917488862 Original CRISPR CTGACTATGCAGCTGGAGAA TGG (reversed) Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900768048 1:4518711-4518733 CTTACTATAGAGCTGGAGTAAGG + Intergenic
901303787 1:8217799-8217821 TTAATTTTGCAGCTGGAGAAGGG - Intergenic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
902997178 1:20235453-20235475 AAGACTATGCAGTAGGAGAAAGG + Intergenic
905470791 1:38190230-38190252 CTGACTATGCAGATGCAGGAAGG - Intergenic
905947866 1:41918665-41918687 CAAACTAGGCAGCTGGATAATGG + Intronic
909547370 1:76862823-76862845 TGGACTGGGCAGCTGGAGAATGG - Intergenic
910205272 1:84743286-84743308 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
910980059 1:92951253-92951275 CTGGCTTTGAAGTTGGAGAAAGG + Intronic
911102334 1:94104584-94104606 CTGTCCATGCAGCTGGGGCAGGG + Intronic
911499741 1:98670418-98670440 CTGGAAATGCAGCTGCAGAAAGG + Intronic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
915255935 1:154628700-154628722 AAGACTTGGCAGCTGGAGAATGG - Intergenic
915989054 1:160494680-160494702 CTGACTATGGAGGTAGAGATTGG + Intronic
916078849 1:161219424-161219446 CTGAGGATGGAGCTGGAGCAGGG + Intronic
916267045 1:162901009-162901031 CTGGCTTTGGAGATGGAGAAAGG - Intergenic
916298344 1:163245681-163245703 CTGATTATGCATCTGTAAAATGG + Intronic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
919657812 1:200214431-200214453 CTGGTTGTGCTGCTGGAGAAGGG + Intergenic
919662108 1:200257388-200257410 CTGGCTTTGAAGATGGAGAACGG + Intergenic
919834569 1:201564864-201564886 CTGACTTTGAAGATGGAAAAAGG - Intergenic
920902897 1:210129316-210129338 CTGATTATGCAGCTGATGCATGG - Intronic
922579959 1:226689500-226689522 CTCACTATCCGGGTGGAGAAAGG + Intronic
922996460 1:229966151-229966173 CTGGCTTTGAAGGTGGAGAAAGG + Intergenic
923083800 1:230686118-230686140 CTGAGTCTTCATCTGGAGAATGG + Intronic
923340792 1:233005391-233005413 CTCACTCAGCAGCAGGAGAAAGG + Intronic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1065009264 10:21406854-21406876 CTGACTTTTCAGTAGGAGAAAGG - Intergenic
1065694955 10:28371204-28371226 CTGACTTTGAAACTGGAGGAAGG - Intergenic
1067550195 10:47228973-47228995 GTGACCATGGAGATGGAGAATGG - Intergenic
1067741877 10:48901734-48901756 ATGCCTCTGCAGCAGGAGAAAGG + Intronic
1067982837 10:51106588-51106610 CTGTCTCTGCTGCTGAAGAAAGG - Intronic
1068647078 10:59479956-59479978 CTGCCTAGGCAACTGGAGGATGG - Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069684506 10:70309084-70309106 CTGGCTGTGCCGCTGGGGAATGG - Intronic
1070512864 10:77177028-77177050 CTGGCTGTGAAGGTGGAGAAAGG + Intronic
1071806104 10:89122911-89122933 CTGGCTTTGAAGCTGGAGGAAGG - Intergenic
1072904951 10:99444546-99444568 CTGACTAAGCTGCAGGAGAAGGG + Intergenic
1074430379 10:113389170-113389192 ATGACCATGCAGCTGGAGACGGG - Intergenic
1075106061 10:119540906-119540928 CCCACTTTGCAGGTGGAGAAAGG + Intronic
1075682796 10:124344322-124344344 CTGGCTGTGAAGCTGGAGGAAGG - Intergenic
1076251902 10:128991380-128991402 CAGACTGTGCAGCTGCAGAGAGG - Intergenic
1076326418 10:129626856-129626878 CTGACTATGGAGCTGGTGTAAGG + Intronic
1077782607 11:5347952-5347974 ATGACTATGGAACTGAAGAATGG + Intronic
1079222773 11:18578280-18578302 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1080375335 11:31703199-31703221 CTGACTATGCCACTGGTGCAAGG - Intronic
1080615158 11:33939345-33939367 CTGACTTTGAAGCTGGAGGAAGG + Intergenic
1082655777 11:55855586-55855608 CAGATAATGGAGCTGGAGAATGG + Intergenic
1083402105 11:62430685-62430707 CTGACTTTGAAGATGGGGAAGGG - Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1084705182 11:70812073-70812095 CTGACTTTGCAGCTGCAGCAGGG - Intronic
1086846548 11:91756694-91756716 CTGACTATGGAGCAAGAGAAAGG + Intergenic
1087670128 11:101096587-101096609 CTGTATATGCAGGTGAAGAAAGG + Intronic
1088266976 11:107997241-107997263 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1088884391 11:113995481-113995503 CTGGCTTTGAAGCTGAAGAAAGG - Intergenic
1089553951 11:119304503-119304525 CAGACTGTGAAGCGGGAGAAAGG - Exonic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1090773800 11:129945801-129945823 GTCACCATGCAGCTGGAGTAAGG - Intronic
1092945767 12:13452731-13452753 CTGACTATGTGGATGGAGTATGG + Intergenic
1093067692 12:14675664-14675686 GTGCCTCAGCAGCTGGAGAATGG + Intronic
1098387333 12:69933383-69933405 CTGACTATTCATATGGTGAAAGG + Intronic
1099196648 12:79624768-79624790 ATTATTATGCAGCTGAAGAAAGG - Intronic
1101044346 12:100789165-100789187 CTGACTATGTAGCATGAGATGGG - Intronic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1104706701 12:130952754-130952776 CTCTCTGTGGAGCTGGAGAAGGG - Intergenic
1104998814 12:132675461-132675483 CTGAGCATGCAGCAGGAGATAGG - Exonic
1105327486 13:19383220-19383242 CTGGTTGTGCTGCTGGAGAAGGG + Intergenic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107108023 13:36667632-36667654 CTCACTCTGCAGCTGGCGCAAGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108709215 13:53016544-53016566 CTGACTGTGAAGGTGGAGGAAGG + Intergenic
1108776110 13:53767232-53767254 GATACTATGCAGCTGTAGAAAGG + Intergenic
1110246146 13:73326842-73326864 CTGATTAGGTAGCTTGAGAATGG + Intergenic
1112669609 13:101619424-101619446 CTGCCTTTGAAGATGGAGAAAGG + Intronic
1113909457 13:113835231-113835253 CCGTCTATGCAGGTGGAGAAGGG + Intronic
1114588376 14:23835896-23835918 GTGAAGATTCAGCTGGAGAAAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1116588645 14:46742522-46742544 CTGAATGTGCAGCTTGAGGATGG + Intergenic
1117835272 14:59798530-59798552 CTGGCTTTGAAGATGGAGAATGG - Intronic
1122305140 14:100760562-100760584 CTGACTATCCACATGCAGAAAGG + Intergenic
1122853693 14:104549661-104549683 CTGTCCATGTAGCTGGAGACAGG - Intronic
1122871049 14:104639240-104639262 CTGACTTTGCAGCTGGAGACAGG + Intergenic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1126757177 15:51936122-51936144 TGGACTCTGCAGCTGCAGAAAGG + Intronic
1126773775 15:52082377-52082399 CTGGATATGCAGCGGCAGAAAGG - Intergenic
1127289727 15:57559643-57559665 CTGACAATGCAGCTGGGGGTAGG - Intergenic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128798627 15:70482487-70482509 ATGGCGATGGAGCTGGAGAAGGG + Intergenic
1130620849 15:85460757-85460779 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1130712094 15:86293416-86293438 CTGGCTTTGAAGATGGAGAAAGG - Intronic
1130840034 15:87689959-87689981 ATGAATATAGAGCTGGAGAATGG - Intergenic
1131640726 15:94289983-94290005 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1132071666 15:98783054-98783076 CTGCCTAGGCTGCTGGAGGATGG + Intronic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133435653 16:5777256-5777278 CTGACTATGAAGGTAGAGGAAGG - Intergenic
1133796029 16:9047182-9047204 ATCATTGTGCAGCTGGAGAAAGG + Intergenic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1134872775 16:17666824-17666846 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135912500 16:26574166-26574188 CTGACTTTGAAAATGGAGAAAGG + Intergenic
1136996402 16:35193756-35193778 CTGACTGTTCAGCTGCAGCAAGG + Intergenic
1138137617 16:54536978-54537000 TTCACTATGCAGGTGGGGAAGGG + Intergenic
1138309351 16:56009929-56009951 CTGAAGTTGGAGCTGGAGAAGGG + Intergenic
1138578785 16:57926151-57926173 CTGACACTCCAGCTGGGGAAAGG - Intronic
1138665854 16:58567751-58567773 CTGGCTGTGGAGCTGGAGATGGG - Intronic
1139057141 16:63199489-63199511 CTGACTTTGAAGATGGAGAGAGG + Intergenic
1139205815 16:65027354-65027376 AAGCCTATGCAGCTGGAGATGGG + Intronic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1140335764 16:74103625-74103647 CTGGCTCTGAAGATGGAGAAAGG + Intergenic
1140894452 16:79312855-79312877 CTTACTCTGCAACTGGGGAAGGG + Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1141461707 16:84181767-84181789 CAGGCAATGCAGGTGGAGAAAGG - Exonic
1141471933 16:84244671-84244693 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1141607873 16:85165571-85165593 CTCACCCTGCAGCTGGAGAGAGG - Intergenic
1141769416 16:86080319-86080341 CTGACTTTGCAGGTGGAGGGAGG + Intergenic
1141918743 16:87120591-87120613 CCATCTTTGCAGCTGGAGAAAGG + Intronic
1142150609 16:88511006-88511028 TTGTCTCTGCAGCTGAAGAATGG - Intronic
1143812457 17:9483272-9483294 CTGACTCTGAACGTGGAGAACGG - Intronic
1146254144 17:31379409-31379431 GTGACTATGCTGCTGTAGTATGG - Intronic
1146376523 17:32298361-32298383 CTCCCTATGAGGCTGGAGAACGG + Intronic
1146480931 17:33204318-33204340 CTGACTTAGCAGCTGGACATGGG - Intronic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1146611494 17:34309450-34309472 CTGACTTTGAAAATGGAGAAGGG - Intergenic
1149286773 17:55173920-55173942 CTGGCTTTGCAGGTGGATAAAGG - Intergenic
1150673314 17:67221586-67221608 CAGGCTATGCAGCTGGAGAGTGG - Intronic
1151307086 17:73269976-73269998 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
1151393547 17:73804015-73804037 CTGGCCAGGCAGCTGGGGAATGG - Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1155524463 18:26702323-26702345 ATGACTACGCAGTTGGAAAAGGG - Intergenic
1155851617 18:30781840-30781862 CTGACTTTGGAACTGGATAAGGG + Intergenic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1156842686 18:41628058-41628080 CTGAGTATCCAGTTGAAGAAGGG - Intergenic
1157015416 18:43706608-43706630 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1157522925 18:48357574-48357596 CCGACTGTGCTGCTGGGGAAAGG - Intronic
1157983022 18:52404433-52404455 TTCACTATGCAGCAGGAGGAAGG - Intronic
1158474412 18:57767236-57767258 CAGACTAAGCAGGTGGGGAAGGG + Intronic
1158992672 18:62886004-62886026 ATGGCTGTGAAGCTGGAGAAAGG + Intronic
1159897514 18:74011436-74011458 CTGTCTCTGCTGATGGAGAATGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160294923 18:77629300-77629322 CACACAATGCAGCTGGAGGAAGG + Intergenic
1163752147 19:19084252-19084274 CTGACTATGCAGATGTAGAGGGG - Intronic
1165768021 19:38362717-38362739 CTGGCTATGCAGCTGGAAGGCGG - Exonic
1166999510 19:46737643-46737665 CTGACTCTCCTGCTGGGGAACGG + Intronic
1167035102 19:46990508-46990530 CTTGCTGTGCAGCTGCAGAAGGG + Intronic
1167639282 19:50671767-50671789 CTGGCTCTACATCTGGAGAATGG - Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
925577711 2:5377615-5377637 GTGGCTTTGCAGCTGGAGAGAGG - Intergenic
926221563 2:10939201-10939223 ATGACTTTGAAACTGGAGAATGG - Intergenic
926983100 2:18592413-18592435 GTGACTTTGCAACAGGAGAATGG + Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG + Intronic
935730700 2:106062938-106062960 CAGACTTAGCAGCGGGAGAAAGG + Intergenic
936636098 2:114260365-114260387 CTGACCAAGCAGCTGAGGAATGG - Intergenic
937053145 2:118908496-118908518 CTGAAGATCCAGCTGGGGAAAGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938365980 2:130734665-130734687 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939718446 2:145615774-145615796 CTCACTTTGAAGATGGAGAAAGG + Intergenic
939916176 2:148046579-148046601 CTGACTATGGAGGTAAAGAAGGG - Intronic
940161054 2:150713990-150714012 CTTATTATGTAGTTGGAGAAAGG + Intergenic
941177562 2:162217385-162217407 CTGAGTGTGCAGTAGGAGAATGG - Intronic
941849842 2:170168596-170168618 CTGGCTTTGAAGGTGGAGAAGGG + Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943108950 2:183582186-183582208 TTGACTTTGAAACTGGAGAAAGG - Intergenic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
946930871 2:224669099-224669121 CTGAATATGAAACTGGGGAAAGG + Intergenic
947282386 2:228469769-228469791 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
947337438 2:229102051-229102073 CTGGCTTTGAAGATGGAGAATGG + Intronic
947926552 2:233926827-233926849 CTGGCCATAGAGCTGGAGAAGGG - Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948644900 2:239398397-239398419 CTCACAATGAAGCTGGAGAATGG + Intronic
1170799193 20:19576492-19576514 AGGGCTCTGCAGCTGGAGAAGGG + Intronic
1171388567 20:24786585-24786607 CTCAGGAAGCAGCTGGAGAAGGG - Intergenic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173896924 20:46558290-46558312 CAGAGTATGTAGCTGGAGAGGGG + Exonic
1175320188 20:58080052-58080074 CTGGCTTTGCAGGAGGAGAAAGG - Intergenic
1175808821 20:61846344-61846366 CTGGCTATGCAGCAAGAGACAGG + Intronic
1176188052 20:63792290-63792312 TTGACTTATCAGCTGGAGAATGG - Intronic
1176374362 21:6079840-6079862 CTGACTCGGCAGGTGGAGCAGGG + Intergenic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1178896723 21:36564865-36564887 CTCACTTTGAAGGTGGAGAAAGG + Intronic
1179266737 21:39810180-39810202 CTGACTCTGCATCTGGGAAATGG - Intergenic
1179548909 21:42130912-42130934 CTGAGTAGGAAGCAGGAGAATGG - Intronic
1179749114 21:43458405-43458427 CTGACTCGGCAGGTGGAGCAGGG - Intergenic
1182000984 22:26919619-26919641 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
1182978260 22:34643681-34643703 CTAAGTGTGCAGCAGGAGAAGGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183885438 22:40877262-40877284 ATTACTGTGCAGTTGGAGAATGG - Intronic
1184249409 22:43251593-43251615 CTGGCTCTGCAGGTGGAGAAGGG + Intronic
1184252857 22:43270763-43270785 TTCCCTCTGCAGCTGGAGAAGGG - Intronic
1184805139 22:46790239-46790261 CTGACTCTGTACGTGGAGAAAGG - Intronic
949135149 3:555336-555358 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
950993617 3:17468975-17468997 GTGACTTTGAACCTGGAGAAGGG + Intronic
952416305 3:33093958-33093980 TTGACTCTGCAGCTGGGGAGTGG + Exonic
953958278 3:47247755-47247777 CAGACTCTGCAGCATGAGAAAGG + Intronic
954389640 3:50261833-50261855 CTGACCAGGCAGCTGGAGTCAGG - Intergenic
954421071 3:50419306-50419328 CTAATTATGGGGCTGGAGAAGGG - Intronic
958787788 3:98617078-98617100 CTCACTGTGAAGATGGAGAAAGG - Intergenic
959872583 3:111345429-111345451 CTGACTTTGAAAATGGAGAAAGG + Intronic
960333754 3:116392249-116392271 CTGAGTCTGCAGCTGTGGAAGGG - Intronic
961584900 3:127914449-127914471 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
961605927 3:128095346-128095368 CTGACAGTGCAGTTGGTGAAAGG - Intronic
962481231 3:135800397-135800419 CTGCCTATGGTGCTGGAGAGAGG - Intergenic
962852573 3:139318975-139318997 CTGGATATGCAGCTGCTGAACGG - Intronic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963372533 3:144419484-144419506 CTGGCTTTGAAGATGGAGAATGG - Intergenic
964386163 3:156150171-156150193 CTGAATAGGCTGCTGGTGAAGGG + Intronic
964501925 3:157357469-157357491 CTTACAATGCAGATGGACAAAGG - Intronic
964509171 3:157431392-157431414 CTGGCTGTGAAGATGGAGAAAGG - Intronic
964654912 3:159055599-159055621 CTGGCTTTGAAGATGGAGAAGGG - Intronic
964702015 3:159578686-159578708 CTGACTTTGAAGATGGAAAAAGG - Intronic
965636580 3:170788243-170788265 CTGGCTTTGAAGATGGAGAAAGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966315687 3:178643205-178643227 ATAATTATGGAGCTGGAGAATGG + Intronic
968737705 4:2305933-2305955 CTGGCTATGCAGCAGGAGCTGGG + Intronic
968913203 4:3486055-3486077 CTGACTCTGCAGCTGGGGTCGGG + Intronic
970138196 4:12949878-12949900 CTGACTCTGCATCTGTATAAAGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971878972 4:32342908-32342930 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
972169998 4:36334291-36334313 CTGACAATGAACCTTGAGAAAGG - Intronic
972233275 4:37099849-37099871 CTGACTATGAAGGTGGAGGAAGG + Intergenic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
974374402 4:61057947-61057969 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
975389949 4:73804259-73804281 ATGACTATGCATCTTGAGGATGG - Intergenic
975968716 4:80007698-80007720 CTGGCTTTGCAGATAGAGAAAGG + Intronic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
976441724 4:85083515-85083537 CTGACCCTGCAGCTGAAGGAGGG + Intergenic
977361933 4:96016294-96016316 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
978842314 4:113229332-113229354 CTGGCTTTGGAGATGGAGAACGG - Intronic
978928642 4:114283195-114283217 CTGACTTTGTAGCTGGAGGAAGG - Intergenic
979845849 4:125510637-125510659 CTGACTTTGAAGATGGAGTAAGG - Intergenic
980198311 4:129620654-129620676 CAGACTATGAAGGTGGGGAAGGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
981726060 4:147848408-147848430 CTGGCTTTGCAGCAGGAGATCGG + Intronic
981912538 4:149998290-149998312 CTGAGTATGCAGCTTCAGAACGG - Intergenic
983620660 4:169757874-169757896 CTGGCGCTGCAGCTGCAGAATGG - Exonic
985025913 4:185738953-185738975 CTAACTATGCAAATAGAGAATGG - Intronic
986105765 5:4658061-4658083 CTGACTTTGCGGATGGAGGAAGG - Intergenic
986208393 5:5647572-5647594 CTAAGTATGCAGTTGCAGAAAGG - Intergenic
986525149 5:8665418-8665440 CTGAGTATGCATCTGGAGCTGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987789117 5:22541249-22541271 CTGGCTATGCAGCTGCTGCAGGG + Intronic
988371680 5:30377372-30377394 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
989344296 5:40411865-40411887 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
989461271 5:41701416-41701438 CTGAATGTGAAGCTGGAGAAAGG - Intergenic
990592591 5:57281509-57281531 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
991230416 5:64326515-64326537 CTGCATATTCAGCTGGAGATTGG + Intronic
991377981 5:65986202-65986224 CTGAGTAAGCAGCTGGATATAGG - Intronic
992090164 5:73309979-73310001 CTGTCTGTGCTGCTGGAAAAGGG + Intergenic
993878358 5:93335709-93335731 CTGGCTTTGAAGATGGAGAAGGG - Intergenic
994145002 5:96384771-96384793 CTGAATATGCTCCAGGAGAAAGG + Intergenic
995554392 5:113312539-113312561 AGGTCAATGCAGCTGGAGAATGG + Intronic
995788707 5:115860136-115860158 CTGGCTATGAACATGGAGAATGG - Intronic
997370624 5:133357376-133357398 CTGAAGATGCAGCTAGAGAGAGG - Intronic
998560785 5:143169724-143169746 CGGACTCTGCGGATGGAGAAGGG + Intronic
999005582 5:147973776-147973798 CTGCCTTTGAAGCTGGAGAAAGG - Intergenic
999433902 5:151547593-151547615 CTAACCAGTCAGCTGGAGAAGGG - Intronic
1000165958 5:158648955-158648977 CTGAGAGTGAAGCTGGAGAAGGG - Intergenic
1000755064 5:165147915-165147937 CTGGCTTTGGAGATGGAGAAAGG + Intergenic
1001313910 5:170629564-170629586 CTAACTGAGCACCTGGAGAAAGG - Intronic
1001575651 5:172762383-172762405 CTGGTTGTGCTGCTGGAGAAGGG - Intergenic
1001899416 5:175412862-175412884 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1001931302 5:175674983-175675005 TTGGCTTTGCAGGTGGAGAAAGG - Intronic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1006824401 6:36923764-36923786 CTGGCCATGCAGGTGAAGAAAGG - Intronic
1007164215 6:39817165-39817187 GAAACTATGCAGCTGGAGGAAGG + Intronic
1008133424 6:47744223-47744245 CTGACTTTGCAGATGAAGGAAGG - Intergenic
1008140539 6:47826808-47826830 CATGCTATGCAGTTGGAGAAGGG + Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1010308336 6:74351099-74351121 ATGACAATGAAGCTGCAGAATGG - Intergenic
1010572697 6:77496914-77496936 CTGTCTCTGAAGATGGAGAAAGG - Intergenic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1011927764 6:92669169-92669191 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1014168079 6:118248552-118248574 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015581511 6:134730270-134730292 CACACTGAGCAGCTGGAGAATGG - Intergenic
1015868093 6:137748073-137748095 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1016917483 6:149258111-149258133 CAGACTCTCTAGCTGGAGAAGGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017159411 6:151350940-151350962 CTGAGTATGATGCTGTAGAAAGG + Exonic
1018245277 6:161816604-161816626 CTCACAATGCAGCTGGAGGGAGG + Intronic
1018449330 6:163892487-163892509 CTTACAATGCAGTTGGAGAAAGG - Intergenic
1019304311 7:325594-325616 AGGTCTATGCAGCTGGAGAGGGG - Intergenic
1019909081 7:4087821-4087843 CTGAATTTCCATCTGGAGAATGG + Intronic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1021149681 7:17134414-17134436 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1021344857 7:19513837-19513859 CTGACTTTGAAGCTAGAGAAAGG - Intergenic
1023902560 7:44494184-44494206 CAGACGCTGCATCTGGAGAAGGG + Intergenic
1027557713 7:79686875-79686897 CTGGCTCTGAAGATGGAGAAAGG - Intergenic
1027724053 7:81780867-81780889 CTGATTTTGAAGATGGAGAAAGG + Intergenic
1028471669 7:91212844-91212866 CTGACTGTGCTAGTGGAGAATGG + Intergenic
1029442451 7:100594612-100594634 TTCACCATGCAGCTGGAGTAAGG - Intronic
1030176064 7:106655761-106655783 CTGACTATGCAGTAGGAGATTGG - Intergenic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1031789337 7:126080759-126080781 CTGAGTTTGCAACTGGATAATGG - Intergenic
1031915440 7:127558756-127558778 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1032348246 7:131136723-131136745 CAGACAATGCATTTGGAGAACGG - Intronic
1033235803 7:139637006-139637028 CTGCCTAAGCAGCTGGAGGGTGG - Intronic
1035022446 7:155807548-155807570 CTGACTAGGCAGATGCAGACGGG + Intronic
1037358112 8:18044299-18044321 CTGACTTTGAAGATGGAAAAAGG - Intergenic
1037566753 8:20124539-20124561 CTGACTTTGAAGGTGAAGAAAGG - Intergenic
1038219677 8:25595385-25595407 CTGGCCAGGCTGCTGGAGAAGGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040380144 8:46864663-46864685 CTGACTGTGCTGCTGCAGCAAGG - Intergenic
1040740045 8:50562422-50562444 CTGGCTCTGAAGATGGAGAAGGG + Intronic
1041644068 8:60233618-60233640 CTGTTGTTGCAGCTGGAGAAGGG - Intronic
1041834295 8:62194656-62194678 CTGAAAATGCAGCCTGAGAAGGG + Intergenic
1041869574 8:62617606-62617628 CTTTCTATGCAACAGGAGAAAGG - Intronic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1043446682 8:80326004-80326026 CTGACTTTGGAGATTGAGAAAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045318291 8:101062026-101062048 CTGACTATGCATCCTGAGGAGGG - Intergenic
1046501620 8:115085088-115085110 CTGACTTTGAAGAAGGAGAAAGG + Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1047162921 8:122401367-122401389 CTGACTCTGCATCTGCACAAAGG + Intergenic
1048369630 8:133766236-133766258 CTGACTTCGCAGCTGGGGAGAGG + Intergenic
1048450243 8:134527137-134527159 CTGGCTTTGAAGGTGGAGAAGGG + Intronic
1050778678 9:9302400-9302422 TTGCATATGCAGCTGGAGAAGGG - Intronic
1051235357 9:14993328-14993350 CTGGCGCTGCAGCTGCAGAATGG + Intergenic
1051530502 9:18097066-18097088 CTGACTAGGAAGGTGGACAAGGG - Intergenic
1051975080 9:22939308-22939330 CTGACTCTGAAGATGGAGAAAGG + Intergenic
1052715575 9:32112352-32112374 GTGACTATGAAGGTGGAGATTGG + Intergenic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1055242390 9:74198990-74199012 ATGATTATACAGCTAGAGAATGG - Intergenic
1055271484 9:74564645-74564667 GTAAATATGCAGCTGGTGAAAGG + Intronic
1057091425 9:92261504-92261526 CTGACTGTGCTGCTGGATACAGG + Intronic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1057803006 9:98201394-98201416 TTGACTCTGCCCCTGGAGAATGG - Intronic
1058350654 9:104017769-104017791 CTTACAATGCAGGTGGAGCATGG + Intergenic
1058880677 9:109283453-109283475 CAGGATATGCAACTGGAGAAAGG + Intronic
1059444682 9:114330823-114330845 CTGAATGTCCAGCGGGAGAATGG + Exonic
1060006834 9:120007949-120007971 CTGAAAATGGATCTGGAGAAAGG - Intergenic
1061913547 9:133737679-133737701 CTGACCAGGCAGGTGGTGAAGGG - Intronic
1062237015 9:135515189-135515211 CTCACTCTGCACCTGGGGAAGGG - Intergenic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1186360201 X:8833156-8833178 CTGACGATGCAGCCTGAGAGTGG - Intergenic
1186770334 X:12811883-12811905 CGGACCATGCAGCTGGAGATCGG + Intronic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1186963801 X:14765495-14765517 CTTACTCTTCAACTGGAGAACGG - Intergenic
1187715827 X:22101626-22101648 CTCTCTATTCAGCTGGAGGATGG + Intronic
1188024834 X:25197348-25197370 CTGCCTATGCTGAGGGAGAAGGG + Intergenic
1188510818 X:30934583-30934605 CTGGCTTTGAAGCTGGAGGAAGG - Intronic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1188947646 X:36326838-36326860 CTGACAATGCAACTGGGGGAAGG + Intronic
1189499325 X:41540617-41540639 CTTAATAGGCAGCTGGAGATAGG - Intronic
1189730139 X:44011613-44011635 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1189917275 X:45868261-45868283 CTGACTGTGAAGATGGAGAAAGG + Intergenic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1194129230 X:90059611-90059633 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1194155539 X:90383379-90383401 TTGATTATGCTACTGGAGAAAGG + Intergenic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1195026513 X:100882990-100883012 CTGACTTTGAAGATAGAGAAAGG + Intergenic
1197646338 X:129021711-129021733 CTGGCTTTGAAGGTGGAGAAAGG - Intergenic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1200082926 X:153588234-153588256 CTGGTTGTGCTGCTGGAGAAGGG - Exonic
1200501890 Y:3960312-3960334 TTGATTATGCTACTGGAGAAAGG + Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic
1201663913 Y:16427656-16427678 CCCAGCATGCAGCTGGAGAACGG + Intergenic
1202604344 Y:26626389-26626411 CTGGTTGTGCTGCTGGAGAAGGG - Intergenic