ID: 917495771

View in Genome Browser
Species Human (GRCh38)
Location 1:175538798-175538820
Sequence CAGCTACTTTCTTGGCATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917495767_917495771 22 Left 917495767 1:175538753-175538775 CCAGGGTGGGAGGGAGGAGGCAG 0: 1
1: 0
2: 19
3: 174
4: 1228
Right 917495771 1:175538798-175538820 CAGCTACTTTCTTGGCATACAGG 0: 1
1: 0
2: 0
3: 14
4: 126
917495766_917495771 23 Left 917495766 1:175538752-175538774 CCCAGGGTGGGAGGGAGGAGGCA 0: 1
1: 0
2: 5
3: 97
4: 718
Right 917495771 1:175538798-175538820 CAGCTACTTTCTTGGCATACAGG 0: 1
1: 0
2: 0
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917495771 Original CRISPR CAGCTACTTTCTTGGCATAC AGG Intronic
901774004 1:11546730-11546752 CAGCTACCTTCAGGTCATACAGG - Intergenic
902584044 1:17427205-17427227 CAGATACTTTCTAGGCAGCCAGG - Intronic
907884244 1:58578190-58578212 CAGCTACTTACGTGGGATACAGG - Intergenic
907884253 1:58578270-58578292 TGGCTAGTTTCATGGCATACAGG + Intergenic
908126831 1:61040517-61040539 CAGCTACTTCCTTAGTATAGGGG - Intronic
908466091 1:64397085-64397107 CAGCTTCTTTCTTGGCCTCCTGG - Intergenic
908682533 1:66678263-66678285 CATTTACTTTCTTGGCATTTAGG - Intronic
908993654 1:70126266-70126288 CAGCAAGTTTATTGGCACACTGG + Intronic
909397747 1:75189223-75189245 CTGCTTCTTTCTTGGGATAAAGG + Intergenic
909515036 1:76497447-76497469 CAGCTAATTTCTTCACATTCTGG - Intronic
909899631 1:81116149-81116171 CTGGTACTTTCCTGGCATCCTGG + Intergenic
913961183 1:143339136-143339158 CAGCTGCTTTGTTGGCAGCCAGG + Intergenic
914055537 1:144164709-144164731 CAGCTGCTTTGTTGGCAGCCAGG + Intergenic
914123609 1:144801653-144801675 CAGCTGCTTTGTTGGCAGCCAGG - Intergenic
915977229 1:160399615-160399637 TAACTGGTTTCTTGGCATACTGG + Intergenic
917495771 1:175538798-175538820 CAGCTACTTTCTTGGCATACAGG + Intronic
917692218 1:177481248-177481270 CAGCAACTGTCTTGGCAAACTGG + Intergenic
922322595 1:224501897-224501919 CAGCTACTTTCCTGGAAGAGGGG + Intronic
1064516805 10:16158729-16158751 CTGCTACTTGCTCGGCAGACAGG + Intergenic
1067029632 10:42871535-42871557 CAGCTGCTTTGTTGGCAGCCAGG + Intergenic
1067405523 10:46019987-46020009 TAGCTCCTTTCTTGGCATCTGGG - Intronic
1071418054 10:85459412-85459434 CAGCGAATTTCTTGACATTCTGG + Intergenic
1071866897 10:89745018-89745040 CAGCTACTTTCTAGGTAAAAGGG + Intronic
1072955392 10:99883682-99883704 CAGCTTATTTTGTGGCATACTGG + Intronic
1074077002 10:110137650-110137672 CATCTACTTTGTTGGGATACTGG - Intergenic
1074519845 10:114209159-114209181 CAGGTACAATCATGGCATACTGG - Intronic
1079398350 11:20085360-20085382 CATCTCCTCTCTTGGTATACAGG - Intronic
1079848953 11:25505192-25505214 TTTCTAGTTTCTTGGCATACAGG + Intergenic
1080850417 11:36063934-36063956 CAGCTAGCTTCTTGGCAGAATGG - Intronic
1081968707 11:47184715-47184737 CAGGTCCTTTCTGGGCAGACAGG - Intronic
1086734463 11:90288752-90288774 CAGCCAGTTTCTTGCCATGCTGG + Intergenic
1087303533 11:96462683-96462705 CACCTCTTTTCTTGGCATGCAGG + Intronic
1088737546 11:112740201-112740223 CAGTTTCCTTCTTGGCAAACAGG + Intergenic
1089983190 11:122789423-122789445 CAGCTCCTTTCCTGGAATTCTGG - Intronic
1091130721 11:133144956-133144978 CAGCTACTTTGTGGGCATCTAGG + Intronic
1092245455 12:6861591-6861613 CAGCTACTGACTTGGCCTGCAGG - Exonic
1093555782 12:20471865-20471887 CAGCTACTGTGTTGGCACTCAGG + Intronic
1100286101 12:93168438-93168460 CAGATACTTTCTGGGCACAAGGG - Intergenic
1101566544 12:105911136-105911158 CAACTACTTTCTAGGCCTGCTGG - Intergenic
1109635966 13:65117226-65117248 CACCTTCTTTCTTTGCATAGTGG - Intergenic
1109899704 13:68750772-68750794 TAGCTACATACTTGGAATACAGG - Intergenic
1110403714 13:75123827-75123849 TAGGCACTTTCTTGGAATACAGG + Intergenic
1111493762 13:89021031-89021053 CAGCTACTATCTGGTCATACTGG - Intergenic
1112013777 13:95314232-95314254 AAGCTAATTTCTTGGGATCCTGG - Intergenic
1115201196 14:30855924-30855946 CTGTTACTTTTCTGGCATACTGG - Intergenic
1115650848 14:35402243-35402265 CAGGTACATTCTTGGGATACTGG + Intronic
1118909084 14:70046385-70046407 AAGCTGCTTTTTGGGCATACTGG - Intronic
1127887985 15:63220759-63220781 CTGTTACTTGCTTGGCAAACAGG + Intronic
1127966553 15:63926954-63926976 CAGCCACTTTCTTAGCATGGTGG + Intronic
1128008450 15:64268013-64268035 CAGATATCTTTTTGGCATACTGG - Intronic
1128555789 15:68630899-68630921 AAAGTTCTTTCTTGGCATACTGG - Intronic
1128602171 15:69005273-69005295 CAGCTCCTTTCTTGGAGTTCTGG + Intronic
1129015621 15:72465826-72465848 AAGCACCTTTCTTGGCATTCTGG - Intergenic
1131091142 15:89625638-89625660 CAGCTTCTTCCTTGGCCAACAGG - Exonic
1131498634 15:92937792-92937814 CTGCTTCTTTCTTCGCAGACTGG + Intronic
1134202434 16:12210140-12210162 CGGCTACTTTCCAGGCACACTGG + Intronic
1139873294 16:70124916-70124938 CACCTGCTTTCTTGACATATGGG + Intronic
1143666538 17:8365314-8365336 CTCCTAGTTACTTGGCATACCGG - Intergenic
1148278988 17:46332474-46332496 CAGCTACTCACCTGGAATACTGG + Intronic
1148301203 17:46550336-46550358 CAGCTACTCACCTGGAATACTGG + Intronic
1149382821 17:56110881-56110903 CAGCTACTGTGGTGGCATGCCGG - Intergenic
1149399397 17:56279513-56279535 CAGCTATTGACTTGGCATCCAGG + Intronic
1155760864 18:29564857-29564879 TAACTATTTTGTTGGCATACAGG - Intergenic
1156860843 18:41834760-41834782 CAGCTAAGTGCTTGGCATACAGG + Intergenic
1159533453 18:69684934-69684956 AAGGAACTTTATTGGCATACAGG + Intronic
1162543470 19:11312907-11312929 TAGCTAATTTATTGGCATACAGG - Intronic
1164054510 19:21610692-21610714 GAGCTACCTTCTTGGTCTACAGG + Intergenic
1166145993 19:40835791-40835813 CAGGTATTTTCTTGGCTGACTGG + Intronic
1166150095 19:40866725-40866747 CAGGTATTTTCTTGGCTGACTGG + Intronic
1202695020 1_KI270712v1_random:117386-117408 CAGCTGCTTTGTTGGCAGCCAGG + Intergenic
927594745 2:24386533-24386555 CAGCTACTTTCCTGGCTGAGGGG + Intergenic
929874352 2:45784219-45784241 CAGCTCCTTCCTTGGGATCCTGG - Intronic
937963995 2:127487083-127487105 AAACTACTTTATAGGCATACTGG - Intronic
938795382 2:134714599-134714621 CAGCAACCTTCTTGACATTCTGG - Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940616583 2:156056111-156056133 CTCCTTCTTTCTTGGAATACAGG - Intergenic
942279365 2:174344355-174344377 CTGCTACATTCTGGGCATTCTGG + Intergenic
943198286 2:184784566-184784588 CTGCTACTATCTTGGGACACTGG - Intronic
943459883 2:188159268-188159290 CAGCTACTTCCTCGGCTTATTGG - Intergenic
944890373 2:204110842-204110864 CAGCCACTTTCCTGTCAAACAGG - Intergenic
945668675 2:212774767-212774789 CAGCTACTTAAGTGGCATCCTGG + Intergenic
946879412 2:224162123-224162145 CAGCTGCTGTCTTGGCCTAAGGG - Intergenic
1170287339 20:14724787-14724809 CATCTCCTTTCTTGGCTTACAGG - Intronic
1171218404 20:23370646-23370668 CAGCTACTTTATTGACAAAAAGG + Exonic
1172029664 20:31972906-31972928 AAACTACATTCTTGGCATAACGG + Intronic
1181489623 22:23253487-23253509 CCTCTACTTTCCTGGCATGCAGG - Intronic
1183774636 22:39955899-39955921 CAGATACTTACTTGGGAAACTGG - Exonic
950730277 3:14950239-14950261 CAGCTAGTTACATGGCATCCAGG + Intronic
951845367 3:27079128-27079150 CAGCAACTTTCTAGGCATCCAGG - Intergenic
952999225 3:38916642-38916664 CAGCAACTTTTTGGGCAGACAGG - Intronic
957220364 3:77374710-77374732 CAGCTACTCTCTTAGTAAACTGG - Intronic
957985069 3:87563633-87563655 CAGCTACAGTCTAGCCATACAGG + Intergenic
958898885 3:99862239-99862261 GTGCTACTTGCTTGGCATATTGG + Intronic
962548491 3:136463217-136463239 CAGCTACTTACTGGGCATGCTGG - Intronic
964836675 3:160946738-160946760 GTGCCACTTTCTTGTCATACTGG + Intronic
969169891 4:5353129-5353151 CAGGTACGTTCTTGGCATCTTGG - Intronic
974612282 4:64231805-64231827 CAGCTACTTTCTTAGTAACCTGG - Intergenic
975498818 4:75062539-75062561 CAATTACTTTCTTTGCCTACTGG + Intergenic
977377076 4:96219382-96219404 CAGCTAGTTTCTTGGGAGATGGG - Intergenic
978433276 4:108655636-108655658 CAGTAGCTTTCTTGGCCTACAGG + Exonic
978890940 4:113826685-113826707 CAGCTACACTGTTGGCATCCTGG - Intergenic
983843804 4:172490934-172490956 CATCTCCTTGCTTGGCATATGGG - Intronic
986199265 5:5566948-5566970 GATAGACTTTCTTGGCATACTGG + Intergenic
986523108 5:8642923-8642945 CAGCCACCTTCCTGCCATACTGG + Intergenic
987212377 5:15695828-15695850 CAACCACTTTCTTGGCATAGGGG - Intronic
990527735 5:56644739-56644761 CAGCTGGTTTCTTGGCTTATGGG - Intergenic
992113526 5:73518021-73518043 CAGCTACTGTCTTAGAATAGAGG + Intergenic
992541952 5:77774796-77774818 CAGGTACTTTCTTGGTTTACAGG + Intronic
995870749 5:116740938-116740960 CAGCTTCTGGCCTGGCATACAGG + Intergenic
1000504436 5:162097314-162097336 CAGCTAGTTTCTTGCCATGAGGG - Intronic
1004302492 6:14471056-14471078 CAGATAGTTTCTTGGTATATAGG - Intergenic
1004716822 6:18225711-18225733 CAGCTAATTTCTTGAGATAGAGG - Exonic
1004808471 6:19231396-19231418 CAGCTACTTTCATGTTATAATGG - Intergenic
1008711487 6:54233081-54233103 CAGGTACTTTCTTTTCATCCTGG + Intronic
1012241222 6:96875202-96875224 GAGATACTTTCCTGGCATAAAGG - Intergenic
1012408338 6:98926811-98926833 CCACTACTTCTTTGGCATACTGG + Exonic
1015590886 6:134821961-134821983 CAGCAACTCTCTTGTCCTACTGG + Intergenic
1023590362 7:41774851-41774873 CAGCTTCTTTCTAGGCATAGAGG + Intergenic
1026192034 7:68137591-68137613 CAGCTATTTTCTTTGTATATGGG - Intergenic
1032929512 7:136650158-136650180 AAGCTACTCTCTTGGGATAACGG - Intergenic
1039175692 8:34802699-34802721 CATCTAATTTATTGGCATGCAGG + Intergenic
1043356768 8:79422965-79422987 CACCAACTTTCTTAGCCTACTGG - Intergenic
1044720049 8:95136131-95136153 CTGCTATGTTCTTGGCATGCAGG - Intronic
1047940431 8:129823503-129823525 CAGCTCCTTCCTTGGCACAAAGG + Intergenic
1057742196 9:97721633-97721655 CAGCTGCATTCTTGCCATTCTGG + Intergenic
1057775402 9:98004414-98004436 CAGCTACTTTCAGGGAAGACAGG - Intronic
1059652326 9:116326368-116326390 CAACTATTTTCTTGGAATAAGGG + Intronic
1185575702 X:1170486-1170508 CTGCTACATTCTTAGCATGCTGG - Intergenic
1186344576 X:8678661-8678683 CAGCTACTTCCTTGGGTTATTGG + Intronic
1187929007 X:24276835-24276857 AAGTTACCTTCTTGGCATTCTGG - Intergenic
1189214175 X:39309139-39309161 CAGCTACTCTCTTGACAGTCAGG - Intergenic
1189292937 X:39898745-39898767 CAGCTTCCTTATTGGCATAATGG + Intergenic
1190501757 X:51086078-51086100 CAGCTAGTATCTTGGTATATTGG - Intergenic
1191750435 X:64536341-64536363 CTGTTCCTTTCTTGTCATACAGG + Intergenic
1191781207 X:64867957-64867979 TATCTAATTTGTTGGCATACAGG + Intergenic
1194976514 X:100402184-100402206 AAGCCACTTTACTGGCATACTGG + Intronic
1195207350 X:102615729-102615751 CAGCTACTAGCTTGGCACAGTGG - Intergenic
1195968061 X:110447342-110447364 CAGCCCCATTCTTGGCATATGGG + Intronic
1198485629 X:137084797-137084819 CAGCTAGTTTCTGGGCAAAAGGG + Intergenic
1199686094 X:150267041-150267063 TAGCCATTTTTTTGGCATACAGG + Intergenic
1201927956 Y:19310753-19310775 CAGCTACTTCCTAGACAAACTGG + Intergenic