ID: 917490283

View in Genome Browser
Species Human (GRCh38)
Location 1:175492930-175492952
Sequence AATTCTAGGTAGTGGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917490276_917490283 26 Left 917490276 1:175492881-175492903 CCACATATGGGCCTCCAGAGGCA 0: 1
1: 0
2: 0
3: 19
4: 131
Right 917490283 1:175492930-175492952 AATTCTAGGTAGTGGATGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
917490275_917490283 27 Left 917490275 1:175492880-175492902 CCCACATATGGGCCTCCAGAGGC 0: 1
1: 0
2: 0
3: 18
4: 111
Right 917490283 1:175492930-175492952 AATTCTAGGTAGTGGATGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
917490279_917490283 -5 Left 917490279 1:175492912-175492934 CCTGATAGACTTCTTGTTAATTC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 917490283 1:175492930-175492952 AATTCTAGGTAGTGGATGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
917490277_917490283 15 Left 917490277 1:175492892-175492914 CCTCCAGAGGCACATTTAATCCT 0: 1
1: 0
2: 0
3: 17
4: 163
Right 917490283 1:175492930-175492952 AATTCTAGGTAGTGGATGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
917490278_917490283 12 Left 917490278 1:175492895-175492917 CCAGAGGCACATTTAATCCTGAT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 917490283 1:175492930-175492952 AATTCTAGGTAGTGGATGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917490283 Original CRISPR AATTCTAGGTAGTGGATGGC TGG Intronic
905397890 1:37678978-37679000 AATTCCAGGTGGTGGAGGGGAGG + Intergenic
907609857 1:55857835-55857857 TATTTTAGGGAGTGGAGGGCAGG - Intergenic
910259371 1:85281003-85281025 ATTGCAAGGTAGTGGATGGGTGG - Intergenic
917490283 1:175492930-175492952 AATTCTAGGTAGTGGATGGCTGG + Intronic
918134289 1:181657920-181657942 AGTTGTAGGTACTGGCTGGCTGG - Intronic
920574940 1:207052540-207052562 AATTCTAGATACTGGGAGGCAGG + Intronic
921428565 1:215034987-215035009 AATTGTAGGTAATGGAAGCCAGG - Intronic
921871852 1:220149600-220149622 AATTCTAGGATGTGTGTGGCTGG + Exonic
921983355 1:221282993-221283015 AATTCTAGGTAGGGGAAGGGGGG - Intergenic
923892883 1:238235324-238235346 AATTCTAGGTAGAAAAGGGCGGG - Intergenic
924334492 1:242973672-242973694 CTTTCTAGGTAGTTCATGGCAGG - Intergenic
1063063961 10:2590275-2590297 AATTGCAGGTAGTGGAGAGCTGG - Intergenic
1067533314 10:47090395-47090417 AAGTCAAGGTAGTGTAAGGCAGG - Intergenic
1068241146 10:54302197-54302219 ATTTCTAGGAAGTGAATGGGTGG - Intronic
1069299990 10:66895619-66895641 AATTATAGGTGGTGAATGGTAGG - Intronic
1072048207 10:91678281-91678303 AAATCTGGGTAGGGGGTGGCAGG + Intergenic
1072911047 10:99501357-99501379 AAATCTAGGTAGTGGATATGTGG + Intergenic
1074351515 10:112741889-112741911 AAATCTAGGTATTTGATGGCTGG - Intronic
1074709998 10:116169347-116169369 AATACTAGGTAGAAGATGGTGGG + Intronic
1077949378 11:6939516-6939538 AATACTAGGAAGTGGAAGGGAGG + Intronic
1081341024 11:41927648-41927670 AATTCTAGGTGGTCGAGGGGAGG + Intergenic
1084127121 11:67106866-67106888 AATGTTAGACAGTGGATGGCAGG + Intergenic
1085322635 11:75583998-75584020 CTTTCTGGGTAGTGGAGGGCTGG + Intergenic
1087634371 11:100686904-100686926 AATTGTAGGGAGTGGGTGGAGGG + Intergenic
1093763218 12:22933890-22933912 AATTCTTAGGAGTGGATGACTGG + Intergenic
1094322124 12:29196208-29196230 GATACTCGGTAGTGGATTGCTGG + Intronic
1095613087 12:44155399-44155421 AAGTCTAGGGAGGGGCTGGCTGG - Intronic
1098203373 12:68080760-68080782 AATTCTCTGTAGTGGTGGGCTGG - Intergenic
1100378239 12:94037610-94037632 ATTTTTGGGTAGTGGCTGGCTGG - Intergenic
1102860100 12:116328866-116328888 ACTTGTAGGTAGAGGATGGGAGG + Intergenic
1102861161 12:116337678-116337700 AATTCTAGCAAGGGGAAGGCAGG + Intergenic
1104338010 12:127918783-127918805 AATTCTGGGGAGGGGAGGGCAGG - Intergenic
1104547305 12:129723895-129723917 ACATCTTGGTAGTGGAGGGCAGG - Intronic
1106836394 13:33639868-33639890 TATTCTAGTTGGTGGGTGGCGGG + Intergenic
1108361177 13:49669173-49669195 AAATGTTGGTAGTGAATGGCCGG - Intronic
1115656045 14:35444759-35444781 AATTGTATGTAATGGATGCCAGG + Intergenic
1117437273 14:55728593-55728615 AATTTTAAGTAGTGGTTGGCTGG + Intergenic
1117719001 14:58610076-58610098 AATTTCATGTAGTGGTTGGCAGG + Intergenic
1118952189 14:70445157-70445179 AATTCAAGGTAGTTCATGGAGGG + Intergenic
1122930282 14:104930035-104930057 AATTCTGGGTTGTGGATGGACGG + Exonic
1131784788 15:95900536-95900558 AAATCTAGGTAGTAGAGAGCAGG + Intergenic
1133745078 16:8680132-8680154 AAGTCTAGGATGTGGATGACAGG - Intronic
1134901880 16:17945592-17945614 ACAACTAGGTAGTGGTTGGCAGG + Intergenic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1139428520 16:66898336-66898358 AGTTCAAGGTCATGGATGGCTGG + Intergenic
1139840275 16:69873040-69873062 AATTGTAGGTAGAGGAATGCAGG + Intronic
1140267120 16:73430212-73430234 AAGCCAAGGCAGTGGATGGCAGG - Intergenic
1140748195 16:77999491-77999513 AATGCTAGGTAGAGAAGGGCTGG - Intergenic
1142102604 16:88283584-88283606 AATTCTAGGTGGTGGGTTGGGGG + Intergenic
1148713070 17:49695950-49695972 AATTCTAGGTAGTGTGTAGTGGG + Intergenic
1157454975 18:47818292-47818314 AATTCTAGGTGTTGGTTGCCAGG - Exonic
1159666066 18:71162035-71162057 AATTCTAGGCAGAAGAGGGCAGG + Intergenic
1162095726 19:8308737-8308759 AATGCTAGCTACTGGAGGGCAGG + Intronic
1162600219 19:11663145-11663167 AATTGTAGGTAAAGGAAGGCAGG + Intergenic
1164630420 19:29758171-29758193 AATTCTGGGTAGTGTGTGGAAGG + Intergenic
1165930626 19:39356154-39356176 AATGCTGGGTAGAGGATGGATGG - Intronic
927267464 2:21167869-21167891 AGCTCTAGGTATTGGATGGTAGG - Intergenic
930653148 2:53982580-53982602 AATTCTAGGCAGTGGGTGGAAGG - Intronic
931627261 2:64267889-64267911 AATTCTAGGGGGTGGAGGGCTGG - Intergenic
934101474 2:88657330-88657352 ATTTCTAGCTAGCGGAGGGCAGG + Intergenic
935348983 2:102137399-102137421 AATTCTAGTTAGTGGCTGTCTGG - Intronic
938682511 2:133705771-133705793 TATGCTAGGTAGTGTTTGGCAGG - Intergenic
938786841 2:134637434-134637456 AGTTCTAGGTTGAGAATGGCTGG - Intronic
944284436 2:197932450-197932472 AAATCTAGGTGGTGGGTGACAGG - Intronic
1170350410 20:15434650-15434672 AATACTCAGTAGTGGATTGCTGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174739817 20:53001478-53001500 AATGCTAGGTAGAGGATGAAAGG + Intronic
1175562342 20:59940641-59940663 ATTTCTGGGTTGTGGATGGGGGG + Intronic
1175639145 20:60612486-60612508 CTTTCTAGGGATTGGATGGCTGG - Intergenic
1177124621 21:17181204-17181226 AATTCTGGGTAGAAGAGGGCAGG + Intergenic
1177554351 21:22670702-22670724 AATTTTAGGGAGGGGATGGAAGG + Intergenic
1184623033 22:45697501-45697523 AATGCTAAGTAGTGGTTGCCAGG - Intronic
950697624 3:14715474-14715496 AATGCTAGGCAGTGCATGGCAGG - Intronic
959184151 3:103022922-103022944 AACTCTGGGTAGGGGAAGGCAGG + Intergenic
963300690 3:143593943-143593965 AATCCAAGGCAGAGGATGGCAGG - Intronic
963774809 3:149427966-149427988 AATTCTATATAGAAGATGGCAGG - Intergenic
967690425 3:192467413-192467435 AATTCTAGGTACTGTAAGGCTGG - Intronic
968192120 3:196676165-196676187 AATTTTTGGTAGTAGATGACAGG + Intronic
971546606 4:27894221-27894243 ACTTCTAGGTACTAGATGGAAGG + Intergenic
978646722 4:110942056-110942078 AATTCAGGGATGTGGATGGCTGG + Intergenic
979404919 4:120298034-120298056 AATTCTAGGTCAGGCATGGCTGG + Intergenic
985048960 4:185970692-185970714 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
986163242 5:5250209-5250231 AATACTGGGTAGAAGATGGCAGG - Intronic
987195954 5:15526243-15526265 AATTGTAGGGAATGGCTGGCAGG + Intronic
989679030 5:44007577-44007599 AGTTCTATGTTGTGGATGGAAGG + Intergenic
990145698 5:52757725-52757747 AATTCCAGGGAGTGCATGTCAGG - Intergenic
990334667 5:54760666-54760688 AAAGCTAGGTGGTGGAGGGCTGG - Intergenic
991507249 5:67338117-67338139 AATTCCAGATAGTGGAGGGTTGG - Intergenic
993265079 5:85716427-85716449 AATTTTAGGTAGTTGGTAGCAGG + Intergenic
1000627973 5:163561450-163561472 AATTCTATGTAGAGGCTGCCAGG - Intergenic
1001304687 5:170563123-170563145 AATGATAGTTGGTGGATGGCAGG - Intronic
1003534050 6:6960683-6960705 GATTCCAGGTAGGGGATGGGTGG - Intergenic
1004512380 6:16293525-16293547 AATTCTAGATAATGAATGTCTGG + Intronic
1006882295 6:37350916-37350938 AAATCTAGGTAGTGTTTGTCAGG - Intergenic
1007677635 6:43610481-43610503 AATTCTAGGTACTGAACTGCAGG - Intronic
1008317577 6:50064647-50064669 ATTTCTGGGTATTAGATGGCTGG + Intergenic
1010243441 6:73639747-73639769 AATTCTATTTAGTTGTTGGCTGG + Intronic
1011245600 6:85318212-85318234 AAATCTAGGTAGAGGGTGCCAGG - Intergenic
1012247763 6:96945229-96945251 AATTGTGGATAGTGCATGGCAGG + Intronic
1017783426 6:157734390-157734412 AATCCTGGGGATTGGATGGCAGG + Intronic
1019443710 7:1060223-1060245 AATTGGAGGTAGGGGATTGCAGG - Intronic
1021088770 7:16455837-16455859 AGTGCTGGTTAGTGGATGGCTGG + Intergenic
1025803140 7:64806515-64806537 AAATTTAGGTACTGGATGGGTGG - Intronic
1026426231 7:70297170-70297192 AATTCTGGGTGGTGTAAGGCAGG - Intronic
1028144112 7:87303165-87303187 AGTTCTGGGTAATGGATGGAAGG - Intergenic
1031981828 7:128132590-128132612 AATTCCAGGAAGCGGTTGGCTGG + Intergenic
1032864602 7:135913385-135913407 AATTCTAGGCACTGTATGACAGG - Intergenic
1034285637 7:149881559-149881581 AAGTGTAGGTAGTGGCTGGCTGG + Intergenic
1037957710 8:23071732-23071754 AATTGGAGGCTGTGGATGGCTGG + Intergenic
1038486069 8:27936047-27936069 AATTCTGGGCAGGGGCTGGCGGG - Intronic
1040683440 8:49841910-49841932 AATTCTAGGTAGACAGTGGCAGG + Intergenic
1042445955 8:68885191-68885213 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
1047110428 8:121783620-121783642 AAATATAGGTAGTGGATTGAAGG + Intergenic
1048965992 8:139614896-139614918 ATTTCTAGGTACTGGCTGGTGGG + Intronic
1050414627 9:5403025-5403047 GATAATAGGTAGTGGAAGGCTGG + Intronic
1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG + Intergenic
1057892633 9:98880879-98880901 ACTTGAAGGTAGTGGATGGGAGG + Intergenic
1059456494 9:114403229-114403251 AATCCTAGGCAGGGGCTGGCGGG + Exonic
1061152738 9:128838023-128838045 GATGCTAGGTAGAGGATGGATGG - Intronic
1061403476 9:130381268-130381290 AATTCTAGGCTGGGGCTGGCCGG - Intronic
1061679690 9:132236808-132236830 GATTCTGGGCAGTGGAAGGCAGG + Intronic
1062196764 9:135278516-135278538 AAATCTAGCTAGGGGATGGTGGG - Intergenic
1188146406 X:26619015-26619037 CATTCTAAGTAGGGGATGGAGGG + Intergenic
1195738603 X:108039100-108039122 CATTCTAGGTGGTTGATGGGGGG - Intergenic
1198041319 X:132855655-132855677 ATTTCTAGTTGGTGGGTGGCTGG - Intronic
1199328165 X:146526346-146526368 AATTCAAAATATTGGATGGCTGG - Intergenic
1199780742 X:151056800-151056822 AGTTCAGGGTTGTGGATGGCTGG - Intergenic
1202390349 Y:24363718-24363740 CTTTCTAGGTAGTTCATGGCAGG + Intergenic
1202480435 Y:25306398-25306420 CTTTCTAGGTAGTTCATGGCAGG - Intergenic