ID: 917490764

View in Genome Browser
Species Human (GRCh38)
Location 1:175496461-175496483
Sequence GCCATATGCAGAAGCATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917490764 Original CRISPR GCCATATGCAGAAGCATCTC TGG Intronic
900295021 1:1944441-1944463 TCCATATGCAGCTGCATTTCAGG - Exonic
902699192 1:18160070-18160092 GACAAATTCAGAAGCATTTCTGG + Intronic
903458975 1:23507771-23507793 GCCATATGGAGAGGCCTCTAGGG + Exonic
903603186 1:24556578-24556600 GCCCTATGCAGAGGCCCCTCCGG + Intronic
904174059 1:28613345-28613367 GCAATCTGCAGCAGCATCTGGGG + Exonic
905543742 1:38781207-38781229 TCCTTATGCTGAAGCATCCCGGG + Intergenic
906980849 1:50627337-50627359 GCCAAATGAAAAAGCGTCTCAGG + Intronic
909133931 1:71773001-71773023 CACATATCCAGAAACATCTCAGG + Intronic
910257447 1:85261875-85261897 TCTAGATGCAGAAGCACCTCAGG + Intergenic
912969522 1:114267536-114267558 GCCAGATGCAGCAACATCTGGGG - Intergenic
917490764 1:175496461-175496483 GCCATATGCAGAAGCATCTCTGG + Intronic
917509874 1:175661236-175661258 CACAAATGGAGAAGCATCTCAGG + Intronic
919497381 1:198290564-198290586 GGCATATGAAGAAGCGTGTCAGG + Intronic
919945169 1:202313974-202313996 GGCAAATGCAGAAGAATTTCAGG - Intronic
920905852 1:210166694-210166716 GCCAAATGAAGTAGAATCTCTGG - Intronic
1062820800 10:533188-533210 GTCAAATGCAGCAGCATCTCCGG + Intronic
1063437394 10:6045439-6045461 TTCATTTGCAGAAGCATCTGAGG - Intronic
1064871119 10:19937994-19938016 GTCAAATGCAGAAGCATCCAGGG - Intronic
1065072011 10:22034904-22034926 GCCATAAGCCTAATCATCTCAGG + Intergenic
1070204283 10:74241141-74241163 ACCGTATGCTGAATCATCTCAGG - Intronic
1072723634 10:97797598-97797620 GCCACATGCAGAAGGAGCTGTGG + Intergenic
1074095951 10:110312630-110312652 TGCTTATGCAGAAGCATCTCAGG + Intergenic
1076244780 10:128938371-128938393 GCCATGTGGAGAGACATCTCTGG - Intergenic
1077627976 11:3790302-3790324 GACATAAGCAGAAGCTGCTCTGG + Intronic
1077878262 11:6325757-6325779 GCCATTTGCAGGAGCATCCTGGG - Intergenic
1084654307 11:70506245-70506267 GCCCTGTGCAGGAGCAGCTCTGG - Intronic
1085393354 11:76193794-76193816 GCCATCTGCACATGCAGCTCTGG + Intronic
1087489606 11:98807813-98807835 GCCATATGCAGAAGAATAAATGG - Intergenic
1092169251 12:6363197-6363219 GTCCTATGTAGAAGCATTTCAGG - Intronic
1094478270 12:30859228-30859250 TCCAGATGCAGAAACCTCTCTGG - Intergenic
1099709219 12:86199145-86199167 GCCATATGAAGAAAAATCTAGGG - Intronic
1101602734 12:106224516-106224538 GCCATCTGCAGAAGAATCTGGGG + Intergenic
1102205831 12:111090199-111090221 GCCAGATGAGGGAGCATCTCAGG + Intronic
1102219283 12:111183453-111183475 GCAATAGGCAGAAGCAACACCGG + Intronic
1105305446 13:19165556-19165578 GCTATGTGCAGGAGCATCTGAGG - Intergenic
1105510229 13:21045641-21045663 GCCATGTGCAGAGGCAGCTATGG - Intronic
1110152751 13:72274756-72274778 GCAATATGAAGATGCATTTCAGG + Intergenic
1112441608 13:99428159-99428181 TCCATAAGGAGATGCATCTCTGG - Intergenic
1114323625 14:21567852-21567874 GCCATAGCCACAAGAATCTCAGG - Intergenic
1115243175 14:31269506-31269528 GCCATAAGCAGAGGAATGTCTGG - Intergenic
1115410959 14:33074181-33074203 TCCATCTGCAGAAACATTTCTGG - Intronic
1119632285 14:76243601-76243623 GCTATATGTAGGAGCATCTTGGG - Intronic
1120502345 14:85311907-85311929 GCCATTTGCAGAAGTTTCTGGGG + Intergenic
1124705067 15:31956926-31956948 GTCATGTGAAGAAGCATCACAGG - Intergenic
1126724925 15:51622529-51622551 ACCTGATGCAGATGCATCTCCGG + Exonic
1126909458 15:53402562-53402584 GCAAAATGCAGCAGTATCTCGGG - Intergenic
1129711479 15:77822475-77822497 GTCATGTGCAGAGGCCTCTCTGG + Intergenic
1129763118 15:78143397-78143419 GCCATATGGAAAAGCATTCCAGG + Intronic
1131287693 15:91075258-91075280 GTAATTTGCAGCAGCATCTCAGG - Intergenic
1132735081 16:1381842-1381864 GGCTGATGCAGAAGCATCTCTGG + Intronic
1136366018 16:29809666-29809688 GCCACATGCAGACCCATCTGGGG + Exonic
1139274329 16:65713565-65713587 CTCATTTGCATAAGCATCTCTGG + Intergenic
1139740925 16:69034277-69034299 GCCATCAGCAGCAGCATCTTGGG - Intronic
1141324572 16:83044162-83044184 TCCAGATGCAGAAGTAGCTCAGG + Intronic
1142132588 16:88437774-88437796 GCCACATGAACAAGCACCTCAGG + Exonic
1143357470 17:6341154-6341176 GCTATTTGCAGAAGCACCACAGG + Intergenic
1146239768 17:31209067-31209089 GGGATATTCAGCAGCATCTCTGG + Intronic
1148150333 17:45393304-45393326 GGCTTCTGCAGAAGCATCTCAGG + Intergenic
1148335349 17:46837351-46837373 GCCAAATGCAGATGCTTCTTAGG + Intronic
1150810100 17:68349490-68349512 ACCAGATGCAGTAGCATTTCAGG + Intronic
1153952264 18:10067510-10067532 GACAGTTGCAGATGCATCTCTGG + Intergenic
1153968311 18:10201909-10201931 GCCTTATGCAGAAAGACCTCTGG - Intergenic
1155714597 18:28925797-28925819 GACATATGAAGAAGCATGTAAGG - Intergenic
1155728278 18:29117528-29117550 CCCATAGGCAGAATCATCTAGGG + Intergenic
1158234344 18:55296340-55296362 GCCAGATGCAGAGGAATCCCAGG + Intronic
1162766682 19:12924199-12924221 CCCATGGGCAGCAGCATCTCTGG + Exonic
1168104230 19:54156843-54156865 GGGAGATGCAGAAGCATCTGGGG - Exonic
926771001 2:16375196-16375218 TCCTTATGCACTAGCATCTCTGG + Intergenic
930125482 2:47792926-47792948 GCCTGATGCAGAAGGATCACTGG - Intronic
930805651 2:55486639-55486661 CCAAGATGCAAAAGCATCTCTGG - Intergenic
931881789 2:66576731-66576753 GCCTTAGGCAGAAGCTCCTCAGG + Intergenic
932872949 2:75421780-75421802 GCCCTATGCAGAAACATTTCTGG - Intergenic
933354117 2:81194012-81194034 GCCAACTGCAGAGGCATTTCAGG - Intergenic
938044898 2:128109785-128109807 ACCAAATGCAGAAGCAGCACTGG - Intronic
938693667 2:133815640-133815662 GCCATATGCAGGTGGATTTCAGG - Intergenic
939059568 2:137403873-137403895 GAGATATGTAGCAGCATCTCTGG - Intronic
940541800 2:155029832-155029854 GCCATATGGAGTAACATCACAGG - Intergenic
941169081 2:162116008-162116030 GCCATATGCAGAAGACTCAAAGG + Intergenic
942430219 2:175902928-175902950 GCCATAAGCAGAAGTGTCTGAGG - Intergenic
944889649 2:204104012-204104034 GCAGTATACAGAAGCCTCTCAGG + Intergenic
1168758752 20:334190-334212 GCCATGTGGAGAAGCAGCCCGGG + Intergenic
1170859537 20:20089881-20089903 GGCAAGTGCAGAGGCATCTCAGG + Intronic
1170897230 20:20426551-20426573 CCCCTAAGCAGAAGCATCACAGG - Intronic
1172665537 20:36596823-36596845 GCCCTAGGAATAAGCATCTCTGG + Intronic
1173302712 20:41818091-41818113 GGCAGAAGCAGAAGGATCTCGGG - Intergenic
1173474990 20:43352684-43352706 GCTATTAGCAGAAGCTTCTCTGG + Intergenic
1174426707 20:50436785-50436807 GGCATATTCAGAAGCCTCCCAGG - Intergenic
1176372696 21:6071929-6071951 GTAATTTGCAGAAGAATCTCAGG + Intergenic
1179096916 21:38324320-38324342 TCCATATGCAGATGCTTGTCAGG - Intergenic
1179721804 21:43320571-43320593 GCCATCTCCAGGAACATCTCAGG + Intergenic
1179750780 21:43466314-43466336 GTAATTTGCAGAAGAATCTCAGG - Intergenic
1184121344 22:42452576-42452598 GCCACCTGCTGAAGCATCACCGG - Intergenic
952328158 3:32339496-32339518 GCCCTTAGCAGAAGCATGTCTGG - Intronic
953379905 3:42462009-42462031 GCCATATCCAGAGCCATGTCAGG + Intergenic
953857130 3:46507992-46508014 GGCATATACAGGAGCATGTCTGG + Intergenic
959234404 3:103700331-103700353 GCCATTTGTAGAAGCATATTTGG - Intergenic
961112251 3:124294677-124294699 ACCAAATCCAGAAGCTTCTCTGG + Intronic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
963439394 3:145318077-145318099 TGCATATGCTGATGCATCTCTGG + Intergenic
964873820 3:161342974-161342996 GACAGAAGCAGAAACATCTCTGG - Intergenic
967341649 3:188405246-188405268 TCCATCTGCAGGAGCAGCTCTGG - Intronic
968493950 4:905171-905193 CCCAGATGCAGAATCTTCTCGGG - Intronic
979703368 4:123692305-123692327 ACCAGATGCAGAAGCCTCTTAGG - Intergenic
982312407 4:153999854-153999876 ACCATATTCAGAATCCTCTCTGG - Intergenic
985084143 4:186295835-186295857 GCCATATGCTGAAACAACACCGG - Intergenic
985508971 5:301076-301098 ATCATAAGCAGAAGCTTCTCTGG - Intronic
986695679 5:10353131-10353153 GCCAAATGCAGAAGTCTCCCTGG + Intergenic
989124270 5:38036162-38036184 TCCATATGCAGAAACATTTAGGG + Intergenic
993020727 5:82587146-82587168 GCCTCATGCAGAAGCAGCTGTGG + Intergenic
994730825 5:103488721-103488743 ACCAAATACAGAAGCACCTCTGG - Intergenic
997209618 5:132069725-132069747 GACATATGAAGCAACATCTCTGG - Intergenic
1002438681 5:179251788-179251810 GCTGTGTGCAGAAGCAGCTCTGG + Intronic
1004102395 6:12627100-12627122 GGCATCTGCAGAAACATTTCAGG + Intergenic
1021139784 7:17009949-17009971 GCCATAAGCAGGAGCTTCTTTGG - Intergenic
1022691879 7:32664058-32664080 GCCACAGGCAGAAGCAGCTGAGG + Intergenic
1022919541 7:34998599-34998621 GCCACAGGCAGAAGCAGCTGAGG + Intronic
1023025989 7:36049878-36049900 ACCACCTGCAGCAGCATCTCTGG - Intergenic
1024283671 7:47739090-47739112 ACCATCTGCAGAGGCCTCTCTGG + Intronic
1024608507 7:51042901-51042923 GCCAACTGCATAAGCATTTCAGG + Intronic
1024984736 7:55185254-55185276 TCCATATGCAAAACCATCTCAGG + Intronic
1027926424 7:84470377-84470399 GCTATATGATGAAGCATTTCTGG + Intronic
1028461975 7:91104303-91104325 ACCATTGGCAGCAGCATCTCTGG + Intronic
1030575173 7:111276910-111276932 GCCACATGCAGAAGAATGACTGG + Intronic
1031661492 7:124430442-124430464 GCCAAATGCAGAAGCTTGCCAGG - Intergenic
1032896049 7:136251935-136251957 GCTGGGTGCAGAAGCATCTCAGG - Intergenic
1035783028 8:2243888-2243910 GCCACGTGCAGAAGCACCTGTGG - Intergenic
1035809099 8:2475698-2475720 GCCACGTGCAGAAGCACCTGTGG + Intergenic
1036227327 8:6970823-6970845 GCCATCAGCACAGGCATCTCGGG - Intergenic
1038344553 8:26720129-26720151 GCCATATGCAAATGCATTTCGGG + Intergenic
1042867562 8:73369112-73369134 GCCATATGAAGAAAAATCTAGGG - Intergenic
1043274362 8:78374550-78374572 GCCATTTGCAGAAGTAACTCTGG - Intergenic
1044276793 8:90310489-90310511 TCCCAATGCAGAAACATCTCAGG - Intergenic
1048534812 8:135283396-135283418 CCCAAATTCAGAAGCATGTCAGG + Intergenic
1050297678 9:4222382-4222404 GCCATATGCTGATTCATCTTAGG + Intronic
1057231684 9:93325199-93325221 GGCAGATGCAGCATCATCTCAGG + Intronic
1058278632 9:103082089-103082111 GACATTTGAAGAAGCATTTCAGG + Intergenic
1058856009 9:109063025-109063047 CTCATATGCAGAGGCATATCAGG - Intronic
1185885907 X:3782599-3782621 GACATAAGCAGAAACATCTTTGG + Intergenic
1186098773 X:6132468-6132490 ACCATGTTCAGCAGCATCTCTGG + Intronic
1186292002 X:8110550-8110572 GACATATGCAGAATCATGTTAGG - Intergenic
1187329979 X:18328878-18328900 GCCATCTGCAGATACTTCTCAGG - Intronic
1187988975 X:24849038-24849060 GCAATATGCAGTAGAATCACAGG + Intronic
1188260468 X:28016869-28016891 GCCTAATGTAGAAACATCTCAGG + Intergenic
1189331540 X:40147453-40147475 GCCTTAGGCAGACGCATCCCGGG - Intronic
1189632777 X:42973146-42973168 GCCATAGGCTGAACCAACTCTGG + Intergenic
1198371163 X:135990647-135990669 ACCCTATGCTGAAGCATCACTGG - Intronic
1198919857 X:141713331-141713353 AGGATATTCAGAAGCATCTCTGG - Intergenic
1200048769 X:153417301-153417323 GCCAAATGCAGGACCATCTGAGG + Intergenic