ID: 917495991

View in Genome Browser
Species Human (GRCh38)
Location 1:175540691-175540713
Sequence CTGGGGAAGGGGAGAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1871
Summary {0: 1, 1: 0, 2: 25, 3: 197, 4: 1648}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917495991_917496001 12 Left 917495991 1:175540691-175540713 CCATCCACTCTCCCCTTCCCCAG 0: 1
1: 0
2: 25
3: 197
4: 1648
Right 917496001 1:175540726-175540748 CTCTCAGCCCTTGTTATCTCCGG 0: 1
1: 0
2: 0
3: 15
4: 198
917495991_917496002 17 Left 917495991 1:175540691-175540713 CCATCCACTCTCCCCTTCCCCAG 0: 1
1: 0
2: 25
3: 197
4: 1648
Right 917496002 1:175540731-175540753 AGCCCTTGTTATCTCCGGACTGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917495991 Original CRISPR CTGGGGAAGGGGAGAGTGGA TGG (reversed) Intronic
900104066 1:974747-974769 CTGGGGCAGGGAAGGGTGGGAGG + Exonic
900159159 1:1215350-1215372 CTGGAGAGGGAGGGAGTGGAGGG + Intergenic
900264039 1:1748309-1748331 CTGGGGAGAGGAAGAGAGGAAGG - Intergenic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900522294 1:3111515-3111537 GAGGGGAAGGGGAGAGCGGAGGG + Intronic
900620157 1:3583076-3583098 TTGGGGAAAGGGAGGGTGCAAGG + Intronic
900774520 1:4572180-4572202 CAGGGGAGGGGAAGAGTGGCAGG + Intergenic
900977601 1:6026968-6026990 AAGGGGGAGGGGAGAGAGGAGGG - Intronic
901162722 1:7192378-7192400 CTGCGGAGGGGCAGAGCGGAGGG + Intronic
901163865 1:7201050-7201072 CTGGCGGTGGGGAGTGTGGATGG - Intronic
901180750 1:7340288-7340310 CTGGAGAAGGTAAGACTGGAGGG + Intronic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901514551 1:9736242-9736264 CTGGAGAAAGGGAGAGTTGGGGG + Intronic
901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG + Intergenic
901672742 1:10865888-10865910 CTGGGAATGGGGAGAGAAGAAGG + Intergenic
901727516 1:11253629-11253651 ATGGGGAGGGGGTGAGTGGAGGG - Intronic
901796199 1:11681013-11681035 CTGGGGGAGGGGAGAGGGGGCGG - Intronic
901928551 1:12582762-12582784 CTGGTGAACGGGAGAGTGGACGG - Intronic
902163394 1:14550750-14550772 AGGGGGAAGGGGAGAGGGGGTGG - Intergenic
902231704 1:15031494-15031516 GTGGGGAAGGAGAGTCTGGAGGG + Intronic
902374948 1:16026280-16026302 CTGGGGCAGGGTAGGGTGGGCGG - Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902702827 1:18184331-18184353 CTGGGGAGGGGGAGAAGGGAGGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
902833570 1:19033305-19033327 CAGGGCAAGGGCAGAGGGGAGGG - Intergenic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
903012043 1:20338116-20338138 CTGGGGGAGGAGAGAGTTTAGGG + Intronic
903015044 1:20356093-20356115 CAGGGGATGGGGAGTGTGCAGGG - Intergenic
903131215 1:21280579-21280601 TTTGGGAAGGGCAGGGTGGAGGG + Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903189268 1:21647708-21647730 CTGGGGTAGGGGAAAGAGCATGG - Intronic
903193881 1:21670837-21670859 CTGTGAAAGGGCAGAGGGGAAGG + Intergenic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903362929 1:22788299-22788321 CAGGGGAAGATGAGAGTGGAAGG - Intronic
903424399 1:23242887-23242909 CTGGGGTAGGGGTGAGAGGGAGG + Intergenic
903682783 1:25108280-25108302 CTGGGGACAGGGACAGTGGCTGG + Intergenic
903812267 1:26041369-26041391 CTGGGGAAGTGTATAGGGGAGGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903956833 1:27031717-27031739 CGGGGGAGGGAGAGAGTGGGAGG + Intergenic
903957377 1:27034645-27034667 TGGAGGAAGGGGAGAGTGGCAGG - Intergenic
903984476 1:27215813-27215835 CTGGGAAAGGGGAGAGAAGGAGG - Intergenic
904024211 1:27492007-27492029 ATGGGTGAGGGAAGAGTGGAGGG - Intergenic
904274173 1:29369579-29369601 CTGGGTATGGAGTGAGTGGAGGG - Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904373627 1:30066214-30066236 TTGGGGAGGGGTGGAGTGGAGGG - Intergenic
904431733 1:30468753-30468775 CAGGGGAAGGGGAGAGAGGGTGG - Intergenic
904433475 1:30479603-30479625 CTGGGGAAGGGGTGGAGGGAAGG - Intergenic
904645067 1:31959403-31959425 CTGGGGAAAGGGAGTCTAGATGG - Intergenic
904746872 1:32716779-32716801 CTGGGGGAGGGGACAGGGCAGGG - Intergenic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904810028 1:33157461-33157483 CTGGGAAAGGTGAGACAGGATGG - Intronic
904833128 1:33318397-33318419 CACAGGAAGGGGAGAGTGAATGG - Intronic
904995412 1:34627706-34627728 GTGGGGAAGGGGAGGTAGGAAGG + Intergenic
905001790 1:34677803-34677825 TTGGGGAAGGGGAGAAGAGAAGG - Intergenic
905006566 1:34714621-34714643 CTGCGGAAGGAGAGACAGGAAGG + Intronic
905107205 1:35571348-35571370 CTTGGGAAGGCCAGAGTGGCGGG - Intergenic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905342252 1:37287299-37287321 ATGGGGAAAGAGAGAGTGAAGGG - Intergenic
905348648 1:37328924-37328946 CAGGGGAAGGGGAGAGAGATGGG + Intergenic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
905569451 1:38991816-38991838 CTGGGGGAGGAGAGCCTGGAGGG + Intronic
905636822 1:39559559-39559581 CTGGGGGTGGGCAGAGTGGGCGG - Intergenic
905743251 1:40390548-40390570 TTGAGGAAGGGGAGTGTGGATGG + Intronic
905746866 1:40425473-40425495 CAGGGGTAGGGGAGAATGGAGGG + Intergenic
905794034 1:40805427-40805449 ATGAGCAAGGGGAGAGTGGTGGG - Intronic
905914996 1:41678544-41678566 CTGGGGAAGAGGTGTGTGGGTGG - Intronic
905970558 1:42138693-42138715 CTGGGTATGGGGAGAGTGGGAGG - Intergenic
906090250 1:43172561-43172583 CCGGGGGAGGGGAAAGGGGAGGG + Exonic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906191969 1:43904746-43904768 CAGGAGGAGGGGAGAGTGGTGGG - Intronic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906391052 1:45416744-45416766 CAGAGGATGGGGTGAGTGGATGG - Intronic
906465898 1:46078962-46078984 CTGAGGGAGGGGAGAATGGGGGG + Intronic
906640177 1:47436998-47437020 CTGGGGCCAGGGAGAGGGGAGGG + Exonic
906725352 1:48040316-48040338 CTGGGGATGGGGAGAGGAGTGGG + Intergenic
906773107 1:48502768-48502790 CTGAGGATGAGTAGAGTGGATGG + Intergenic
906903203 1:49860745-49860767 CTGGGGAAGGGGATAATTTATGG - Intronic
907305933 1:53513224-53513246 CTGGGGAGGGGGAGCCCGGAAGG - Intronic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
907467862 1:54651441-54651463 CTGGGGAAGGGGAGTGGAGATGG + Intronic
907704462 1:56820454-56820476 TTGGGGATGGGCAGAGTGGGTGG + Intergenic
907766117 1:57412212-57412234 CAGAGGAAGGGGAAAGTAGACGG - Intronic
907791247 1:57666873-57666895 AGGGGGAAGGGGAGAGGGAAGGG + Intronic
907923505 1:58934592-58934614 CTGGGGCTGGGGGGAATGGAAGG + Intergenic
908109070 1:60876687-60876709 GAGGAGATGGGGAGAGTGGATGG - Intronic
908267080 1:62390002-62390024 CTGGGGTGGGGGGGAATGGAGGG + Intergenic
908322819 1:62994597-62994619 TTGGGGGATGGGACAGTGGATGG - Intergenic
908397532 1:63740157-63740179 AAAGGGAAGGGAAGAGTGGAAGG - Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908738475 1:67302384-67302406 TTTGGGAAGGAGAGACTGGAGGG + Intergenic
908920809 1:69189240-69189262 GTGGTGAAGGGGAGGGGGGAAGG - Intergenic
908930550 1:69312331-69312353 CTGGAGCCGGGGAGACTGGAGGG - Intergenic
909081353 1:71116427-71116449 CTGAGGAAGTGAAGAGGGGAAGG + Intergenic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909808301 1:79899625-79899647 CTGGGTAAGGGTTGAGTTGAGGG - Intergenic
909899020 1:81109589-81109611 CTGGGGAAGGGGTGAATGAAGGG - Intergenic
910245324 1:85132662-85132684 CTGGGAAAGGAGGGAGTGGGGGG - Intronic
910478536 1:87634228-87634250 CTGGGGAATGGGTGGGGGGAGGG + Intergenic
910730724 1:90392937-90392959 TTGGGCAAGAGGAGAGTGGAGGG - Intergenic
910968688 1:92832465-92832487 CTGGGGAACGCCAGAATGGAGGG + Intronic
911451404 1:98066501-98066523 TTGGGTAGGGGGATAGTGGAGGG + Intergenic
911887160 1:103317763-103317785 ATGGGGATGGTGAGGGTGGAAGG + Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912306072 1:108568806-108568828 CTGGGAAGGAGGAGAGGGGAAGG + Intronic
912406325 1:109441247-109441269 AAAAGGAAGGGGAGAGTGGAAGG - Intergenic
912701935 1:111884461-111884483 CTGGGGTGGGGGACAATGGAGGG + Intronic
913130774 1:115837490-115837512 CTGGGAAGGAGGAGAGAGGAGGG - Exonic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914900595 1:151709192-151709214 GTGGGGAAGGGGGAAGTGGGTGG + Intronic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915147957 1:153806490-153806512 CTGGGGAAGGGGAGGGGGTAGGG - Exonic
915243729 1:154541856-154541878 GTGAGGATGGAGAGAGTGGACGG + Intronic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915292660 1:154897032-154897054 CAGAGGAAGGGGTGAGGGGAAGG + Intergenic
915399484 1:155611898-155611920 CTGGGGAAGGGCAGGGAAGATGG - Intronic
915416597 1:155747478-155747500 CTGGGGAAGGGCAGGGAAGATGG - Intergenic
915496647 1:156286491-156286513 GTGGGGCATGGGAGAGGGGATGG + Intronic
915536096 1:156536475-156536497 TAGGAGAAGGGGAGAGAGGATGG + Intronic
915555342 1:156657970-156657992 CCGGGGAAGGGGAAAGGAGAGGG - Intronic
915556437 1:156663442-156663464 ATGGGGGTGGGGAGAGTGAATGG + Intergenic
915564102 1:156704493-156704515 CTGGGGCAGGGGAGAGTGCCAGG - Intronic
915595441 1:156894007-156894029 GAGGGGAAGGGGACAGTGGAGGG + Intronic
915610313 1:156986605-156986627 CAAAGGAAGGGGAGACTGGAGGG + Intronic
915856196 1:159388996-159389018 CTGGGGAAGGTGAGCTTGAAGGG + Intergenic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
915940978 1:160117938-160117960 TTGGGGGAGGGAGGAGTGGAGGG + Intronic
916285417 1:163100176-163100198 ATGGGGAAGAGGTGTGTGGATGG + Intergenic
916523825 1:165590601-165590623 TTGGGGAATGAGAGAGTGGTGGG - Intergenic
917027792 1:170661671-170661693 GTGGGGGCGGGGAGAGTGGGGGG + Intergenic
917256174 1:173118709-173118731 CAGGGAAAAGGGAGAGGGGAAGG + Intergenic
917261987 1:173179761-173179783 AAGAGGAATGGGAGAGTGGAAGG + Intergenic
917405041 1:174696686-174696708 CTTGGGAAAGGGAGAGAGCAGGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917510269 1:175663813-175663835 CTGGGGAACTGGAGAGTCCAAGG + Intronic
917537172 1:175882676-175882698 GAGGGCCAGGGGAGAGTGGATGG + Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
918144069 1:181740514-181740536 GTGGGGGTGGGGATAGTGGAGGG + Intronic
918202527 1:182280436-182280458 CTGGGGAGGGGTAGAGGGGAGGG + Intergenic
918799356 1:188953123-188953145 CTGTGGATGGGGTGAGTGAAGGG + Intergenic
918918141 1:190671222-190671244 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
919090748 1:192976685-192976707 CTGGGGAAGGGGAATGTCAAAGG - Intergenic
919758754 1:201083323-201083345 CTGAGGGAGGGGACAGAGGATGG + Intronic
919804575 1:201373576-201373598 GTGGGGGTGGGCAGAGTGGATGG - Intronic
919967146 1:202539214-202539236 CTGAGGCAGGGGACACTGGAAGG + Intronic
920006304 1:202836014-202836036 CTGGAGATGGAGAGAGGGGAAGG - Intergenic
920071230 1:203304707-203304729 TGGGGGAAGGAGGGAGTGGACGG + Intergenic
920255614 1:204652225-204652247 AGGGCGAAGGGGAGAGAGGAGGG - Intronic
920268872 1:204747782-204747804 CTGCAGAAGAGGAGAGGGGATGG + Intergenic
920295619 1:204954421-204954443 CTGGGTAAATGGAGAGTGGGGGG + Intronic
920440729 1:205978929-205978951 CTGGGGAAGGAAAGAGAGGCCGG + Intronic
920605759 1:207383165-207383187 CTGGAGTAGGCAAGAGTGGATGG - Intergenic
920678518 1:208055405-208055427 CTGAGGATGGGGAGAGATGAAGG + Intronic
920706294 1:208252977-208252999 ATGGGGGTGGGGAGAGGGGAGGG - Intergenic
920707684 1:208266505-208266527 CTGGGAAAGGTGGGAGAGGAGGG - Intergenic
920730978 1:208484128-208484150 GTAGGGAAGGGGAGAGAGAAAGG + Intergenic
920837421 1:209524565-209524587 CTGGAGGCTGGGAGAGTGGAGGG + Intergenic
921177934 1:212609451-212609473 ATGGGGAAGGGGCGAGAGGGCGG + Intronic
921363638 1:214353516-214353538 ATGGGGAAAGGGAGACTAGAAGG + Exonic
921377454 1:214489347-214489369 GTGGGCAAGGGGAGAGGGCATGG - Intronic
921734572 1:218612365-218612387 CTGGGACATGGGTGAGTGGATGG + Intergenic
922002463 1:221493904-221493926 TTGAGGAAGGAGAGAGGGGAAGG - Intergenic
922035734 1:221846158-221846180 CTTGGGAAGAGGTGAGGGGAGGG + Intergenic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922196537 1:223364353-223364375 GTGGGGACGGGGTGAGTGGGGGG + Intergenic
922207342 1:223459979-223460001 CTGGGGAAGAGGAAACTGCAAGG - Intergenic
922494786 1:226048048-226048070 CTGGGGAAGGGGAGAGGCTCTGG - Intergenic
922542316 1:226428702-226428724 CTGGGGAGGGAGAGAAAGGATGG - Intergenic
922554639 1:226523590-226523612 CTGGGGAAAGGGATAATGTAAGG - Intergenic
922597341 1:226824127-226824149 AAGGGGAAGGTGAGAGTGGAGGG + Intergenic
922644712 1:227275594-227275616 GTGGGGAGGGGGAGAGGGGGAGG - Intronic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922737842 1:227998959-227998981 CTAGGGAACAGGAGAGTGGGGGG - Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922894430 1:229089283-229089305 TTGAGGAGGGGGAGAGAGGAGGG + Intergenic
923056161 1:230426675-230426697 CTGCGGAAGGGGACAGTGAGCGG - Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923272548 1:232370792-232370814 CAGGGGAAAGGAAGAGTGAATGG + Intergenic
923619582 1:235567459-235567481 TGGGGGAAGGAGAGAATGGAGGG - Intronic
923660971 1:235957068-235957090 CTTAGGGAGGGGACAGTGGAGGG - Intergenic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924592096 1:245413797-245413819 GTCCTGAAGGGGAGAGTGGAGGG + Intronic
924944701 1:248838451-248838473 CTGGGGCGGGGGAGCGAGGAAGG - Exonic
1062976900 10:1690768-1690790 CTGGGGAGGGGGTGACAGGAAGG - Intronic
1063385229 10:5612389-5612411 GTGGGGAAGTGGAGATGGGAAGG - Intergenic
1063528204 10:6804288-6804310 GTGGGGTAGGGGAGGGAGGAGGG - Intergenic
1063669831 10:8091150-8091172 TTTGGGAAGGTGAGAGGGGAGGG + Intergenic
1063768380 10:9169168-9169190 GTGGGGAAAGGGAAAGTGGGAGG + Intergenic
1063873000 10:10439782-10439804 CTGGGGCGGGGGAGAGGGGAGGG + Intergenic
1063925071 10:10969588-10969610 ATGGGGAAGGGGAGAGGGAGGGG - Intergenic
1063939223 10:11109820-11109842 CAGGGGGCGGGGAGAGAGGAAGG - Intronic
1064457086 10:15497829-15497851 TTGGAGAAGGAGGGAGTGGATGG + Intergenic
1064714745 10:18165257-18165279 CTGTGGAAGGGCAGAGAGGAGGG + Intronic
1065204512 10:23344224-23344246 GGGGGGAAGGGGAGAGGGAAAGG + Intronic
1065563756 10:26988957-26988979 GTGGGGAAGGGGAGTGTTGCAGG + Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1066369814 10:34811078-34811100 AAGGGGAAGGAGAGAGTGAAGGG - Intronic
1066594833 10:37038893-37038915 GTGGGGTAGGGGAAAGGGGAAGG - Intergenic
1066985997 10:42466873-42466895 CAGGTGAAAGGGAGAGAGGATGG + Intergenic
1067125461 10:43511890-43511912 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
1067231913 10:44418007-44418029 TGAGGGAAGGGGACAGTGGAGGG + Intergenic
1067472774 10:46548496-46548518 CTGAGGAAGGGGAGAATGGGTGG - Intergenic
1067551872 10:47242048-47242070 CTGGGGAGGGGAAGAGAGCAGGG + Intergenic
1067687638 10:48476711-48476733 CTGGGGAAGGGGTCAGTCTAGGG + Intronic
1067828671 10:49597558-49597580 CTCAGGAAGGGGGGAGAGGAGGG - Intergenic
1068007581 10:51408924-51408946 CTGGGGAAGAGGTGTGTGGATGG - Intronic
1068175602 10:53453424-53453446 CTGAGGCAGGGCAGAGTGAAAGG + Intergenic
1068390836 10:56394882-56394904 CTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1068405289 10:56580740-56580762 CTGGGGATGGGGATAGGGGTGGG + Intergenic
1068405619 10:56585144-56585166 CTGAGAAGGGGGAGAGTGGGAGG - Intergenic
1068568863 10:58606412-58606434 CTGGGGTGGGGGAGGGGGGAGGG + Intronic
1069111794 10:64456727-64456749 ATGGGGGAGGGGGGAGGGGAGGG - Intergenic
1069635739 10:69923779-69923801 CTGGGGAAGAGGAGAGAGTTGGG - Intronic
1069711465 10:70491745-70491767 CTGGGGGAGGGGAAACTGGGAGG - Intronic
1069853036 10:71422902-71422924 CTGGGGGAGGGCAGAGCAGAGGG + Intronic
1069895338 10:71677047-71677069 CTGGTGAAGGGCAGGGTGGTTGG - Intronic
1069917286 10:71795558-71795580 GTGGGCAAGGGAGGAGTGGAGGG - Intronic
1070039707 10:72763907-72763929 GTGTGGAAGGGGAGTGTGAAGGG - Intronic
1070126430 10:73625855-73625877 CTGGGGAGGGGGTGCGGGGAAGG - Intronic
1070282086 10:75057371-75057393 CTGGAGTCCGGGAGAGTGGAGGG + Intronic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070437336 10:76406126-76406148 CAGGGGAAGTGCTGAGTGGATGG + Intronic
1070491505 10:76981161-76981183 TTGGGGAAGGAGAGAGAGTATGG - Intronic
1070575420 10:77673526-77673548 AAGGGGAAGAGGAGAGTGAATGG - Intergenic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070610173 10:77927110-77927132 CCTGGGGAGGGGAGAGAGGAGGG - Intergenic
1070831434 10:79420271-79420293 CTTGGGGAGGGGACAGGGGAAGG - Intronic
1070838495 10:79467043-79467065 CAGGGGCTGGGGAGGGTGGAGGG + Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071204195 10:83255014-83255036 GTGGGGGAGGGGAGGGGGGAGGG - Intergenic
1071546127 10:86531098-86531120 CTGGGGAAGGGGGTTGGGGAGGG + Intergenic
1071570017 10:86691643-86691665 CTGGGGAAGGGCAGACCTGAGGG + Intronic
1071847426 10:89535339-89535361 CTAGGGCAGCGGAGAATGGAGGG + Intronic
1071890632 10:90002801-90002823 CTGGGGAGGGGCCGAGTGGGGGG + Intergenic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1072050574 10:91699396-91699418 ATGGGGCAGGGGAGAGAGGGAGG - Intergenic
1072450389 10:95534882-95534904 TTGGGGAAGCACAGAGTGGAGGG - Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073251173 10:102121007-102121029 TTAGGGAAGGGGTGAGTTGAGGG - Intergenic
1073275019 10:102302250-102302272 CTGTGGAAAGGGAGAGGGAAAGG + Intronic
1073526267 10:104185040-104185062 CTGGTGAATGGGAGAGATGATGG - Exonic
1073533330 10:104253163-104253185 CTGGGGAGGGAGCGAGTGGGTGG + Intronic
1073784610 10:106875110-106875132 CTCAGGAGGAGGAGAGTGGAAGG - Intronic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074658487 10:115622003-115622025 GTGTGGAAGGGGAGAGCAGAGGG + Intronic
1074689953 10:115995275-115995297 CTGGTGGAGGGGTAAGTGGACGG + Intergenic
1074754984 10:116617813-116617835 CAGGGAAAGGGGAGAGTGTCAGG + Intergenic
1074772933 10:116744992-116745014 GGGGGGAATGGGAGAGTGGAAGG - Intergenic
1074830082 10:117241614-117241636 CTGGGGGACGGGAGAATGGGGGG + Intronic
1074844881 10:117388981-117389003 CGGGGAAAGGGGAAAGTGAAGGG - Intergenic
1074898391 10:117796205-117796227 CTGGGGAAGGGATGAGGGGTGGG + Intergenic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1074911736 10:117916301-117916323 CTTGGGGAGGGGAGACAGGAGGG + Intergenic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075079168 10:119371237-119371259 CCGGGCTAGGGGAGAGTGGGCGG - Intronic
1075212610 10:120503689-120503711 CTGGGGAAGGGGAAAGAGACAGG - Intronic
1075585443 10:123653802-123653824 AGGGGGAAGGGGGGAGGGGAGGG + Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075974779 10:126685827-126685849 ATGGGGAGGAGGAGATTGGATGG - Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076107983 10:127839502-127839524 ATGGGGCAGGGGTGAGGGGAGGG + Intergenic
1076117178 10:127908440-127908462 GTGGGGAGGGGGGGTGTGGAGGG + Intronic
1076204562 10:128586569-128586591 CTTGGGAATGGAAGAGGGGAGGG - Intergenic
1076312539 10:129518561-129518583 CTGGGGAGGGGGAGGGGGAAGGG - Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076396537 10:130142315-130142337 TTGGGAGAGGTGAGAGTGGAAGG - Intronic
1076735989 10:132459222-132459244 CTGGGCAAGGTGTGACTGGAGGG + Intergenic
1076747400 10:132521323-132521345 CCCTGAAAGGGGAGAGTGGAAGG + Intergenic
1076757291 10:132579194-132579216 CGGGGGAAGGAGAGTGTGGGGGG + Intronic
1076826786 10:132973383-132973405 CTGGGCAGGGGCAGACTGGATGG + Intergenic
1076846447 10:133071731-133071753 CTGGGGAAGGAGTGTGTGGCTGG - Intronic
1076981068 11:205056-205078 CTGGGGGAGGGGGGAGGGGCTGG + Exonic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077078018 11:709948-709970 CTGGGGAAGGGCAGAGTGGGGGG - Intronic
1077166753 11:1145152-1145174 CTGGAGACTGGGAGAGGGGACGG + Intergenic
1077227602 11:1445177-1445199 CTGGGCACAGGGAGAGTGGCAGG + Intronic
1077299986 11:1842319-1842341 CTGGGCACGGGGAGCGTGGAGGG + Intergenic
1077320536 11:1938971-1938993 CTATGGGAGTGGAGAGTGGAGGG - Intergenic
1077343763 11:2037281-2037303 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1077364096 11:2154610-2154632 CAGGGGCAGGGGTGAGTGGAAGG - Intronic
1077484055 11:2830802-2830824 CTGATGATGGGGAGAGGGGAAGG - Intronic
1077791537 11:5446104-5446126 GTGGGGTGGGGGAGAGTGGAGGG + Intronic
1077852367 11:6085450-6085472 CTGGGGAAGGGGTGAGTGAGGGG - Intergenic
1078103434 11:8343680-8343702 CTGGGGAAGGGGAGAGGGAGAGG - Intergenic
1078133738 11:8635432-8635454 CTGGGGTTGGGCAGGGTGGAGGG - Intronic
1078441563 11:11372633-11372655 CAGGGGCAGGGGAGAGCAGAAGG + Intronic
1078461695 11:11519692-11519714 CAGGGGAATGGGAGAGTGCCTGG - Intronic
1078599157 11:12715389-12715411 CTGGGGAGGAGGAGAGGGTATGG + Intronic
1078659578 11:13276641-13276663 CTGGGGTAGGGTGGAGTGGTGGG - Intronic
1078724838 11:13920732-13920754 CTACGGATGGGGAGAGTTGAGGG + Intergenic
1078858478 11:15225904-15225926 CTGAGGCAGGGGAGAGAGCATGG + Intronic
1078868953 11:15326312-15326334 TTGGGGAAGTGGAGAGGAGAAGG + Intergenic
1078967081 11:16358271-16358293 CAGGAGAATGGCAGAGTGGAAGG - Intronic
1079002957 11:16773094-16773116 CTCGGGAAGGTGAGGTTGGAGGG - Intergenic
1079167536 11:18059590-18059612 GTGGGGTGGGGGAGAGGGGAGGG + Intergenic
1079279798 11:19076899-19076921 CTGGGGCAGGGGAGAGGAGATGG - Intergenic
1079337294 11:19581508-19581530 GTGGGGTGGGGGAGAGGGGAGGG - Intronic
1079438713 11:20486169-20486191 CTGGGCAAGAAGAGAATGGATGG + Intronic
1079709797 11:23666771-23666793 CTGGGGTAGGGGTAAGTGAAAGG - Intergenic
1079754249 11:24235400-24235422 TTGGAGAAGGGGTGAGTGAAGGG - Intergenic
1080830443 11:35888939-35888961 GAGGGGAAGCTGAGAGTGGATGG - Intergenic
1080928745 11:36785226-36785248 CTGGGGAAGGGGATAGAACAGGG + Intergenic
1081000188 11:37659739-37659761 GTGGGGTGGGGGAGGGTGGAGGG + Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081745773 11:45471386-45471408 CTGGTGGAGGGAAGAGGGGAAGG - Intergenic
1081745935 11:45472422-45472444 CTGGGAGAGGGGAAAATGGAGGG + Intergenic
1082667921 11:55997519-55997541 GTGGGGTTGGGGAGAGGGGAGGG - Intergenic
1082938279 11:58676644-58676666 GTGGGAAAGGGAAGAGTTGAGGG - Intronic
1082999749 11:59280497-59280519 TTGGGGAAGAGGTGTGTGGATGG + Intergenic
1083044099 11:59716831-59716853 CTGGGGTAGGGTAGAAGGGAAGG - Intronic
1083106366 11:60361914-60361936 CTGGGGAAGGAGGGAGGGGGAGG + Intronic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083258970 11:61513037-61513059 AGGGGGCAGGGGAGACTGGAAGG + Intergenic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1083738013 11:64692747-64692769 GAGGGGAAGGGGACAGGGGAAGG + Intronic
1083826449 11:65206693-65206715 CTGGGAGAGGGGAGAGTGGCAGG - Intronic
1083887277 11:65579055-65579077 CTGGGGGAGGGGGAAGGGGAGGG - Intronic
1083891154 11:65596387-65596409 CTGTGGCAGGGGAGAGTTGGGGG + Intronic
1083899497 11:65636743-65636765 CTGGGGGAGGGGGGAGAGGTTGG - Intronic
1084008020 11:66333458-66333480 GCAGGGAAGGGGAGAGGGGATGG - Intronic
1084068332 11:66718369-66718391 CTGGGTGTGGGGAGAGTGGCCGG - Intronic
1084117308 11:67049799-67049821 CCGGGGAAGGCCAGGGTGGAAGG + Exonic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084233693 11:67771868-67771890 CTGGGGAAGGGGGGATGGGGAGG + Intergenic
1084268185 11:68015492-68015514 CTGGGGCAGGGGGGCATGGAGGG + Intronic
1084398625 11:68931090-68931112 GAGTGGAAGGGGACAGTGGAAGG - Intronic
1084432234 11:69117514-69117536 CTGGGGAAGGGGAGCGAGAAGGG + Intergenic
1084461226 11:69297763-69297785 CTGGGGTAGGGGAGTGAGGCAGG - Intronic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084575649 11:69986336-69986358 CCGGTGAAGGCGAGAGGGGAGGG + Intergenic
1084662519 11:70554542-70554564 CTGGGGGAGGGGGGAGGAGAGGG - Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084779626 11:71399775-71399797 CTGGGGGAGGGCAGTGTGGAGGG + Intergenic
1084786013 11:71442041-71442063 CTGGGTAAGGAGGGAATGGATGG - Intronic
1084953191 11:72677989-72678011 GTGGGGATGGAGGGAGTGGATGG - Intergenic
1084970385 11:72768313-72768335 TCAGGGAAGGGCAGAGTGGAGGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085243919 11:75082301-75082323 CTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1085250448 11:75140283-75140305 CTGTGGAGGGAGACAGTGGATGG - Intronic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1085297509 11:75439383-75439405 AGGGGGAGGGGGAGAGAGGAGGG + Intronic
1085654718 11:78303039-78303061 CTCGGGAAAGGGTGAGAGGAGGG + Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086372829 11:86171866-86171888 GTGGGGAAGGGTAGAGCAGAGGG + Intergenic
1086745012 11:90414190-90414212 CAGGGTGAGGGGAGAGGGGAGGG - Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087622216 11:100555184-100555206 AGGGGGAAGGGGTGAGGGGAAGG - Intergenic
1088430203 11:109750424-109750446 CTGAGGAAGGGGACAGAAGATGG - Intergenic
1088788505 11:113203632-113203654 CTGGGGAAAGGAAGAATGGGTGG + Intronic
1088834344 11:113565280-113565302 CTGGGGAAGGGCACAGTAGCAGG + Intergenic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089018854 11:115190401-115190423 GTGGGGAAGGGCAGGGAGGAGGG - Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089520573 11:119059931-119059953 CTGGGGAAAGGGGGAGGGGGAGG + Intergenic
1089561108 11:119343623-119343645 CTGGGGACAGGGAGAGTGTGGGG + Intronic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090142174 11:124277071-124277093 CTGGGAAAGGAGTGAGTGAAGGG + Intergenic
1090212963 11:124935844-124935866 CAGACGGAGGGGAGAGTGGAGGG - Intronic
1090358135 11:126154327-126154349 CAGGGGAAGAGGAGATTGCAGGG + Intergenic
1091124345 11:133082377-133082399 CGGGGGAGGGGAAGAGGGGAGGG - Intronic
1091208855 11:133839530-133839552 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1091297687 11:134485485-134485507 TTGGGGAAGGGGAGCCAGGAGGG + Intergenic
1202826749 11_KI270721v1_random:92470-92492 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1091391436 12:128677-128699 CTGGGGAAGGCAAGAGAGGGTGG - Intronic
1091648840 12:2294485-2294507 CTGGGGCAGTGGAGAGTGAGGGG + Intronic
1091753814 12:3038987-3039009 CTGGGGAAGGGGTGAGGAGAGGG - Intronic
1092140787 12:6182095-6182117 CAGGGGATGGGGACAGGGGATGG + Intergenic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093609035 12:21131978-21132000 GTGGGGTGGGGGAGAGGGGAGGG - Intronic
1093618964 12:21264543-21264565 CTAGGGAAGAGGAGAAAGGAAGG + Intergenic
1094525418 12:31227774-31227796 CCAGGGAGGGTGAGAGTGGAGGG + Intergenic
1095085292 12:38053437-38053459 TAGGGGAAGGGGAGAGAAGACGG + Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095527234 12:43141527-43141549 CTGGGCAAGGGCAGAGTGGCAGG + Intergenic
1095631696 12:44384401-44384423 GTGGGGAAGTGCAGAGGGGAAGG - Intronic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1096108650 12:49015055-49015077 ATGGGCTAGGGGAGAGTGCAGGG + Intronic
1096116591 12:49059067-49059089 CTGGGCAAAGGGAGAGTGTGTGG - Intronic
1096144300 12:49267111-49267133 CGTGGCCAGGGGAGAGTGGAGGG + Intronic
1096319423 12:50598761-50598783 GAGGGGGAGGGGAGAGGGGAGGG - Intronic
1096319447 12:50598803-50598825 GAGGGGAGGGGGAGAGGGGAGGG - Intronic
1096319454 12:50598816-50598838 GAGGGGAGGGGGAGAGGGGAGGG - Intronic
1096319461 12:50598829-50598851 GAGGGGAGGGGGAGAGGGGAGGG - Intronic
1096319468 12:50598842-50598864 GAGGGGAGGGGGAGAGGGGAGGG - Intronic
1096319475 12:50598855-50598877 GAGGGGAGGGGGAGAGGGGAGGG - Intronic
1096319482 12:50598868-50598890 GAGGGGAGGGGGAGAGGGGAGGG - Intronic
1096539139 12:52294471-52294493 ATGGGGAAGGGAGGAGGGGAGGG + Intronic
1096660020 12:53118486-53118508 CTCAGGGAGGGGAGAGTAGAAGG - Intronic
1096790898 12:54044230-54044252 CTGGGGAAGGGAGGAAAGGAGGG - Intronic
1096909211 12:54965338-54965360 CAGGGGATGGGGTGAGAGGAGGG - Intronic
1096948436 12:55436915-55436937 CATGGGAAGGAGAGAGTGGCAGG - Intergenic
1097035254 12:56119604-56119626 CTGGGGGTGGAGAGAGGGGAGGG + Intronic
1097641700 12:62191097-62191119 CCGGGGAAGGCGAGAGGTGAGGG - Intronic
1097773621 12:63620171-63620193 CTGGGGAAGCAGAGAGTAAATGG - Intronic
1098031539 12:66259770-66259792 CTGGTCAAGGGGAAAGTGGTAGG - Intergenic
1099144212 12:79018343-79018365 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
1099785017 12:87251109-87251131 CTTGGGAAGGAAAGAGAGGAAGG - Intergenic
1099865670 12:88277831-88277853 CTGGGTGGGGGGAGTGTGGAGGG - Intergenic
1099924120 12:88996679-88996701 CTGTGGAAGGAGAGAGTAAAAGG - Intergenic
1100177796 12:92050649-92050671 CTGGGGAAGGGTTGGGGGGATGG + Intronic
1100239106 12:92692694-92692716 GTGGGGAAGGGAAAAATGGAAGG + Intergenic
1100829387 12:98503911-98503933 TTGGGGGAGGGGAGAGAGGGCGG + Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101443283 12:104719423-104719445 GTGGGCAAGGGGAGCGTGGGTGG - Intronic
1101663985 12:106793064-106793086 ATGAGGAAGGGCAGAATGGAAGG - Intronic
1101686685 12:107030777-107030799 GTGGGGAAGGGGGCAGGGGAAGG + Intronic
1101909221 12:108850003-108850025 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1101909258 12:108850099-108850121 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1101909275 12:108850139-108850161 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1101909324 12:108850259-108850281 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1101967297 12:109290404-109290426 CTGGGGACGGGCAGGTTGGAGGG - Intronic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1102047172 12:109836537-109836559 CTGGGGGAGAGGAGAATGGGAGG + Intergenic
1102182691 12:110924097-110924119 CTGGGGAGGGAGCGAGTGGGCGG + Intergenic
1102212627 12:111138361-111138383 GTGGGGGTGGGGAGAGAGGAGGG + Intronic
1102540987 12:113619143-113619165 CTGGGGTAGGGGCGAGTGAGTGG + Intergenic
1102543322 12:113637954-113637976 CTGGGGAAGGGGTGGGGGTAGGG - Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102631901 12:114288418-114288440 TTGGGGAGAGGGAGAGAGGAGGG + Intergenic
1102634044 12:114307109-114307131 CTGGGGCAGGGGTGACTGCAAGG + Intergenic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1102789706 12:115634789-115634811 CCGGGGATGGGGAGAGTGGTAGG - Intergenic
1102810274 12:115818410-115818432 CTTGAGAAGAGGAGAGAGGAAGG - Intergenic
1102826265 12:115950169-115950191 CTGGGTAAGAGGTGAGGGGAAGG + Intergenic
1103070514 12:117937360-117937382 CTTGAGAAGGGTAGGGTGGAGGG - Intronic
1103425578 12:120830519-120830541 GTGGGGAGGGGGAGAGCAGAGGG + Intronic
1103606140 12:122087388-122087410 CTGGGGCTGGGGAGGGTGGGTGG + Intronic
1103794550 12:123494414-123494436 ATGGGGCAGGGAAGAGAGGAGGG - Intronic
1103884006 12:124187571-124187593 GGGTGGAGGGGGAGAGTGGAGGG + Intronic
1103929344 12:124440966-124440988 CTGGGGAGGGGCAGAGAGGACGG + Intronic
1104109923 12:125695332-125695354 CTGGGAGAGGGGAGAATGGCTGG - Intergenic
1104544506 12:129698743-129698765 AGGGGGAAGAGGAGAGGGGAGGG + Intronic
1104757662 12:131279158-131279180 GTGGGGAGAGGGAGAGGGGAAGG + Intergenic
1104914234 12:132256587-132256609 CAGTGGAGGGGGACAGTGGAGGG + Intronic
1105213641 13:18272282-18272304 CTGGGACAGGGTGGAGTGGAGGG - Intergenic
1105546615 13:21355449-21355471 CTGGGGAGGGGGAGGAGGGAAGG + Intergenic
1106086873 13:26550731-26550753 GTGGGGAAGGGGAGGGTGCCTGG - Intergenic
1106138473 13:26991858-26991880 CTGGGGTAGGGGAGAAGGGAAGG - Intergenic
1106180964 13:27369037-27369059 ATGGGGAAGGGGTGAGAGTAGGG + Intergenic
1106269283 13:28138483-28138505 AAGGGGGAGGGGAGAGGGGAGGG - Intergenic
1106319349 13:28623816-28623838 ATGGGGAAGAGGAGAATTGAAGG + Intergenic
1106898973 13:34334921-34334943 CTGAGGAAGAGGAGAGTGCAGGG + Intergenic
1107955412 13:45506570-45506592 CTGGGGTAGGGGTGTGAGGATGG + Intronic
1108585554 13:51867000-51867022 CTGGGGGTGGGGAGATTAGATGG + Intergenic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1108688898 13:52845734-52845756 CTGGGGGAAGGGAGACTGGAGGG - Intronic
1109069861 13:57750667-57750689 CTGGGGAAGTAGAGACTGCAGGG + Intergenic
1109181898 13:59223889-59223911 CAGGAGAAGGGGAGAAGGGAAGG + Intergenic
1109483322 13:62985534-62985556 CTGGGGAAGAGGCTTGTGGATGG - Intergenic
1109574929 13:64242990-64243012 CTGGTGAAGGAGAGACTGCAGGG + Intergenic
1109673993 13:65648711-65648733 CTGAGGAAGGGAGGAGTGTACGG + Intergenic
1109895102 13:68676766-68676788 AGGGGGAAGGGGAGAGGGGAGGG - Intergenic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1110595143 13:77312446-77312468 CTGGGGGAGGGGAGAATAAAAGG + Intronic
1110728663 13:78855052-78855074 GTGGGGTGGGGGAGAGGGGAGGG - Intergenic
1110761654 13:79237205-79237227 GTGGGGTGGGGGAGAGGGGAGGG + Intergenic
1110788358 13:79560185-79560207 AGGGGGAAGGGGGAAGTGGAGGG - Intergenic
1110932779 13:81243457-81243479 ATAGGGAAGGGGAAAGTGGTAGG - Intergenic
1111057711 13:82972392-82972414 TTGGGGAAGGGGTATGTGGATGG - Intergenic
1111091324 13:83452020-83452042 CTGGTGAGGGGCAGAGTGGATGG - Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1112217607 13:97449543-97449565 GTGGGGCAAGGGAGAGTGGATGG - Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1113183896 13:107664125-107664147 TTTGGGAATGGGAGAGTGGGAGG - Intronic
1113257983 13:108528614-108528636 GAGGGGAGGGGGAGAGGGGAGGG - Intergenic
1113264186 13:108598995-108599017 CTGGGGATGGGGTGGGGGGAGGG - Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113536345 13:111069348-111069370 CTGTGGGAGGGGAGAGTGTAAGG + Intergenic
1113738306 13:112693458-112693480 GTGGGTACGGGGAGAGGGGACGG + Intronic
1113741256 13:112713998-112714020 CAGGGGTGGGGGGGAGTGGAAGG - Intronic
1113794525 13:113049336-113049358 GTGGGGAAGGGGTGGGTGGTGGG + Intronic
1113796620 13:113061938-113061960 GTGGGGGTGGGCAGAGTGGATGG - Intronic
1113861785 13:113491344-113491366 CCGGGGAGGGAGAGAGGGGAGGG - Intronic
1113861798 13:113491373-113491395 CTTGGGAAGGGAAGAAGGGAAGG - Intronic
1113881436 13:113628908-113628930 CTGTTGAATGGGAGACTGGAAGG + Intronic
1113899352 13:113788048-113788070 GTGGGGATGGGCAGAGGGGAAGG + Intronic
1113899366 13:113788079-113788101 GTGGGGATGGGCAGAGGGGAAGG + Intronic
1113899380 13:113788110-113788132 GTGGGGATGGGCAGAGGGGAAGG + Intronic
1113899394 13:113788141-113788163 GTGGGGATGGGCAGAGGGGAAGG + Intronic
1113899408 13:113788172-113788194 GTGGGGATGGGCAGAGGGGAAGG + Intronic
1113899422 13:113788203-113788225 GTGGGGATGGGCAGAGGGGAAGG + Intronic
1113899436 13:113788234-113788256 GTGGGGATGGGCAGAGGGGAAGG + Intronic
1113899450 13:113788265-113788287 GTGGGGATGGGCAGAGGGGAAGG + Intronic
1113899464 13:113788296-113788318 GTGGGGATGGGCAGAGGGGAAGG + Intronic
1113899478 13:113788327-113788349 GTGGGGATGGGCAGAGGGGAAGG + Intronic
1113899492 13:113788358-113788380 GTGGGGATGGGCAGAGGGGAAGG + Intronic
1113992952 14:16042610-16042632 TGGGGGAAGGGGAGAGAAGACGG - Intergenic
1114042210 14:18689414-18689436 CTGGGGAAAGGGAGTGTGGGAGG + Intergenic
1114070110 14:19099026-19099048 CCGGGGCAGGGAAGCGTGGACGG + Intergenic
1114092153 14:19300976-19300998 CCGGGGCAGGGAAGCGTGGACGG - Intergenic
1114250649 14:20957295-20957317 GTCGGGAAGGGGTCAGTGGATGG - Intergenic
1114265188 14:21069622-21069644 CTGGGGAAGGCGGGAGTGTGCGG - Intronic
1114320015 14:21539439-21539461 GTGGTGAAGTGGAGAGGGGAGGG + Intergenic
1114450093 14:22819683-22819705 CTGAGTCAGGGGAGAGGGGAAGG + Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1114527718 14:23376986-23377008 ATGGGGAGGGGCAGAGAGGAAGG - Exonic
1114777333 14:25498659-25498681 CTGGGGTGGGGGAGGGGGGATGG + Intergenic
1115227680 14:31121271-31121293 GTGTGGAAGGGGTGAGAGGAGGG - Intronic
1115320753 14:32077141-32077163 CTGGGGAAGGGGGGAGGGACGGG + Intronic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1115724151 14:36194666-36194688 GAGGGGGAGGGGAGAGGGGAGGG + Intergenic
1116885228 14:50214203-50214225 TTGGGGAATGGGGAAGTGGAAGG + Intronic
1117294705 14:54368713-54368735 CCTGGGAAGGGGCTAGTGGATGG + Intergenic
1117555263 14:56877222-56877244 GTGGGGGAGGTCAGAGTGGAGGG + Intergenic
1117634218 14:57725006-57725028 CTGGGGAAGAGATAAGTGGATGG + Intronic
1117866923 14:60159755-60159777 CTGGGGGAGGGGAGATAGGAAGG - Intronic
1118329052 14:64801625-64801647 CTGCTGAAGGGGAGAGGAGAAGG + Intronic
1118731607 14:68670692-68670714 CAGTGGAAGATGAGAGTGGATGG - Intronic
1118910812 14:70060472-70060494 GTGGGGTGGGGGAGAGTGCAGGG + Intronic
1119096551 14:71838239-71838261 GTGGGGTGGGGGAGAGGGGAGGG - Intergenic
1119125047 14:72117610-72117632 GTGAGGAAGGGAAGAGAGGAGGG + Intronic
1119159885 14:72444008-72444030 CAGGGCAAGGGGAGAGTGTGCGG - Intronic
1119184813 14:72632756-72632778 GAGGGGAAGGGGAGAGAAGAGGG + Intronic
1119184843 14:72632828-72632850 GAGGGGAAAGGGAGAGGGGAGGG + Intronic
1119383860 14:74245311-74245333 CCGAGAGAGGGGAGAGTGGAGGG - Intronic
1119529856 14:75352517-75352539 ATGGGGAAGGGAAGAGAGGGTGG - Intergenic
1119768498 14:77205717-77205739 CTGGGGGAGGTGAGACTGGAGGG + Intronic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120759771 14:88274969-88274991 TTGGGGTAGGGGTGAGGGGAAGG - Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1120929236 14:89831660-89831682 ATGGTGAAGGGAAGAATGGAAGG + Intronic
1121123766 14:91392982-91393004 CTGGGGAAGGAGAAACTGCAAGG + Intronic
1121186163 14:91971617-91971639 AAGGGGAAGGGAAGAGAGGAAGG + Intronic
1121235978 14:92391492-92391514 ATGGGGTAAGGGAGTGTGGACGG - Intronic
1121729247 14:96174836-96174858 CTGGAGAGGGGGAGAGGGAAAGG + Intergenic
1121739864 14:96243725-96243747 CTGAGGCAGAGGAGAGTGGGTGG - Exonic
1121870462 14:97402380-97402402 CTGGGGAAGGTAAGAGTGAAAGG + Intergenic
1122098253 14:99386986-99387008 ATGGACAAGGGGAGACTGGAAGG + Intergenic
1122211837 14:100178565-100178587 CTGGGGAAGGGGAGTGGAGCAGG + Intergenic
1122254222 14:100464852-100464874 ATGGGGTAGGGGAGAGTAGATGG - Intronic
1122254241 14:100464947-100464969 ATGGGGTAGGGGAGAGGAGATGG - Intronic
1122329759 14:100904355-100904377 GTGTGGACGGGGAGAGGGGAGGG + Intergenic
1122393475 14:101406798-101406820 CTGGGGGAGGGGAGAAGGGGGGG - Intergenic
1122411426 14:101527964-101527986 CTGGGGAGGCGGAGAGTTGAGGG + Intergenic
1122822728 14:104355289-104355311 CTGTGCAAGGTGACAGTGGACGG - Intergenic
1122825749 14:104369660-104369682 CTGGGGGTGGGGTGAGGGGAGGG - Intergenic
1122971721 14:105154963-105154985 ATGGGGAGGGGGTCAGTGGAAGG - Intronic
1122994925 14:105257882-105257904 CTGGGGAAAGGCAGGGTGGGTGG + Intronic
1123179892 14:106459917-106459939 TCTGGGAAGGGGTGAGTGGACGG + Intergenic
1202902290 14_GL000194v1_random:50805-50827 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1123433275 15:20236230-20236252 CTGGGCAATGGGAGTGGGGAGGG - Intergenic
1123587462 15:21772726-21772748 TGGGGGACGGGGAGAGAGGAGGG + Intergenic
1123587472 15:21772747-21772769 GGGGGGATGGGGAGAGAGGAGGG + Intergenic
1123587486 15:21772775-21772797 CGGGGGGTGGGGAGAGAGGAAGG + Intergenic
1123624100 15:22215291-22215313 TGGGGGACGGGGAGAGAGGAGGG + Intergenic
1123624110 15:22215312-22215334 GGGGGGATGGGGAGAGAGGAGGG + Intergenic
1123624124 15:22215340-22215362 CGGGGGGTGGGGAGAGAGGAAGG + Intergenic
1124136136 15:27037944-27037966 CTGGGGACGGGGTGAGGGCAAGG - Intronic
1124345000 15:28916309-28916331 GTGGGGAAGGGTAGACTGCAAGG - Intronic
1124402787 15:29364818-29364840 CTGGGGAGGGAGGGAGTGTATGG - Intronic
1124516016 15:30367941-30367963 CTGAGGAAGGGGTCAGTGGCAGG + Intronic
1124597371 15:31102232-31102254 CTGGTGAAGGGGGGAGAGCAGGG - Intronic
1124726904 15:32162790-32162812 CTGAGGAAGGGGTCAGTGGCAGG - Intronic
1124969581 15:34473190-34473212 CTGTGGCAAGGCAGAGTGGAAGG + Intergenic
1125477757 15:40058891-40058913 CTGGGGCTGGGGAGATTGGGAGG + Intergenic
1125616473 15:41018502-41018524 GTGGGGAAGGGAGAAGTGGATGG + Intronic
1125672055 15:41480871-41480893 CTGGGGGAGGGGAGGCTGGTGGG - Exonic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126838350 15:52691057-52691079 CAGGGGGAGTGGAGAGTTGAGGG + Intronic
1127121639 15:55777054-55777076 GTGGGGAAGGGGAGAGAGGGAGG + Intergenic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127532140 15:59853784-59853806 ATGGGGAAGGACAGAGAGGAGGG - Intergenic
1127903898 15:63361711-63361733 CTGGGGCAGGAAAGAGTGGTGGG + Intronic
1127953991 15:63836483-63836505 TTGGAGATGGGAAGAGTGGATGG + Intergenic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128325261 15:66719906-66719928 CTGGGGAGGGGGGTGGTGGAGGG + Intronic
1128513575 15:68328062-68328084 CTGGGGGTGGGGAGAAAGGAGGG + Intronic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1128878556 15:71222426-71222448 CTGGGGAATGGGATATTTGATGG + Intronic
1129012400 15:72433273-72433295 TGGGGGAAGTGGAGAATGGAGGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129194270 15:73954845-73954867 CAGTTGAAGGGGAGAGGGGATGG - Intergenic
1129325230 15:74796800-74796822 CTTGGGACAGGGAGACTGGAAGG - Intronic
1129558402 15:76538565-76538587 GTGGGGTCGGGGAGAGGGGAGGG + Intronic
1129698519 15:77754310-77754332 GGGAGGAAGGGAAGAGTGGAAGG + Intronic
1130113586 15:80987221-80987243 CTGGGGAAGGAGTGAGGGTATGG + Intronic
1130115225 15:81000696-81000718 CTGGGGGAGCGGACAGGGGAAGG - Intergenic
1130562404 15:84968906-84968928 CCGGGTAAGGGGAGAGGGAAAGG + Intergenic
1130766614 15:86877534-86877556 CTGGGGAAGGGATAAGTAGAAGG + Intronic
1131065514 15:89432894-89432916 CTGGCCTAGGGGTGAGTGGATGG + Intergenic
1131090672 15:89622695-89622717 CTGGGGAGGTGGAGCGGGGAGGG - Intronic
1131109273 15:89754631-89754653 ATGGGCGAGGGGTGAGTGGAGGG - Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131467585 15:92668013-92668035 GAGGGGAAGAGGAGAGGGGAAGG + Intronic
1131529374 15:93179001-93179023 TTGGGGAAGGAGGGAGTTGAGGG + Intergenic
1131672079 15:94630873-94630895 CTGGGTAAAGGGAGAGGAGAGGG + Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132070370 15:98771366-98771388 GTGAGGAAGGGGAGAGAGGGTGG - Intronic
1132240028 15:100250538-100250560 TTAGGGAAGGGGAGGGTGGCAGG + Intronic
1132296176 15:100736387-100736409 CTGGGGACGGGGAATGGGGATGG - Intergenic
1132351030 15:101139849-101139871 GTGAGGAAGCGCAGAGTGGAGGG - Intergenic
1132829003 16:1918484-1918506 CGGGGGAGGGGGAGGGGGGAGGG - Intergenic
1132839961 16:1974116-1974138 CTGGGGAAGGGCAGTGGGGCGGG + Intronic
1132868481 16:2105039-2105061 GGAGGGGAGGGGAGAGTGGAGGG + Intronic
1133013472 16:2927933-2927955 CTTGGCAAGGGGAGTGTGGCAGG + Intronic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133377795 16:5303622-5303644 CTGTGGTGGGGGAGAGAGGAAGG - Intergenic
1133708482 16:8378578-8378600 ATGGGGGAGGTGAGAGTGAAAGG + Intergenic
1133873824 16:9714268-9714290 GTGGGGAGAGGGAGATTGGAAGG - Intergenic
1133960829 16:10492078-10492100 CTGGGGGAAGAGACAGTGGAAGG - Intergenic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134523108 16:14927623-14927645 GGAGGGGAGGGGAGAGTGGAGGG - Intronic
1134523202 16:14927816-14927838 AAGGGGGAGGGGAGAGGGGAGGG - Intronic
1134549522 16:15132435-15132457 GGAGGGGAGGGGAGAGTGGAAGG + Intronic
1134710775 16:16326274-16326296 GGAGGGGAGGGGAGAGTGGAGGG - Intergenic
1134718946 16:16370562-16370584 GGAGGGGAGGGGAGAGTGGAGGG - Intergenic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1134807407 16:17137638-17137660 CTGGGGAAGGGCAGAGCAGGAGG - Intronic
1134948826 16:18342371-18342393 GGAGGGGAGGGGAGAGTGGAGGG + Intergenic
1134955810 16:18381597-18381619 GGAGGGGAGGGGAGAGTGGAGGG + Intergenic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1135147468 16:19975016-19975038 CTGGGGAAGTGCAGGGTTGAGGG - Intergenic
1135277092 16:21122609-21122631 TTTGGGAAAGGGAGAGTGCATGG - Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135459398 16:22628383-22628405 CAGGGGAAAGGGAGAGACGATGG - Intergenic
1135467646 16:22701080-22701102 CAAGCGAAGGGGAGAGTGGCAGG + Intergenic
1135474067 16:22757896-22757918 TTTGGAAAGTGGAGAGTGGAAGG - Intergenic
1135710394 16:24711487-24711509 CTGGGGATGGGGAGATTGCAGGG - Intergenic
1135711988 16:24725523-24725545 CTGGGGAGGGGGAGAGGAGGGGG - Intergenic
1135817232 16:25645868-25645890 TTGGACAAGGGGTGAGTGGAAGG - Intergenic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1135920808 16:26647364-26647386 CTAGCGAAGGAGAGAGGGGAGGG - Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136135912 16:28256875-28256897 CAGGGAGAGGGGAGAGGGGAGGG - Intergenic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136171772 16:28494381-28494403 CTGGGGAGGGGGAGAGGGAGGGG - Intronic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1136234574 16:28905792-28905814 GTGGGGAAAGGGAGAGGGCATGG - Intronic
1136253918 16:29025555-29025577 CTGGGGGAGGGGAGAGAGTTTGG - Intergenic
1136484975 16:30565864-30565886 CTGGGGTCGGGGAGAGTAGGGGG - Intergenic
1136602520 16:31303602-31303624 TTGGGGAAGGGGAGTCTGGGAGG - Intronic
1136679840 16:31952295-31952317 CTGGACAAGGGCATAGTGGATGG + Intergenic
1136851350 16:33614892-33614914 CTGGGCAATGGGAGTGGGGAGGG + Intergenic
1136890221 16:33965806-33965828 CTGGACAAGGGCATAGTGGATGG - Intergenic
1136912321 16:34154362-34154384 TGGGGGAAGGGGAGAGAAGACGG - Intergenic
1137439234 16:48483897-48483919 AGGGGGAAGGGGAGAGGGGGAGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1137549189 16:49425266-49425288 GTGGGGAAGGGGACAGTGGCTGG - Intergenic
1137734467 16:50713692-50713714 CTGGGGGAGGGTAGACTTGAAGG + Intronic
1137831840 16:51551247-51551269 CTGAGGAAGGTGTGAGAGGACGG - Intergenic
1137842785 16:51655419-51655441 CTAGTGCAGGGGTGAGTGGAAGG + Intergenic
1137899115 16:52245966-52245988 CTGGGGAAGGGTTGAGTGAAGGG + Intergenic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1138003500 16:53307139-53307161 TTGGGAAATGGGAGAATGGAGGG + Intronic
1138279051 16:55759091-55759113 CTGGGGAAGGGGAAAGAGACGGG - Intergenic
1138289489 16:55834590-55834612 CTGGGGAAGGGGAAAGAGACGGG + Intergenic
1138442212 16:57041959-57041981 CTGGGGGTGGGGAGAAGGGAGGG - Intronic
1138519891 16:57564999-57565021 CAGGAGAAGGGCTGAGTGGAGGG - Intronic
1138586288 16:57972386-57972408 CGGGTGCAGGGGAGAGTGGTGGG + Intergenic
1139374465 16:66488091-66488113 CTGGGAAAGATGAGAGTGGCTGG + Intronic
1139379224 16:66520049-66520071 CAGAGGAGCGGGAGAGTGGACGG + Intronic
1139624998 16:68180642-68180664 GTGGGGTGGGGGAAAGTGGAAGG - Intronic
1139632017 16:68236644-68236666 CTGGGAAAGGGGAGGGCGGCGGG + Intronic
1139670138 16:68487277-68487299 CTGGGGACATGGAGAGTGGGTGG - Intergenic
1139968248 16:70757474-70757496 CTGGAGAAGGGAAGACGGGAGGG + Intronic
1140284859 16:73592594-73592616 CTGAGGCAGGGGAGAGTAGGAGG + Intergenic
1140986672 16:80164407-80164429 TTGGGGAAGGGGAGAGGGAGAGG + Intergenic
1141028818 16:80570767-80570789 GTGGGGAAGGTGGGAGTGGTGGG - Intergenic
1141428320 16:83957617-83957639 CTGGAGTGGGGGAGAGGGGAAGG - Intronic
1141431398 16:83972001-83972023 CCGGGGAGGGGGAGAGGGAAGGG + Intronic
1141830488 16:86507559-86507581 GTGGGGGAGGGGCGAGGGGAAGG + Intergenic
1141856484 16:86684760-86684782 CTGGAGACGGGGAGAGTGGGGGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1141926241 16:87171660-87171682 CTGGGGAAGGGGGGTCAGGAAGG + Intronic
1142004733 16:87684297-87684319 GTGGGGAGGGGGTGCGTGGATGG + Intronic
1142042657 16:87905076-87905098 CTGGGGGGGGGCAGAGTGAATGG - Intronic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142234513 16:88915448-88915470 GTGGAGGAGGGGAGAGTGGAGGG + Intronic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1142234547 16:88915548-88915570 GTGGACAGGGGGAGAGTGGACGG + Intronic
1142257818 16:89023780-89023802 GTGGGGAAGGGGTGAGGGGCCGG - Intergenic
1142323765 16:89401092-89401114 CTGGGGAGGGGGAGGGCGGGTGG - Intronic
1203082810 16_KI270728v1_random:1157808-1157830 CTGGACAAGGGCATAGTGGATGG + Intergenic
1142645004 17:1305928-1305950 CTTGGGAAGGGGAGATTGGTGGG + Intergenic
1142836946 17:2594112-2594134 CAGGGGGAGGGGAGAATGGGAGG - Intronic
1143092662 17:4458146-4458168 CCAGGGAAGGGCAGAGAGGACGG - Intronic
1143134547 17:4704174-4704196 CTGGGGAGGGGGCGTGGGGAGGG + Exonic
1143196308 17:5078710-5078732 CTGGGGGCGGGGGGAATGGAGGG - Intronic
1143321356 17:6070833-6070855 CCGGGGCAGGGGAGAGTGAGCGG + Intronic
1143355687 17:6326307-6326329 CTGGGAAGGGGGAGAGACGAGGG + Intergenic
1143445204 17:7005234-7005256 CTGGAGAGGAGGAGATTGGAGGG - Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143591827 17:7889585-7889607 GTGGGGAAGGGGCAAGTTGAGGG + Intronic
1143651736 17:8267520-8267542 GTGGGGAGGGGGAGTGTGGGTGG - Intronic
1143704609 17:8687721-8687743 AGGGGGAGGGGGAGAGGGGAGGG - Intergenic
1143818632 17:9541293-9541315 ATGTGGAAGAGGAGAATGGAGGG + Intronic
1143887490 17:10076075-10076097 CTTGGGAAGGGAAGAGGGAAGGG + Intronic
1144201746 17:12948332-12948354 CAGGGGAAGGGCAGACTGGGTGG - Intronic
1145846719 17:28044655-28044677 CTGTGGAAGGGAAGAGAGGAAGG - Intronic
1145875630 17:28316942-28316964 CTGGGGGAGGTAACAGTGGAGGG - Intergenic
1145944222 17:28760850-28760872 ATGGGGAAGGGGAGAGATGTTGG - Intronic
1146032372 17:29377205-29377227 TTGGAGAATGGGAGATTGGAAGG - Intergenic
1146280268 17:31540130-31540152 CTAGAGAGGGGGATAGTGGAGGG + Intergenic
1146296358 17:31653648-31653670 AGGGGAGAGGGGAGAGTGGAAGG - Intergenic
1146445484 17:32929398-32929420 CTGGGGACCGGGGGAGGGGAAGG + Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1146710769 17:35039603-35039625 CTGGGGAGGGGGAGAATGTGGGG - Intronic
1146739579 17:35270771-35270793 CTGGGGTAGGGGAGGGAGGGTGG - Exonic
1147162351 17:38575598-38575620 CTGGGGAAGGGGAGATGGTAAGG - Intronic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147250391 17:39149750-39149772 CTGGGGAAGGGGGAATTGGGAGG - Intronic
1147403697 17:40195697-40195719 CTGAGGGAGGGGAGAGGGGATGG + Intergenic
1147571379 17:41573193-41573215 CTGGGTGAGGGCAGAGTTGACGG - Intergenic
1147605911 17:41773620-41773642 CTGGGGAAGGGGTGTGGGGAAGG - Intronic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147614471 17:41820084-41820106 CTGGGGCAGGGGGCAGGGGAAGG - Intronic
1147614954 17:41822200-41822222 CTGGGGCAGGGGAGAGCCGGGGG - Intronic
1147669972 17:42171239-42171261 CTGGGAAGGGGCAGAGAGGATGG + Intronic
1147871781 17:43592594-43592616 CTAGAGATGGGGAGAGTGGCTGG - Intergenic
1148079623 17:44960492-44960514 CGGGGGAGGGGGAGCGTGGCAGG - Intronic
1148186848 17:45650555-45650577 CTGGGGAGGGGGAGGATGGGGGG + Intergenic
1148232857 17:45947934-45947956 CTAGGGAATGGGAGTGGGGAAGG - Intronic
1148287853 17:46411625-46411647 GAGGTGAAGGGCAGAGTGGAGGG + Intergenic
1148289475 17:46431591-46431613 CTGTGGAGGAGGAGAGTGCAGGG + Intergenic
1148310022 17:46629205-46629227 GAGGTGAAGGGCAGAGTGGAGGG + Intronic
1148311644 17:46649163-46649185 CTGTGGAGGAGGAGAGTGCAGGG + Intronic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1148550179 17:48545472-48545494 CTGGGGAAGGGGAGAAGGGAAGG - Intergenic
1148675282 17:49441359-49441381 CTGGGCTGGGAGAGAGTGGAAGG - Intronic
1148757981 17:49984552-49984574 CTGGGGATGGGAACAGTGGGTGG - Intergenic
1148758268 17:49985972-49985994 GAAGGGAAGGGGAGAATGGAGGG - Intergenic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1148860561 17:50602322-50602344 CTGGGGCAGGGCAGGGAGGAAGG - Intronic
1148872751 17:50668355-50668377 CTGGGGATGGGGCGAGGGTAGGG + Intronic
1148889642 17:50798616-50798638 CTAGGGAAGGGGTCAGGGGAGGG + Intergenic
1149000263 17:51749812-51749834 CTGGGGAACGGGGGAGGGAATGG + Intronic
1149304428 17:55334604-55334626 CTGGGAAGGGGGTGAGAGGAAGG + Intergenic
1149389500 17:56174791-56174813 CTGGGGGAGGGGAAAGATGAAGG - Intronic
1149626629 17:58084256-58084278 CTGGAGGATGGGATAGTGGAGGG + Intronic
1149772231 17:59331458-59331480 CTGGGCTAGGGGAGAGCGGCTGG - Intergenic
1150123043 17:62619109-62619131 CTGGGGATGGAGAGAGGGCACGG + Intergenic
1150229667 17:63543259-63543281 CTGAGGAGGGGGAGAGGGGATGG - Intronic
1150245423 17:63671108-63671130 CTGATGAAGTGGAGAGAGGAAGG + Intronic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150591615 17:66567588-66567610 CTGGGAAAGGGGAGAGATGGTGG - Intronic
1150643714 17:66965541-66965563 CTGGGGTTGGGGGGAGCGGACGG + Intronic
1150648899 17:66997217-66997239 CTAGGGCAGGGCAGTGTGGATGG + Intronic
1150653834 17:67026900-67026922 CTGGGGCAGGAGAGAGAGAAAGG - Intronic
1150711147 17:67531888-67531910 GAGGGGAGGGGGAGAGAGGAAGG - Intronic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1151143329 17:72016220-72016242 CTGGGGAAGAGGGGACAGGAAGG + Intergenic
1151167803 17:72219896-72219918 TTTGGGGAGGGGAGAGGGGAGGG - Intergenic
1151282342 17:73086115-73086137 TTGGGGATGGTGAGATTGGAAGG + Intronic
1151313488 17:73308573-73308595 GTGGGGTGGGGGAGAGTGAAAGG + Intronic
1151343476 17:73486807-73486829 CTGGGGAAGGGGGCAGTGAAGGG + Intronic
1151347565 17:73511535-73511557 CTGGGGAGGAGGAGAGGGAAGGG + Intronic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151522683 17:74641569-74641591 CTGGGGAAGGGGAGGTGGGTGGG - Intergenic
1151547705 17:74803369-74803391 ATGTGGATGGGGAGAGGGGAAGG - Intronic
1151585460 17:75005631-75005653 CTGGGGGAGAGGAGTGTGGAAGG + Exonic
1151765612 17:76131928-76131950 CTGGGCAAGGGGAGAGCTGTGGG + Intergenic
1151829853 17:76543148-76543170 TGGGGGAAGGGGAGACTGGCAGG - Exonic
1151947795 17:77329025-77329047 CTGGGGAAGGTGGGAGTGGCTGG + Intronic
1151949812 17:77345157-77345179 CTGGGGGAAGGGAGAATGAATGG + Intronic
1151978766 17:77497236-77497258 CTGGGCAGGGGGAGAGAGGTGGG + Intronic
1152231419 17:79115749-79115771 CTGTGGAAGGAGAGAGAGCAAGG + Intronic
1152240285 17:79157355-79157377 CTGTGGAAGGGGTGCATGGACGG - Intronic
1152310995 17:79549661-79549683 CTGGGGAAGGAGACAAAGGAAGG + Intergenic
1152358902 17:79821045-79821067 CTGGGGAAGGGTAGATTGGAAGG - Intergenic
1152382786 17:79950816-79950838 CTGGGGTTGGAGAGAGTGGGGGG - Intronic
1152471724 17:80493231-80493253 TTGGGGGAGGAGAGAGAGGAAGG + Intergenic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1152755385 17:82084980-82085002 CTGGGGATGGGGAGGCTGGTGGG + Intronic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153177944 18:2399975-2399997 ATGGGGTGGGGGAGAGGGGAGGG + Intergenic
1153195998 18:2597025-2597047 GTGGGGTGGGGGAGAGGGGAGGG + Intronic
1153464370 18:5372647-5372669 GTGGGGTGGGGGAGAGGGGAGGG + Intergenic
1153563290 18:6393933-6393955 GTGAGCAAGGGGAGAGCGGAAGG - Intronic
1153658128 18:7303492-7303514 CTGGGGAGGAGAAGAGAGGATGG - Intergenic
1153761363 18:8335239-8335261 CTGAAGGAGGGGAGAGGGGAGGG - Intronic
1153769080 18:8401033-8401055 CTGGGGGTGGGGAGAGGGGATGG - Intronic
1154315818 18:13302453-13302475 CTGGGGAATGGGATACTTGAGGG + Intronic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1155691651 18:28632156-28632178 CTTGAGAAAGTGAGAGTGGATGG + Intergenic
1155884534 18:31191163-31191185 TGGGGGAAGGGGAGAGATGAAGG + Intergenic
1156292411 18:35759469-35759491 AGGGGGGAGGGGAGAGGGGAAGG + Intergenic
1156472206 18:37384384-37384406 CTGGGGATGAGGACAGGGGAGGG + Intronic
1156481104 18:37437018-37437040 CTGGGGAGGGGGTGAGTGAGAGG - Intronic
1156493700 18:37511939-37511961 CTGGGGGTGGGGATAGAGGAGGG + Intronic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156518465 18:37700845-37700867 CTGGGGTAGGAGAGTGTGTAGGG + Intergenic
1157084995 18:44570992-44571014 GTGGAGGAGGGGAGAGAGGAAGG + Intergenic
1157120903 18:44910306-44910328 ATGGCGAAGGGGTGAGCGGAGGG + Intronic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157311213 18:46554665-46554687 TGAGGGAAGGGGAGAGTGGAGGG + Intronic
1157391768 18:47309095-47309117 GTGGGGCCGGGGAGAGTGGCAGG + Intergenic
1157487767 18:48100766-48100788 CTGGGGAATGGGGGAGGGGGAGG + Intronic
1157532206 18:48430511-48430533 CGGGGGTAGGGGAGTGGGGATGG - Intergenic
1157595019 18:48859182-48859204 ATGAGGACAGGGAGAGTGGAAGG - Intronic
1157768995 18:50327818-50327840 CCGGGGAAGGCGGGAGGGGATGG + Intergenic
1157808851 18:50678893-50678915 CTGGGGTATGGGAGACTTGAGGG + Intronic
1157879901 18:51311570-51311592 TTGGGGTAAGGGAGAGAGGATGG + Intergenic
1158721952 18:59933009-59933031 CTGGGGATGGGGACTGGGGAGGG - Intergenic
1158757324 18:60341626-60341648 CTGAGGAAAGGGAGAGAGGCTGG - Intergenic
1158859699 18:61580434-61580456 CAGGGGAAGGGGAAAGGAGAAGG - Intergenic
1159010052 18:63050551-63050573 CTGGGGTAGGGGTGAAGGGAAGG - Intergenic
1159088290 18:63818882-63818904 CTAGGGAAGGGGTGAGTGTAGGG - Intergenic
1159180603 18:64897790-64897812 CCGAGGAGGGGGAGAGAGGAAGG + Intergenic
1159913144 18:74165237-74165259 CTGGGGAAGGAAGGAGTGGATGG - Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160453208 18:78979335-78979357 CGGGGAGAGGGGGGAGTGGAAGG + Intergenic
1160480118 18:79232225-79232247 CTTGTGAAGGGTAGAGTGCAGGG + Intronic
1160710292 19:548337-548359 CTGGGGCAGGGGTGAGAGCAGGG + Intronic
1160870805 19:1276946-1276968 CTGGCGCAGGGGAGATGGGAGGG + Intronic
1161093844 19:2377489-2377511 AGGGGGAAGGGGAGAGGGGTGGG - Intergenic
1161093915 19:2377644-2377666 GAGGGGGAGGGGAGAGGGGAGGG - Intergenic
1161226154 19:3146905-3146927 GTGAGGAGGGGGAGAGAGGAAGG - Intronic
1161271020 19:3389341-3389363 CTGGGGTTGAGGGGAGTGGAGGG + Intronic
1161274908 19:3410522-3410544 GTGAGGAAGGGGAGACAGGAAGG + Intronic
1161287666 19:3477253-3477275 TTGGGGGATGGGTGAGTGGATGG + Intronic
1161403753 19:4080827-4080849 AAGGGGAAAGGGAGAGGGGATGG + Intergenic
1161527708 19:4767444-4767466 TTAGGGAAGGGGAGAGAGAAAGG + Intergenic
1161625404 19:5323649-5323671 GTGAGGACGGGGAGAGAGGAAGG + Intronic
1161926417 19:7303575-7303597 AGGGGGAAGGGGAGAGGGGAGGG + Intergenic
1162283493 19:9719520-9719542 CTGAGGGAAGAGAGAGTGGAAGG - Intergenic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1162777430 19:12988164-12988186 CCGGGGAGGGGGAGAGAGGGAGG + Intergenic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1162828599 19:13269993-13270015 CAGGGGAAGGGAATAGGGGAAGG - Intronic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163112422 19:15169823-15169845 CTGGGGAGGGGCAGGATGGAGGG + Intronic
1163116068 19:15189220-15189242 CTGGGAAAGAGGGGAGAGGAGGG - Intronic
1163137647 19:15324202-15324224 CTGGGGAGGGGGGAAGGGGAAGG + Intronic
1163496247 19:17648014-17648036 CTGTGGAGGGGGGGATTGGAAGG - Intronic
1163549412 19:17957235-17957257 GTGGGGAAGGGGAAAGGGAAAGG + Intronic
1163585207 19:18160275-18160297 CTGGGAAAGGGCAGAATTGATGG - Intronic
1163728816 19:18938324-18938346 CGGGTGAGGGGGAGAGTGGAGGG - Intronic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164398657 19:27887930-27887952 CTGGGGAAGGAGAGAGAGAGTGG - Intergenic
1164721832 19:30438238-30438260 GTGGGGAGGGAGAGAGGGGAGGG - Intronic
1164896529 19:31882026-31882048 TCGGGGAAGGGAACAGTGGAAGG + Intergenic
1165255880 19:34577032-34577054 CTGGGGAAGGAGGGATAGGATGG + Intergenic
1165270260 19:34700522-34700544 GTGGGGTGGGGGAGAGGGGAGGG - Intergenic
1165342619 19:35223726-35223748 CTTGGGAAGGGGCCAGTGGTTGG - Intergenic
1165466600 19:35978559-35978581 TTGGGGCAGGAGAGAGTGGTGGG - Intergenic
1165953975 19:39490154-39490176 GTGGAGAAGGGAAGAGAGGATGG + Exonic
1166297672 19:41896940-41896962 AGGGGGAAGGTGAGAGAGGAGGG - Intronic
1166379820 19:42350125-42350147 CTGGGGAAGGGGTCACAGGAAGG - Intronic
1166746030 19:45142280-45142302 CTGGGGACGGGGAGGGGGCACGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167284780 19:48592870-48592892 CTCGGGAAGGGGAGAGTGTGGGG - Intronic
1167454431 19:49591172-49591194 CTGGGGGAGGGGGGAGGGGAAGG - Intergenic
1167459774 19:49618751-49618773 CTGGGAAAGGGTGGAGGGGATGG - Intronic
1167466637 19:49653733-49653755 CTGGGGCAGGTGAGACAGGATGG + Intronic
1167476586 19:49704984-49705006 CTGGGGACCAGGAGAGGGGATGG - Intronic
1167577349 19:50324155-50324177 CTGGGGAAGGGGGCACTGGAAGG - Intronic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1167932443 19:52877146-52877168 CTGGGGACAGGGAGAGTCTAAGG + Exonic
1168296628 19:55380278-55380300 GGGGGGAAGGGGGGAGGGGAGGG - Intronic
1168405541 19:56108411-56108433 CTGGGCAGGGGCAGGGTGGAGGG - Intronic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
925171109 2:1750748-1750770 ATGGGGATGGGGAGAAGGGAGGG - Intergenic
925283439 2:2700941-2700963 GAGGGGAAGGGGAGGATGGAGGG - Intergenic
925286230 2:2717283-2717305 CTGGGCAGGTGGGGAGTGGAAGG + Intergenic
925309488 2:2872336-2872358 CTGGGGAAGGGGAGGGGACAAGG - Intergenic
925554158 2:5110895-5110917 CTGAAGTAGGGGAGAGAGGAGGG + Intergenic
925849899 2:8069882-8069904 GAGCCGAAGGGGAGAGTGGATGG + Intergenic
925874264 2:8298584-8298606 CTGGGGCAGGGGCCTGTGGATGG - Intergenic
926254928 2:11185037-11185059 CTGGGGTATGGGAGTGAGGAGGG - Intronic
926515057 2:13832974-13832996 CTGGGGCAGGGGTGGGGGGAGGG + Intergenic
926672288 2:15587699-15587721 CTGGGAAAGTGTAGAGAGGATGG - Intergenic
926862229 2:17321509-17321531 CTGGGGATGGGAAAAGGGGATGG - Intergenic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
927812004 2:26185387-26185409 GTGGGGAAGGGGAGAAGGAAAGG + Intronic
927823017 2:26285677-26285699 CTGGGGGTGGGGAGTGGGGAGGG + Intronic
927884367 2:26709603-26709625 CGAGGGAAGGGGAGGGTGGTGGG + Intronic
928649069 2:33386047-33386069 CTAGGGAAGCGGGCAGTGGAGGG - Intronic
928687346 2:33762178-33762200 CTGGGGAGAGGGAGAGGGGGAGG + Intergenic
929052599 2:37850625-37850647 CTGGGGCAGGTGATAGAGGAAGG - Intergenic
929071696 2:38038067-38038089 TCGGGAAAGGGGAGAATGGAGGG - Intronic
929091402 2:38221147-38221169 AGGGGGATGGGGAGATTGGAGGG + Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929542240 2:42831280-42831302 CTGGGGAAGGGGCTGGTGGTGGG + Intergenic
929576656 2:43056578-43056600 CTTGGTAAGGGGAGAGTGGCTGG + Intergenic
929757744 2:44781354-44781376 CGGGGGAAGGGAGGAGTGGTGGG + Intergenic
929897034 2:45969580-45969602 GTGGAGAAGGGGAGAGAAGAGGG - Intronic
930149213 2:48041255-48041277 CTGTTGGAGGGGTGAGTGGAGGG - Intergenic
930288523 2:49465345-49465367 AAGGGGAAGGGGAGAGGGAAAGG - Intergenic
930288543 2:49465402-49465424 AAGGGGAAGGGGAGAGGGAAAGG - Intergenic
930317768 2:49818121-49818143 TTGGGGAATGGTAGAGTGAATGG + Intergenic
930747319 2:54898053-54898075 TTGGGGGAGGGGAGAATGGCAGG + Intronic
930958121 2:57228482-57228504 GTGGGAAGGGGGAGAGGGGAGGG + Intergenic
931168693 2:59779011-59779033 CTGGGGATTGGGGGAGTGGAGGG + Intergenic
931220480 2:60284399-60284421 ATGGGGAAGGGGAGTGGGGCTGG - Intergenic
931224917 2:60321367-60321389 CTGGGGAAGTGCTGGGTGGAAGG - Intergenic
931357993 2:61553961-61553983 CTGGGGAAGGGAAGAGAAAATGG - Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931400279 2:61925142-61925164 TTGGGGAAAGGGAGATTGGCAGG + Intronic
931667151 2:64617699-64617721 TTTTGGAAGGGGAGATTGGAGGG - Intergenic
932216506 2:69969640-69969662 CTGGGGCAGTGGGGAGAGGATGG - Intergenic
932336710 2:70935820-70935842 GAGGGGAGGGGGAGAGGGGAGGG + Intergenic
932433903 2:71691960-71691982 TGGGGAAAGGGGAGAGGGGAAGG - Intergenic
932434903 2:71697454-71697476 CTGGGGTGGGGGATAGTGGGAGG + Intergenic
932653118 2:73581462-73581484 CTGGGTAAGGGGATAGCAGAAGG + Intronic
932921648 2:75921541-75921563 CTGGGGAAGGGAAAAGGGGAGGG + Intergenic
933226196 2:79752051-79752073 CAGGGGCAGGGGAGAGTGTACGG + Intronic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
933901393 2:86852915-86852937 CTGGGGAAGGAAGGAGGGGAGGG + Intronic
934300687 2:91774464-91774486 CTGGGACAGGGTGGAGTGGAGGG + Intergenic
934504378 2:94879603-94879625 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
934637805 2:96007044-96007066 ATGGGGAGGGGGAGAATGGAAGG - Intergenic
934661689 2:96146472-96146494 CTGGGGGAGGGCGGAATGGAGGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934750703 2:96792440-96792462 GAGGGGAAGGGGAGCGGGGAAGG - Intronic
934795855 2:97098367-97098389 ATGGGGAGGGGGAGAATGGAAGG + Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935114338 2:100121612-100121634 CTTGGCAAGTGGAGAGGGGATGG + Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935514806 2:104022687-104022709 CTTGGGAACGGGGGAGGGGATGG + Intergenic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
935779157 2:106496322-106496344 CTGGGGAAGGAAGGAGGGGAGGG - Intergenic
935902871 2:107811274-107811296 CTGGGGAGGGAGAGAGAGGCAGG - Intergenic
936445185 2:112589262-112589284 TTGGGGAATGCTAGAGTGGAAGG - Intronic
936461976 2:112720992-112721014 CTGAGGGAGAGGAGAGTGGCTGG + Intergenic
936509063 2:113131022-113131044 CTGGGGAAGAACAGAGGGGAGGG - Intronic
936913601 2:117617068-117617090 CTTGGGTAGGGGAGAATGGATGG + Intergenic
937042693 2:118834303-118834325 TTGGTGGAGGGGAGAATGGAGGG - Intergenic
937552133 2:123107551-123107573 ATGGGGGAGGGAAAAGTGGAAGG - Intergenic
937895389 2:126973731-126973753 CTGGGGCCAGGGAGAGTGGCTGG - Intergenic
937910693 2:127074182-127074204 CTGGGAAAGGAGAGAGAGAATGG - Intronic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938220786 2:129565634-129565656 CTGGGAACAGGGAGTGTGGAGGG - Intergenic
938261104 2:129895645-129895667 CTGTGGAAGGAGAGATTGGTGGG + Intergenic
938268005 2:129943117-129943139 CTGGGGAAAGGGAGTGTGGGAGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938538748 2:132268272-132268294 TGGGGGAAGGGGAGAGAAGACGG + Intergenic
938548890 2:132361313-132361335 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
938797970 2:134734699-134734721 CTGGGCATGGGGAGAGTGTCAGG - Intergenic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
939606681 2:144262842-144262864 CGGGGAAAGGGAAGAGGGGAGGG + Intronic
939629487 2:144516248-144516270 CTGGGGGAGGGGAGAGGGCTGGG - Intronic
940143497 2:150521683-150521705 CAGGGGAAGTGGAGAGGGGGAGG - Intronic
940306494 2:152232691-152232713 GTGGAGATGGGGAAAGTGGATGG - Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
940586489 2:155658484-155658506 AGGGGGAAGGGGAGAGGGAAGGG + Intergenic
940901663 2:159131507-159131529 CAGGGGAAGGGGCGGGGGGAGGG - Intronic
941517133 2:166493874-166493896 ATGGGGCAGGTGGGAGTGGATGG + Intronic
941766918 2:169308364-169308386 GTGGGGTAGGGGAGAGGGGAAGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942069024 2:172298652-172298674 GTGGAGAATGGGAGAGAGGAAGG + Intergenic
942378788 2:175365209-175365231 CTGGGGTGGGGGTGAGAGGATGG - Intergenic
942964845 2:181879506-181879528 CTGGGTGAGGAGAGAGTGGTAGG - Intergenic
943358141 2:186884283-186884305 GTGGGGATGGGGAGAGGGCAAGG + Intergenic
943700195 2:190980990-190981012 CTGGGGAGGGAGAGAGCAGATGG - Intronic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944697732 2:202217991-202218013 ATGGGGAGGGGGGGAGGGGAGGG + Intronic
944838197 2:203600477-203600499 CTGGGGAAGGGGCGAGGTGGAGG - Intergenic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
945314733 2:208359822-208359844 CAGGGGAAGGCGAGGGTGGCTGG + Intronic
945463615 2:210141133-210141155 GTGGGGAAGGGAAGGGAGGAAGG - Intronic
945918118 2:215726144-215726166 GTGGGGACAGGGAGAGGGGAGGG + Intergenic
946008601 2:216546676-216546698 CTGGGCAGGGTGAGAGTGGGAGG - Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946142423 2:217703108-217703130 CTAGGAAAGGTGAGAGTGGCTGG - Intronic
946175714 2:217920994-217921016 AGAGGGAAGAGGAGAGTGGAGGG + Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946365445 2:219246075-219246097 CTGGGGGAGGGGTGAGTGTTTGG + Exonic
946393565 2:219431285-219431307 GGGAGCAAGGGGAGAGTGGAAGG - Intergenic
946409592 2:219509504-219509526 CTGGGGAAGGGGAGCGGGGGTGG - Intergenic
946441979 2:219704387-219704409 CTGGGGGAGGGCAGTGTGGAGGG - Intergenic
946643268 2:221806911-221806933 TTTGGGAAGGAGAGAGAGGAAGG - Intergenic
946658002 2:221969801-221969823 CGGGGGAAGGGGTGAGATGAAGG - Intergenic
947232512 2:227902424-227902446 CTGGGGGAGGGGAGTGGGAAGGG + Intronic
947421014 2:229941633-229941655 GTGGGGAAGGGGAGATAGGAGGG + Intronic
947470184 2:230394562-230394584 CTGGGGAAAGGTAGAGTTGCTGG - Intronic
947634565 2:231673464-231673486 GTGGGGAAGGGGAGGGAGCAGGG - Intergenic
947736334 2:232457344-232457366 CTGGGGCTGGGCAGAGGGGAAGG + Intronic
947743208 2:232494379-232494401 CTGGGGAGGGGGATATTGGCAGG + Intergenic
947906172 2:233764922-233764944 CTGGGGCTGGTGAGAGTGGCGGG + Intronic
947928716 2:233943948-233943970 AAGGGGCAGGGGAGAGTGGGAGG + Intronic
947976451 2:234370563-234370585 CAGGGGAAGGTCAGAGTGCAGGG + Intergenic
947976455 2:234370581-234370603 CAGGGGAAGGTCAGAGTGCAGGG + Intergenic
948178489 2:235961992-235962014 CTGGGGCAGGGCGGGGTGGAGGG + Intronic
948190102 2:236051699-236051721 TGGGGGCAGGGGAGAGGGGAAGG + Intronic
948550807 2:238772108-238772130 ATGCCGAGGGGGAGAGTGGAAGG - Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948924084 2:241082681-241082703 CTGAGGAAGAGAAGAGAGGAAGG - Intronic
948931781 2:241136807-241136829 CTGGGGAAGGGTGGAGAGGAAGG + Intronic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1169249595 20:4050111-4050133 CTGTGGAAGGGGTGAGTTTAGGG - Intergenic
1169369813 20:5020110-5020132 GGAGGGAAGGGGAGTGTGGAGGG - Intergenic
1169417678 20:5431873-5431895 CTGAGGCATGGGACAGTGGAGGG - Intergenic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1169571204 20:6908050-6908072 ATGGGGGAGGGGACACTGGATGG + Intergenic
1169596376 20:7204266-7204288 CTGGGGAAGGGAGAAGTGGAAGG - Intergenic
1169849678 20:10035378-10035400 CTGGAGAAGAGAGGAGTGGAGGG - Intronic
1170126610 20:12970759-12970781 CTGAGGAAGGGGAGAAAGGATGG - Intergenic
1170368565 20:15623481-15623503 GTGGGGATGGGGAGAGTAGCTGG + Intronic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1170976319 20:21168062-21168084 GTGGGGTAGGGGAGTGGGGAGGG - Intronic
1171035469 20:21709517-21709539 CTGGGAAAAGGGAGAGCGGGTGG + Intronic
1171046206 20:21810843-21810865 CTTGGGAAGGTGGCAGTGGATGG - Intergenic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171118443 20:22547525-22547547 GTGGGGAAGAGGGCAGTGGAAGG + Intergenic
1171217607 20:23363158-23363180 CTGGAGAAGGGGAGAGGGGTGGG + Intronic
1171313544 20:24166287-24166309 CAGGGGGAGGGGTCAGTGGATGG - Intergenic
1171367762 20:24637830-24637852 CTGGGGCTGGGGAGACTCGAAGG - Intronic
1171429156 20:25069611-25069633 CTGAGGAGTGGGAGAGGGGATGG + Intergenic
1171439549 20:25149048-25149070 CTGCGAAAGGGGAGAGAGGTGGG + Intergenic
1171452411 20:25245518-25245540 CTGGGGGAGGGGTCAGTGGATGG + Intergenic
1171812071 20:29753167-29753189 TGGGGGAAGGGGAGAGAAGACGG + Intergenic
1171867663 20:30500234-30500256 TGGGGGAAGGGGAGAGAAGACGG + Intergenic
1171877713 20:30593840-30593862 GTGGGGAAGGGGAGGGACGAAGG + Intergenic
1171907605 20:30912510-30912532 TGGGGGAAGGGGAGAGAAGACGG - Intergenic
1172029982 20:31975043-31975065 CTGGGGAGTGGGAGGGCGGAGGG + Intronic
1172198138 20:33106141-33106163 GTGGGGTAGGAAAGAGTGGATGG - Intronic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1172578735 20:36030274-36030296 CTTAGGGAGGGGAGAGTGGCAGG + Intronic
1172615566 20:36281302-36281324 CAGATGAATGGGAGAGTGGATGG - Intergenic
1172692196 20:36797574-36797596 CTGGGCAAGGGCAGAGAGGGTGG + Intronic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1172870480 20:38132501-38132523 CTGCAGAAGGGGAGAAAGGAGGG + Intronic
1173019859 20:39258058-39258080 ATAGGAAAGGGGAGAGGGGAGGG - Intergenic
1173348057 20:42219123-42219145 CTGGGGAAAGCTAGAATGGATGG + Intronic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1173442226 20:43087885-43087907 CTGGGAAGGGGAAGAATGGATGG + Intronic
1173550641 20:43930984-43931006 CTAGTGAAGGGGATAGAGGAGGG - Intronic
1173608492 20:44349406-44349428 TTGGGGGCGGGGAGAGTGGGTGG - Intronic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1173972762 20:47165397-47165419 CTGGGAAGTGGGGGAGTGGAAGG - Intronic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174360045 20:50023300-50023322 CTGGGGCAGGGGAAAGTGTCAGG - Intergenic
1174476022 20:50795990-50796012 CTTGGGATGGGGATAGGGGACGG + Intronic
1174514695 20:51082852-51082874 GTCGGGAAGGGGAGAGTGGAGGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174565728 20:51463217-51463239 CTGGGAAGTGGGAGAGTGGAGGG + Intronic
1174595618 20:51681075-51681097 CCTGGGAGGAGGAGAGTGGAAGG - Intronic
1174754068 20:53140846-53140868 CCAGGGAAGGGGTGAGTTGAGGG + Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175062730 20:56258351-56258373 CAGGGAAAGGGGAGAATAGAGGG + Intergenic
1175110523 20:56644843-56644865 CAGGGGAAGTGGAGAGTAGGGGG + Intergenic
1175289797 20:57868147-57868169 GTGAGGAAGGTGAGAGGGGAAGG - Intergenic
1175334618 20:58187199-58187221 CTGGGCTCTGGGAGAGTGGAAGG + Intergenic
1175353378 20:58342801-58342823 CTGGGTGAGGGGGGAATGGAAGG + Intronic
1175391660 20:58631453-58631475 CTGGGGACAAGGGGAGTGGAGGG - Intergenic
1175570236 20:60012585-60012607 GCGAGGAAGGGGAGTGTGGAGGG + Exonic
1175625670 20:60486638-60486660 CTGGGGAAGGGAAGTGTTTAGGG + Intergenic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1175855249 20:62117687-62117709 CGGGGGGAGGGGATAGTGAACGG - Intergenic
1175902584 20:62365994-62366016 CTGGGGCAGGGGCGAGTAGCTGG - Intronic
1175936690 20:62517517-62517539 CTCGGTGAGGGGTGAGTGGAGGG - Intergenic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176255111 20:64147658-64147680 CTGGGGAAGGAGATAGTGGGTGG + Intergenic
1176552799 21:8236285-8236307 TGGGGGAAGGGGAGAGAAGACGG - Intergenic
1176554026 21:8245313-8245335 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176571697 21:8418688-8418710 TGGGGGAAGGGGAGAGAAGACGG - Intergenic
1176572948 21:8428337-8428359 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176579608 21:8463250-8463272 TGGGGGAAGGGGAGAGAAGACGG - Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176621658 21:9065572-9065594 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178013369 21:28313453-28313475 CTGGGGCTAGGGAAAGTGGAAGG - Intergenic
1178491837 21:33057507-33057529 CTGGGGATGCGGAGAGGAGAGGG - Intergenic
1178570207 21:33728876-33728898 ATGGGGCAGGGGGGAGTGGGGGG - Intronic
1178906700 21:36642614-36642636 CAGGGGAAGGGGAAAGAGTATGG + Intergenic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179508793 21:41858748-41858770 CTGGGGAAGAGGGGGGTTGATGG + Intronic
1179646941 21:42781980-42782002 AGGAGGAAGGGGAGAGGGGAGGG - Intergenic
1179673208 21:42964210-42964232 GTGGGGTAGGGGAGAGAAGAGGG - Intergenic
1179800518 21:43809645-43809667 CTGCGGCAGGGGTGAGGGGAGGG + Intergenic
1179802218 21:43816455-43816477 CTGGTCAGGGGGAGAGTGGCAGG - Intergenic
1179947632 21:44688820-44688842 CAGCGGAAGGGGAGTGGGGAGGG + Intronic
1179959687 21:44761060-44761082 CTGGAGAAGGGGAGAGTCCAGGG + Intergenic
1180004284 21:45012906-45012928 CTGGGGAAGAGGTGTCTGGATGG + Intergenic
1180217973 21:46338299-46338321 CTGGGGAAGGAGAGAGCGGCTGG - Intronic
1180314317 22:11264909-11264931 TGGGGGAAGGGGAGAGAAGACGG + Intergenic
1180341041 22:11618642-11618664 TGGGGGAAGGGGAGAGAAGACGG - Intergenic
1180488581 22:15821588-15821610 CCGGGGCAGGGAAGCGTGGACGG + Intergenic
1180590166 22:16930604-16930626 AAGGGCAAGGGGAGTGTGGATGG + Intergenic
1181315315 22:21967325-21967347 CGTGGAAAGGGGAGAGTGGAAGG + Intronic
1181375176 22:22452383-22452405 ATGTGGAAGGGGAGAGGGTAAGG - Intergenic
1181427820 22:22855722-22855744 CTGGGTCAGGGGAGTCTGGAGGG + Intronic
1181484574 22:23222605-23222627 CTGGGAGAGGGGAGCGTGGCAGG + Intronic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181696436 22:24595020-24595042 CAGGGGGAGGGGAGAAAGGAGGG + Intronic
1181699042 22:24609600-24609622 CTGGGACAGGGTGGAGTGGAGGG + Intronic
1181962189 22:26630187-26630209 CTGTGGTAGGGGAGAGAGCATGG + Intronic
1182017863 22:27055942-27055964 CTGGAGAAGAGTAGAGTGGCAGG + Intergenic
1182071968 22:27470104-27470126 CAGGTGAATGGGTGAGTGGATGG + Intergenic
1182094011 22:27614256-27614278 CTGGGGCAGGGGGGCGGGGACGG - Intergenic
1182287429 22:29256671-29256693 ATGGGGTAGGGGAGCATGGAAGG + Intronic
1182310972 22:29406217-29406239 CCCGGGCAGGGGAGGGTGGAAGG - Intronic
1182355255 22:29719932-29719954 CTGGGGGTGGGGAGCGCGGAGGG + Intergenic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182477308 22:30583184-30583206 CTGGGGAAGGGAAGAAGGAAGGG + Intronic
1182551997 22:31105622-31105644 CTGGGGGAGGGGAAATGGGATGG - Intronic
1182659516 22:31915398-31915420 GTGGGGAAGGGGATGCTGGAGGG + Intergenic
1182690138 22:32154885-32154907 CCCGGGCAGGGGAGGGTGGAAGG + Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183065026 22:35356871-35356893 AGGGGGTAGGGGAGAGGGGACGG - Intergenic
1183096213 22:35553847-35553869 GTGGGGAAGGGGACAGAGGCAGG - Exonic
1183333226 22:37232451-37232473 CTGGGGGAGGGGAGAGGTGGAGG - Intronic
1183437330 22:37803622-37803644 CTGGGGAGGGGTAAAGGGGAGGG - Intergenic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1183590349 22:38776197-38776219 ATGGGGGTGGGGAGAGAGGACGG - Intronic
1183718427 22:39548011-39548033 CTGGGCAAGGGGAGTGGGGTGGG + Intergenic
1184070124 22:42142190-42142212 CTGGGCAAGGAGAGAGAGGGTGG - Intergenic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184247443 22:43242731-43242753 CTGGGGACAGAGAGACTGGAGGG - Intronic
1184307657 22:43617521-43617543 ATGAGGAAGGGGAAAATGGATGG - Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184731951 22:46375418-46375440 CTGGGCACGGGGAGAAAGGAGGG - Intronic
1184949937 22:47834103-47834125 CGGAGGAAGAGCAGAGTGGAAGG + Intergenic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185015732 22:48341518-48341540 TGGGGGAAGGGGAGAGTGAGCGG - Intergenic
1185187241 22:49408373-49408395 CGGGGTGAGGGGAGAGGGGAGGG + Intergenic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1185279097 22:49962338-49962360 CGGGGGGAGGGGAGAGAGGGAGG - Intronic
1185363373 22:50422789-50422811 CTGGGGAGGGTGAGACGGGATGG - Intronic
1203257776 22_KI270733v1_random:152685-152707 TGGGGGAAGGGGAGAGAAGACGG - Intergenic
1203259031 22_KI270733v1_random:162351-162373 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
949414508 3:3800269-3800291 CCGGGGACGGGGAGGGAGGAGGG + Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949988015 3:9554411-9554433 TGGGGGCAGGGGAGAGTGTAGGG - Intergenic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950187491 3:10954036-10954058 CTGGGGAAGGGGAGCTTGCAGGG - Intergenic
950398873 3:12755007-12755029 AGGGGGAAGGAGAGAGAGGAAGG - Intronic
950867170 3:16198495-16198517 CAGTGGAAGGGGAGAATGAATGG + Intronic
951297196 3:20952468-20952490 GTGGGGAAGGGTAGGGAGGAGGG + Intergenic
951719173 3:25679715-25679737 CAGAGGAGGGGGAGAGAGGAGGG + Intergenic
951758303 3:26117494-26117516 TTGGGGAAGGGGTGAGTGAAGGG + Intergenic
951891512 3:27572192-27572214 CTGGCCAAGGGAAGAGTGTATGG - Intergenic
952248437 3:31624220-31624242 CAGGGGCGGGGGAGAGTGCACGG - Intronic
952419722 3:33119982-33120004 CTGAGGAAGGGAAGAGAGTAAGG - Intronic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952767560 3:36968150-36968172 ATGGGGTAGGGGAGGGGGGAGGG - Intergenic
952801737 3:37299096-37299118 CTCCGGGAGAGGAGAGTGGATGG + Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953119576 3:40026809-40026831 TTCAAGAAGGGGAGAGTGGATGG - Intronic
953242215 3:41159742-41159764 TTGGAGAAAGTGAGAGTGGAAGG - Intergenic
953265032 3:41378631-41378653 ATGGGGTAGGGGAGCGGGGAGGG + Intronic
954029659 3:47809707-47809729 GTGGGGAGGTGGGGAGTGGAGGG - Intronic
954106424 3:48412075-48412097 CTGGGGAAGGGGACAGGACATGG + Intronic
954124155 3:48518870-48518892 CCAGGGAAGGGGAGAGGGGGCGG + Exonic
954274768 3:49535037-49535059 CTGGGGCAGGGGAGAGGGGCTGG - Exonic
954424939 3:50438311-50438333 CTGGGGGAGGGGAGAGGTGGAGG - Intronic
954461550 3:50629756-50629778 TGGGGGATGGGAAGAGTGGAGGG - Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954802112 3:53193421-53193443 CTGGGGAAGGAGAGACAGGCAGG + Intergenic
954990890 3:54839823-54839845 CTGGGGAACGAGGGATTGGAGGG - Intronic
954995520 3:54877792-54877814 CTGGGGAATGTGAGAGGAGAAGG + Intronic
955002199 3:54937869-54937891 CTGGAGAAGGGGTGAGAGGCTGG + Intronic
955972117 3:64445795-64445817 CTGGGGTAGGGGAGTGGAGATGG + Intergenic
955972998 3:64454419-64454441 CAGGGGAGGGGGCGAGAGGAGGG + Intergenic
956051848 3:65256665-65256687 CTGGGGAAGGGGGGTGGGGTGGG - Intergenic
956912120 3:73828826-73828848 CTTGGGAAGGGGACATGGGAAGG + Intergenic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
957760490 3:84548920-84548942 CTGGGAAATGGGTGAGTGAAGGG - Intergenic
957792651 3:84959751-84959773 CTGGGGACAGGGAGACTGGGAGG - Intronic
957796049 3:85009122-85009144 CTGGGGAAGTTGAGAATGAATGG + Intronic
957824495 3:85423069-85423091 ATGGGGAATTGGAGAGGGGATGG + Intronic
958027201 3:88061986-88062008 GTGGGCAAAGGGAGAGAGGAAGG + Intronic
958184616 3:90105126-90105148 GTGGGGTGGGGGAGAGGGGAGGG - Intergenic
958204230 3:90369521-90369543 CTGGGGTGGGGGAAAGTGGGAGG - Intergenic
958918235 3:100073465-100073487 CTGGGGTAGAGGAGATTGCAGGG + Intronic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
959618569 3:108375328-108375350 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
959714753 3:109420442-109420464 CTGAGGATGGAGAGAGAGGAAGG - Intergenic
960660626 3:120054225-120054247 CTAGGGAAGGAGAGAGAGGAGGG - Intronic
960665106 3:120101183-120101205 CGGGGGAAGGGGGCAGTGGCAGG - Intergenic
960734621 3:120765024-120765046 TTGGGGATGGGGAGGGTGGGGGG - Intronic
960947005 3:122973808-122973830 GTGGGGAAGGGCAGAGAGGGAGG + Intronic
961135914 3:124511117-124511139 TAGGGGAAGGGGAGAGGAGAGGG - Intronic
961557079 3:127703088-127703110 CTGGGGGAGGAGACAGTGGTGGG - Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961654158 3:128432488-128432510 CTGGGCAGCGGGAGTGTGGAGGG + Intergenic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
961713077 3:128842021-128842043 TTGAGGAAGGGGAGAGTGTCAGG - Intergenic
962318970 3:134375521-134375543 CAGGGTAAGTGGAGAGAGGAGGG - Intergenic
962326876 3:134441758-134441780 CTGGGGAAGGGGAGGTGGGGAGG - Intergenic
962357969 3:134711080-134711102 TGGGGGAAGAGAAGAGTGGAGGG - Intronic
962942151 3:140134747-140134769 TGGGGGAAGGAGAGGGTGGAGGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
963430634 3:145197375-145197397 CTTGGGAAGAGGGGAGGGGAGGG + Intergenic
963582714 3:147147170-147147192 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
963837413 3:150071054-150071076 CTGGACAAGGGGAGAGTGGCAGG + Intergenic
963940595 3:151092624-151092646 CTGGGGAAGTGGAGTGAGGGAGG + Intronic
964150020 3:153512645-153512667 CTGGGAAGGGAAAGAGTGGAAGG - Intergenic
964256988 3:154786618-154786640 CAGGTGAATGGGAGAGAGGAAGG + Intergenic
964320938 3:155496517-155496539 CTGGGCAGGGGGAGATGGGAGGG + Intronic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
964912023 3:161794637-161794659 CTGGGGAGGGGAGGAGTGGAGGG - Intergenic
965475482 3:169150007-169150029 ATGGGGTGGGGGAGAGGGGAGGG - Intronic
965530930 3:169769274-169769296 CTGGGGCTGGGGAGGGTGGGTGG - Intronic
966061366 3:175760387-175760409 CTGAGTAAGGGGAGAGGGAAAGG + Intronic
966897655 3:184457729-184457751 AAGGGGAAGGGGAAATTGGAGGG + Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967157307 3:186705382-186705404 TTGGGGATGGGGATAGGGGAAGG - Intergenic
967365116 3:188677619-188677641 CTGGGAAATGGGAGAGGGGGAGG + Intronic
967799308 3:193638244-193638266 CTGAGTGAGGGGAGAGTGGTAGG + Intronic
967880207 3:194296616-194296638 CAGGGGGAGGGGAGAGTAGAAGG + Intergenic
967983070 3:195077200-195077222 CTGGGGAAGGGAAAAGCAGAGGG + Intronic
968091615 3:195901554-195901576 CTAAGGAAGGTGAGAGGGGAGGG - Intronic
968132413 3:196199255-196199277 TGGGCGAAGGGGAGAGAGGAGGG - Intronic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968530026 4:1086718-1086740 ATGGGGTTGGGGAGAGAGGATGG + Intronic
968530033 4:1086737-1086759 ATGGGGTAGGGGTGAGAGGATGG + Intronic
968530059 4:1086813-1086835 ATGGGGTGGGGGAGAGAGGATGG + Intronic
968530066 4:1086832-1086854 ATGGGGTTGGGGAGAGAGGATGG + Intronic
968530109 4:1086946-1086968 ATGGGGTCGGGGAGAGAGGATGG + Intronic
968530129 4:1087003-1087025 ATGGGGTGGGGGAGAGAGGATGG + Intronic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
968530206 4:1087231-1087253 ACGGGGTAGGGGAGAGAGGACGG + Intronic
968530213 4:1087250-1087272 ACGGGGTAGGGGAGAGAGGATGG + Intronic
968585037 4:1412372-1412394 CTGGGACAGGGAAGAGTGAAGGG + Intergenic
968614621 4:1571745-1571767 CAGGGGGAAGGGAGCGTGGAAGG + Intergenic
968662873 4:1806028-1806050 CTGGGGAAGGGGTGGGAGGCAGG - Intronic
968757120 4:2422603-2422625 GTGGGGGCGGTGAGAGTGGATGG - Intronic
968876317 4:3269603-3269625 CTGCGAAAGGGGAGCGGGGAGGG + Intronic
968985857 4:3873916-3873938 CAGGGAAAGGGGAGAGAGGGAGG + Intergenic
969343402 4:6556613-6556635 CTGGGGAAGAGGTGTGTGGATGG - Intronic
969537820 4:7767570-7767592 CTGGGGAAGGGAGGAATGGCTGG - Intronic
969543178 4:7806689-7806711 AGGGGAAAGGGGAGAGGGGAGGG - Intronic
969564583 4:7970514-7970536 CTGGGGAAGGAGAGAAGGGCAGG + Intronic
969581899 4:8070766-8070788 CTGGGGAAGGAAAGAGAGGAGGG + Intronic
969584736 4:8085190-8085212 CCTGGGGAGGGGAGAGTGGCTGG - Intronic
969668086 4:8573744-8573766 CGGGGGAGGGGAAGAGGGGAAGG + Intronic
969685455 4:8671618-8671640 CTGGGGAAGAGCAGAGGAGAAGG + Intergenic
969926182 4:10587812-10587834 CTGGGGTAGGGGAGACAGTAGGG - Intronic
970909280 4:21255516-21255538 CTGAGGGAGGGGAGAGTTTAAGG - Intronic
971350570 4:25852296-25852318 GTGGGGAAGGTGGGAGTGGGTGG - Intronic
971374375 4:26044972-26044994 ATGGGAAAGAGGGGAGTGGATGG - Intergenic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
971494971 4:27254383-27254405 ATGGGTAAGGGGAGATGGGAGGG + Intergenic
971727741 4:30335608-30335630 GAAGGGAAGGGGGGAGTGGAGGG + Intergenic
972109552 4:35541135-35541157 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
972738359 4:41866754-41866776 CTGGGGAGCGGAAGAGTGGAGGG - Intergenic
972739901 4:41879228-41879250 CTAGGGAAGGGGATAGAGGGAGG + Intergenic
972935665 4:44131846-44131868 CTGGAGGAAGGGAGAGTGGAGGG + Intergenic
972960321 4:44446861-44446883 TTGGGACAGGGGAGGGTGGAAGG - Intronic
973333249 4:48930950-48930972 CTGGGGAAGGGGATCGGGGCAGG + Intergenic
973604285 4:52571204-52571226 CTGGGCAAGGAGAGAGGGCAGGG - Intergenic
973712203 4:53641192-53641214 CTGGGGAAGGGCGGGGTGGGGGG + Intronic
973784497 4:54322585-54322607 CTGGGGAAGAGAAGAGTTGGTGG - Intergenic
973816410 4:54623405-54623427 GTGAGGAAGGCGAGAGTGGAAGG - Intergenic
973907635 4:55546956-55546978 CTGGGGAAAGGGAGAGTGAGGGG - Intronic
973926881 4:55747877-55747899 CTGGGGATGGGGAGTATGGAAGG + Intergenic
974206123 4:58705326-58705348 CAGGGGCAGGGCAGTGTGGAAGG + Intergenic
974762839 4:66300697-66300719 GGGAGGAAGGGGAGAGGGGAAGG - Intergenic
974889500 4:67862906-67862928 GTGGGGTGGGGGAGAGGGGAGGG + Intronic
975522998 4:75320152-75320174 GTGGGGTGGGGGAGAGGGGAGGG + Intergenic
976369149 4:84267059-84267081 CTGTGGCAGGGGAGATTGCATGG + Intergenic
976579691 4:86721676-86721698 CGGGGGAGAGGGAGAGGGGAAGG - Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977459613 4:97308957-97308979 TTGGGGCAGGGGAGAGAGAAGGG - Intronic
977660905 4:99584853-99584875 TTGGGGAAGGAGGGAGTGGAAGG - Intronic
978525750 4:109663474-109663496 TTGTGGAAGGGGAGAGAGGCAGG - Intronic
979515484 4:121604816-121604838 GTGGGGTGGGGGAGAGGGGAGGG - Intergenic
979590328 4:122471783-122471805 CTGGGGAAAGGGAGAGAGACAGG - Intergenic
979979463 4:127236881-127236903 CTGGTGAAATGGAGAATGGATGG - Intergenic
980482167 4:133401071-133401093 CTGGGGAAATGGTGATTGGATGG + Intergenic
981422784 4:144570560-144570582 CTGGGGAAGGGGTGCATGGATGG + Intergenic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
981520741 4:145659958-145659980 ACTGGGGAGGGGAGAGTGGAAGG - Exonic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
981661461 4:147171943-147171965 CAGAGAAAGGGGACAGTGGAAGG - Intergenic
982112912 4:152072625-152072647 CTTGGGAAAGGCAGATTGGAGGG + Intergenic
982317692 4:154048060-154048082 TTGGGGAAAGGGTGGGTGGAGGG + Intergenic
982481012 4:155909928-155909950 GGGGGGGAGGGGAGAGGGGAGGG - Intronic
982623251 4:157732254-157732276 GTGGGGAAGAGGTGTGTGGATGG - Intergenic
982670481 4:158314267-158314289 CTGGGGAAAGGGTGAGTAAAGGG - Intergenic
982989798 4:162257912-162257934 TTAGGGAAGGGGAGAGAAGAGGG + Intergenic
983183177 4:164672097-164672119 GTGGGGTAGGGGAGAGGGGAGGG + Intergenic
983531489 4:168813960-168813982 CAGGGGAAGATGAGAGTGGGAGG + Intronic
983559150 4:169083941-169083963 CTGGGGAGCGGAAGAGAGGAGGG + Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
983923728 4:173373143-173373165 CTGGGGAAGGGGGTAAGGGAGGG - Intronic
983925674 4:173399246-173399268 GTGGGGAGGAGGGGAGTGGAAGG + Exonic
984206438 4:176792720-176792742 TCGGGGAAGGGGAGGGAGGAGGG - Exonic
984806789 4:183758540-183758562 CTGGGGACGGGGCGTGGGGAAGG + Intergenic
984873103 4:184344769-184344791 CTGAGGAGGGGGCGAGTGGGAGG + Intergenic
985269906 4:188184041-188184063 ATGGGGAGGTGGAGAGGGGATGG - Intergenic
985542277 5:492550-492572 CTGGGAACGAGGAGAGTGCAGGG + Intronic
985577286 5:679300-679322 CAGGGAAAGGGGTGAGTGGGTGG - Intronic
985592201 5:771351-771373 CAGGGAAAGGGGTGAGTGGGTGG - Intergenic
985731365 5:1550859-1550881 CTGGGCAAGGGCAGCCTGGATGG - Intergenic
985756652 5:1723479-1723501 GAGGGGAAAGGGAGAGAGGAAGG - Intergenic
985805060 5:2037703-2037725 ATGGGAGAGGGGAGAGAGGAGGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
985936614 5:3102384-3102406 CTAGGGAAGAGGAGACAGGAGGG + Intergenic
986087193 5:4463347-4463369 TTGGGGAAGAGGTGTGTGGATGG + Intergenic
986432810 5:7698531-7698553 TTGGGGAGGGGGTGAGGGGAGGG - Intronic
986435767 5:7728821-7728843 CTGGGGATGGGGAGAGTGACTGG + Intronic
986685236 5:10270582-10270604 GTGGGGGAGGGGAGAGGGAAGGG + Intergenic
987148131 5:15012446-15012468 TTGGGGAAGTGGAGGATGGAGGG + Intergenic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987958104 5:24766130-24766152 CTGGGCTAGGGGAGGGGGGAGGG + Intergenic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
988894456 5:35657030-35657052 CTGGAGGAGAGGAGAATGGATGG - Intronic
989550215 5:42726336-42726358 CTGGGGATGGGAAGTGGGGAAGG - Intergenic
990011182 5:51000245-51000267 ATTGGGAATGGGAGGGTGGATGG + Intergenic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
990363075 5:55041132-55041154 CAGGGGAAGGGATGAATGGATGG + Intergenic
990589652 5:57249764-57249786 GAGGGGAAGGGGAGAGGGGAAGG - Intronic
990710881 5:58578779-58578801 GTGGGGTGGGGGAGAGGGGAGGG + Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991229378 5:64313299-64313321 ATGGGTAAAGGGAGAGAGGAAGG - Intronic
991370176 5:65910371-65910393 CGGGGGAAAGGGTGAGAGGAGGG + Intergenic
991611589 5:68455088-68455110 CAGGGGACGGGGAGAGTTTATGG + Intergenic
992004627 5:72465363-72465385 CTGGGGAAGGGGAGTGTTGAAGG + Intronic
992298931 5:75357493-75357515 TTGGGGAAGGGGAAAATGGGTGG + Intronic
992371388 5:76147577-76147599 CTGGGGAATTTGAGAGTAGAGGG + Intronic
992453191 5:76891766-76891788 CAGGGGAAGAGGAGAGAGGTGGG + Intronic
992527813 5:77629459-77629481 CTGGGCAAGGGTAGCGTGGTGGG + Exonic
992534843 5:77689421-77689443 CTTGGGAAGGGGTGGGTGGGTGG - Intergenic
992567215 5:78009781-78009803 TGGGGGAGGGGGAGAGGGGAAGG + Intronic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993367384 5:87050333-87050355 TTGGGGAAGAGGTAAGTGGATGG - Intergenic
993564660 5:89458297-89458319 CTGGGCAAGGAGAGAGAGGGTGG - Intergenic
993857432 5:93093941-93093963 GTGGGGTGGGGGAGAGGGGAGGG - Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994475000 5:100256538-100256560 CTGGGGAGGGGGTGGGTGGGTGG - Intergenic
994729638 5:103476723-103476745 CTGGGGAAGGGGGTGGTGGGGGG - Intergenic
994825109 5:104703282-104703304 CGGGGATTGGGGAGAGTGGAGGG + Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995264166 5:110138900-110138922 CTGGTGCTGGGGAGACTGGATGG - Intergenic
995327548 5:110908086-110908108 ATGGGGTAGGGGAGGGGGGAGGG + Intergenic
995410777 5:111854784-111854806 CTGGGAAAGGGCAGAAGGGAAGG - Intronic
995434814 5:112123629-112123651 TTGGGGGAGGAGAGAGTGGAAGG - Intergenic
995461352 5:112406629-112406651 CTGGGGGTGGGGAGAAGGGAAGG + Intronic
995551413 5:113285495-113285517 GTGAGCAGGGGGAGAGTGGAAGG - Intronic
995562300 5:113395901-113395923 CTGGGAAATGGGAGAGGGGAAGG + Intronic
995946012 5:117646812-117646834 CTGGGGAAGGGTTGGGTGGAGGG - Intergenic
996016005 5:118534660-118534682 CTGGGGAAACGGGAAGTGGAGGG - Intergenic
996040581 5:118805577-118805599 CTGGGGTAGGGGAGAATTGTAGG - Intergenic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996423266 5:123285661-123285683 AAGGGGAAGGGGTGGGTGGAGGG - Intergenic
996464478 5:123783416-123783438 CTTGGGAAGGTGAAAGGGGAGGG + Intergenic
997356559 5:133266478-133266500 CTGGGGAAGGGTGGAGAGGCAGG - Intronic
997366494 5:133328695-133328717 CTGGTGACAGGGAGAGTGGGAGG - Intronic
997428800 5:133823395-133823417 CTGGAGAGGAGGAGAGTGCAGGG - Intergenic
997438525 5:133892374-133892396 CAGGGGCAGGGGTGGGTGGATGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997817466 5:137033025-137033047 CTGGGGATGGGCAGAGAGGCAGG + Intronic
998135534 5:139672442-139672464 CTGGGGAACTTAAGAGTGGAAGG + Intronic
998164961 5:139837560-139837582 TGAGGGGAGGGGAGAGTGGAAGG + Intronic
998200170 5:140113122-140113144 GTGGGGAAGGGCAGAGTCGACGG + Intronic
998205272 5:140153180-140153202 CTGGGGGAGGGGTGAGGAGATGG - Intergenic
998471927 5:142390271-142390293 CTGGGGAGAGGGAGAGTGCAGGG + Intergenic
998494462 5:142575498-142575520 CAGAGGAAGAGGAGAGAGGAGGG - Intergenic
999233777 5:150078450-150078472 CTGGGGAGGGGTAGAGGTGATGG - Intronic
999384436 5:151144406-151144428 CTGGGGCAGGGGTGTGTGGGCGG + Intronic
999400273 5:151258893-151258915 CTGGGAGAGGTGAGAGTGGGTGG + Intronic
999742675 5:154568525-154568547 TGGGGGAAGGGGAGAGAGGCTGG + Intergenic
999873972 5:155781943-155781965 GGAGGGAAGGGCAGAGTGGATGG + Intergenic
999999739 5:157126429-157126451 CAGAGGAAGGGGGGAGGGGAGGG + Intronic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000125270 5:158237606-158237628 CTGGAGAAGTGGGGTGTGGAGGG + Intergenic
1000285929 5:159826236-159826258 CTGAGAAATGGGAGACTGGAGGG - Intergenic
1001034063 5:168284354-168284376 ATGGGGAGGTAGAGAGTGGAGGG + Intergenic
1001101852 5:168820910-168820932 GCGGGGAAGAGGAGAGAGGAAGG - Intronic
1001103250 5:168831304-168831326 TGGGGGTGGGGGAGAGTGGAGGG + Intronic
1001288402 5:170439727-170439749 CTGGGGAAGGGGAATGTTGCTGG - Intronic
1001430741 5:171660034-171660056 CTGGGGATGGGGGGTGGGGAAGG - Intergenic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001703548 5:173724673-173724695 TCGGGGAAGGGGAGAGAGGCTGG - Intergenic
1001831576 5:174793759-174793781 CTGGGGTAGGGGACTGCGGAGGG - Intergenic
1001858507 5:175033130-175033152 CTGGGGATGGCAAGAATGGATGG + Intergenic
1002060314 5:176621736-176621758 CCGGGGGAGGGATGAGTGGAAGG - Intronic
1002159185 5:177304879-177304901 CGGGGGGAGGGGAGAGGGGGAGG - Intronic
1002327705 5:178420589-178420611 GGGGGGAAGGGGGGAGGGGAAGG - Intronic
1002459946 5:179368379-179368401 CTGGGGATGTGGACAGAGGAGGG - Intergenic
1002461526 5:179376080-179376102 CTGGGGGAGGGGAAAGGGGGAGG + Intergenic
1002467067 5:179412941-179412963 TCGGTGAGGGGGAGAGTGGAAGG - Intergenic
1002668681 5:180846981-180847003 GTGGGGAAGGGTGGAGTTGAGGG - Intergenic
1002792237 6:445121-445143 CTGGGGAGGAAGCGAGTGGATGG + Intergenic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003310424 6:4965407-4965429 CTGGGGTGGGGCAGAGTGGGAGG - Intergenic
1003405077 6:5821312-5821334 CTGGGGATGGGGAGGAGGGAAGG - Intergenic
1003749884 6:9043338-9043360 CTCAGAAAGGGGAGAGTGGAAGG - Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004030026 6:11859411-11859433 GTGAGAGAGGGGAGAGTGGAGGG + Intergenic
1004710250 6:18162953-18162975 CTGGAGAAGGGGACCGTGGCAGG + Intronic
1005222077 6:23598233-23598255 CTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1005354532 6:24969705-24969727 CAAGTGAAGGGGAGAGTGGAGGG - Intronic
1005367567 6:25094636-25094658 CTGGAGTAAGGGAGAGTGGTTGG - Intergenic
1005414668 6:25587030-25587052 CTGGGGAAAGGGAGAGGGAGGGG + Intronic
1005495385 6:26383487-26383509 CTCGGGGAGGGGGAAGTGGAGGG + Intronic
1005926807 6:30451643-30451665 CAGGGGAAGAGGGGACTGGATGG - Intergenic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006054495 6:31373354-31373376 TGGTGGCAGGGGAGAGTGGAAGG + Intergenic
1006095828 6:31656161-31656183 CTTGGGAAAGGAAGAGAGGAAGG + Intronic
1006107764 6:31727100-31727122 TTGGGGGAGGGGAGAGTGTAGGG - Exonic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006285355 6:33089080-33089102 CAGGGGATGGTGAAAGTGGAAGG + Intergenic
1006307885 6:33235587-33235609 TTAGGGAGGGGGAAAGTGGAGGG + Intergenic
1006404874 6:33839079-33839101 CTGGGGAAGAGGAGTGGGGGTGG - Intergenic
1006459091 6:34147986-34148008 CAGGGGGTGGGGAGAGTGGCTGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006787966 6:36680446-36680468 GTGGGGAGGGGGAGAATGGGAGG - Intronic
1006820596 6:36891135-36891157 GTGGGGTAGGGGAGTGGGGAGGG - Intronic
1006924870 6:37648721-37648743 CAAGGGAAGGTGTGAGTGGAGGG + Intronic
1006967604 6:38004451-38004473 ATGGAGAGGGGGAGAGGGGAAGG - Intronic
1007094043 6:39202462-39202484 CTGGGGAAGGGGCAAGGTGAGGG + Intronic
1007177911 6:39909192-39909214 CAGGGGAAGGGGAGAGGGAGAGG + Intronic
1007177961 6:39909317-39909339 CAGGGGAAGGGGAGAGGGAGAGG + Intronic
1007298199 6:40844944-40844966 GTGAGGAAGGGTACAGTGGAAGG + Intergenic
1007360396 6:41351407-41351429 TGAGGGAAGGGGACAGTGGAGGG + Intergenic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007732322 6:43954699-43954721 GTGGGGTGGGGGAGGGTGGAGGG - Intergenic
1008242256 6:49127714-49127736 CTGTGCAAGGGCAGTGTGGAAGG + Intergenic
1008437783 6:51496458-51496480 CTGGAGAAGGGGATACTGGCAGG - Intergenic
1008849333 6:56005739-56005761 CTGGAGAAGGGCAGAATGGTTGG + Intergenic
1009441731 6:63688233-63688255 GAGGGGAAGGGGGGAGGGGAGGG - Intronic
1009593788 6:65708915-65708937 GAGGGGAATGGGAGAGGGGACGG - Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010365792 6:75049765-75049787 CTGGGGATGGTTTGAGTGGATGG + Intergenic
1010574819 6:77518004-77518026 GTGGGGAAGGTGAGAGTAGGGGG - Intergenic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1011361235 6:86527024-86527046 CTTGGGAAGGGGTGAGTGAAGGG - Intergenic
1011571827 6:88746269-88746291 CTGGGTAAGAGGGGAGTGGCAGG - Intronic
1011620602 6:89238991-89239013 GTGGTCAAGGGGAGAGTTGATGG - Intergenic
1011632309 6:89339492-89339514 ATGGGGGAGGAGAGAGGGGAGGG + Intronic
1011833326 6:91401067-91401089 GTGGGAGAGGGGAGAGGGGAGGG - Intergenic
1011959559 6:93070248-93070270 GTGGGGAAGGGGAAAGGGAAAGG + Intergenic
1011972253 6:93240971-93240993 CAGGGAAAGGGGAGAAGGGATGG - Exonic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013173709 6:107659887-107659909 CAGGGGAAGGGGAGGCGGGAGGG + Exonic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013423746 6:109991395-109991417 CTGGGGCAGGGAAGAGAGTACGG + Intergenic
1013639628 6:112060507-112060529 GTGTGGAAGAGCAGAGTGGAAGG + Intronic
1013703081 6:112797369-112797391 GTGGGGGATGGGAGAGTAGATGG + Intergenic
1013756460 6:113467539-113467561 ATGGGGACAGGGAGAGGGGAGGG - Intergenic
1014037695 6:116786472-116786494 CTGGGGAGGGGAAGAGTAGATGG + Intergenic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1014422866 6:121266911-121266933 GTGGGGAAGGGGCAAGGGGAGGG + Intronic
1014474933 6:121860388-121860410 CTGGGGCAGAGGAGAGAGGCAGG + Intergenic
1014638624 6:123880510-123880532 CTGGTTAAGGAGAGAATGGATGG + Intronic
1014780849 6:125562922-125562944 ATGGGGGAGGTGAGAGTGCATGG - Intergenic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015485644 6:133766952-133766974 TTAGGGAATGAGAGAGTGGAAGG - Intergenic
1015764288 6:136699545-136699567 GTGGGCGAGGGGAGAGTGGCAGG - Intronic
1016365272 6:143309016-143309038 GTGGGGAGTGGGAGAGTGGGGGG + Intronic
1017014226 6:150087168-150087190 CTGGGGAAGAGGGGAGGGCATGG + Intergenic
1017041816 6:150314259-150314281 CTGCAGAAGGGGAGAGGGGAGGG + Intergenic
1017061780 6:150491307-150491329 CTGGGGAGGGGAAGGGAGGAAGG - Intergenic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017352629 6:153459643-153459665 CTGAGGAAGGGGTAAGTGAAGGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017539991 6:155391158-155391180 CTGGGGAAGGGTAGCGGGGAGGG + Intergenic
1017637359 6:156456191-156456213 GGGAGGAAGGGGAGAGGGGAGGG - Intergenic
1018144870 6:160876801-160876823 CTGAGGAAGGGGTAAGTGAAAGG + Intergenic
1018873561 6:167801402-167801424 CTGGGGAAGGTCAGAGGAGAGGG - Intergenic
1018911004 6:168101033-168101055 CTAGGGGAGGGGACAGGGGAAGG + Intergenic
1018965520 6:168484937-168484959 CTGGGGAAGGGGAAATGGGGAGG + Intronic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019358807 7:594507-594529 CTAGGTAAGGACAGAGTGGAGGG + Intronic
1019479491 7:1260017-1260039 CGGGGGTGGGGGTGAGTGGAGGG + Intergenic
1019519046 7:1452420-1452442 CTGGGGGCGGGGAGAGAGGGAGG - Intronic
1019525112 7:1477294-1477316 GTGGGGATGGGGTGGGTGGATGG - Intronic
1019644561 7:2122014-2122036 GTGGGGAGGGGGAGACTGGAGGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019738084 7:2660253-2660275 CTGGGCAGGGGGAGCCTGGAAGG - Intronic
1020115322 7:5473000-5473022 CTGCAGCAGGGGAGAGAGGATGG - Intronic
1020459483 7:8412693-8412715 TGGGGGACAGGGAGAGTGGAAGG + Intergenic
1021161613 7:17280113-17280135 CTGGGGAATGAGAGAAGGGAAGG + Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1021904856 7:25323045-25323067 CTGGGGAAGGGGATAATGGAGGG + Intergenic
1022469784 7:30675098-30675120 CTGGGGCAAGGGAGAGTGGGAGG - Intronic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1022933195 7:35143923-35143945 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1023362478 7:39430863-39430885 CTGGGGAAGGCCAGAGTGGATGG + Intronic
1023762162 7:43475042-43475064 CTGGGGAAGGAGAGTGGTGATGG + Intronic
1023781900 7:43663722-43663744 ATGGGGAAATGGAGAGTTGATGG - Intronic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1024039166 7:45536413-45536435 CTGGGCAATGGGAGAATGCAGGG + Intergenic
1024061145 7:45699602-45699624 CTGGGGGACGGGAGGGTGGGAGG + Intronic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024452434 7:49563483-49563505 CTGGGGAAGTGGTGAGTGAGGGG + Intergenic
1024685418 7:51739232-51739254 CTGGGGAGGGGGAGAATAAATGG + Intergenic
1024818238 7:53295884-53295906 CTGGGGCACTGGAGAGTGGTGGG + Intergenic
1024859623 7:53823572-53823594 CTGGTGAAAGGGAGACTGGGTGG + Intergenic
1024874740 7:54009048-54009070 CTGGGGCAGGGCACAGAGGATGG - Intergenic
1024920158 7:54546332-54546354 CGGGAGGAGGGGAGAGGGGAAGG + Intronic
1025034512 7:55585258-55585280 GTGGGGGATGGGACAGTGGAGGG + Intergenic
1025110847 7:56214943-56214965 CTTGGGAGGCTGAGAGTGGAAGG + Intergenic
1025264956 7:57449257-57449279 CTGGGGATGGGGAGGGTAGGGGG + Intergenic
1026104155 7:67407864-67407886 ATGAGGAAGGGGAGACAGGAGGG - Intergenic
1026308739 7:69166085-69166107 GTGGGGGAGGGGAGGGGGGAGGG + Intergenic
1026308755 7:69166120-69166142 GAGGGGAAGGGAAGAGGGGAAGG + Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1026355486 7:69553564-69553586 CTGGAGAAGGGAAGTGGGGAAGG - Intergenic
1026739031 7:72966977-72966999 CTGGGGAAGGGGAGGAGAGAAGG - Intronic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1026867440 7:73832316-73832338 CCTGGGAAGTGCAGAGTGGATGG + Exonic
1027049127 7:75010562-75010584 CTGGGGAATGGCAGGGTCGAGGG - Intronic
1027104702 7:75398096-75398118 CTGGGGAAGGGGAGGAGAGAAGG + Intronic
1027218362 7:76198557-76198579 CTGGGCAAAGGAAGAGGGGAGGG + Intergenic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027698774 7:81442951-81442973 GTGGGGCCGGGGAGAGGGGAGGG - Intergenic
1027766622 7:82352125-82352147 GTGGGGTAGGGAAGACTGGATGG - Intronic
1028129097 7:87149151-87149173 CAGGGGCTGGGGAGAGGGGATGG + Intergenic
1028740720 7:94271263-94271285 GTGGGTGAGGGGAGAGGGGAGGG + Intergenic
1028963288 7:96773951-96773973 CTGGGGATGGGGAGTGGGGGTGG + Intergenic
1029290415 7:99498351-99498373 CTGGAGAAGGATAGAGGGGAAGG + Intronic
1029383893 7:100231085-100231107 CTGGGGAATGGCAGAGTCGAGGG + Intronic
1029417877 7:100454859-100454881 CTGGGGAAGGAGAGAGTGATGGG + Intergenic
1029551891 7:101240907-101240929 CTGGGGAGGGGCAGAGAAGAGGG + Intronic
1029662701 7:101973437-101973459 CAGGGGAATTGGAGACTGGAGGG + Intronic
1029791223 7:102845136-102845158 TTTGGGAAGGGGAGAGGGGCTGG - Intronic
1029829117 7:103236689-103236711 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030379977 7:108800765-108800787 CAGGAGGAGGGGAGAGGGGAAGG - Intergenic
1030997899 7:116380796-116380818 CATGGGAAGGGGTGAGTGTAGGG - Intronic
1031451871 7:121931442-121931464 CTGGGTTTAGGGAGAGTGGAGGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031657792 7:124379845-124379867 CCTGGGAAGAGGAGAGAGGAGGG + Intergenic
1032162614 7:129522445-129522467 TTGGGGAGGGGGAGAGAGGCAGG + Intergenic
1032181030 7:129677987-129678009 CGGGGGAAGGGGGGAGGGGGCGG + Intronic
1032581195 7:133105138-133105160 CTGGGGCGGGGGTGGGTGGAGGG - Intergenic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1033134951 7:138776553-138776575 AGGGTGAAGTGGAGAGTGGAGGG - Intronic
1033308624 7:140242788-140242810 CTGGGGAAGGGGATAGGGAGGGG - Intergenic
1033647736 7:143318153-143318175 GTGGGGAAGGGAAGAATAGATGG - Intronic
1033652556 7:143353788-143353810 GTGGGGGAGGGGACAATGGAGGG + Exonic
1033943280 7:146681601-146681623 GTGGGAAAGGGGAGAGTGGGAGG + Intronic
1033989396 7:147265318-147265340 CTGGTGCTGGGGAGACTGGATGG + Intronic
1034120956 7:148627386-148627408 CAGGGGAAGGTAAGAGTGGGAGG + Intergenic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034362768 7:150515078-150515100 CTGTGGGAGGGGTGAGTAGAAGG + Intronic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034439870 7:151081137-151081159 CTGGTGAAGGGGAGCGGGGAGGG - Exonic
1034526784 7:151669136-151669158 CTGGGGAAAGAGTGAGTGCAGGG - Intronic
1034560328 7:151876086-151876108 CTGGAGACGGAGAGAGGGGAGGG - Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034926265 7:155124889-155124911 CTGGTGATGAGGAGAGTGGGCGG + Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035389759 7:158496770-158496792 GTGGGGAAGGGGAGCAGGGAAGG - Intronic
1035435888 7:158858907-158858929 AGGGGGGAGGGGAGAGGGGAGGG - Intronic
1035486469 7:159230252-159230274 CTGGGCAAGGGGGGAAGGGATGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035707442 8:1688130-1688152 CTGGGGGTGAGGGGAGTGGAGGG - Intronic
1035998574 8:4576380-4576402 CTGGGGAATGGGACAGGGGAAGG - Intronic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1036440242 8:8775345-8775367 CTGGGGTAGGAAAGAGTGGCTGG + Intergenic
1036504249 8:9340940-9340962 TTGGGGAAGGGGAGGGAGAAAGG + Intergenic
1037229350 8:16636619-16636641 GATGGGAAGGGGAGAGGGGAGGG - Intergenic
1037467258 8:19172639-19172661 GAGGGGAAGGGGAGAGGAGAGGG + Intergenic
1037560835 8:20073140-20073162 CTAAGGAAGGGGAGAGAGGCTGG - Intergenic
1037726049 8:21483298-21483320 TTGGGGAAGGGAGGTGTGGATGG - Intergenic
1037787870 8:21913066-21913088 CCAGGGAAGGGGAAAGAGGATGG + Intronic
1037838925 8:22230532-22230554 CTGGGGAAGGGCAGGGTGTGAGG + Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038618697 8:29119460-29119482 CAGGTGAAGGGGAGTGGGGAGGG - Intronic
1038632666 8:29261364-29261386 ATGGGGAAAGGGAGAGGGAAAGG + Intronic
1038695909 8:29806076-29806098 TCAGGGAAGGGGAGAGGGGATGG - Intergenic
1038714683 8:29981107-29981129 CTGGGGAAGGAGAGAGGGATGGG + Intergenic
1038804661 8:30779071-30779093 CTGGGGAAGGGGTGAGGGCATGG + Intronic
1038931878 8:32202654-32202676 AAGGGGAACGGGAGAGGGGACGG + Intronic
1039444538 8:37620686-37620708 CTGGGGGTGGGGAGGGTGAAGGG - Intergenic
1039870362 8:41540520-41540542 CCGGGGAAGGGGAGCTTGGCCGG + Intronic
1039874605 8:41574952-41574974 TTGGTGGAGGGGAGAGGGGACGG - Intergenic
1040453686 8:47574745-47574767 CTTGAGAAGAGGAGAGGGGAGGG + Intronic
1040611316 8:48984973-48984995 CTTGGGAAGGAGAGTGGGGAAGG + Intergenic
1040841807 8:51792643-51792665 CTGGTGCTGGGGAGACTGGATGG + Intronic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1041758533 8:61339260-61339282 CTGGGGAATGGGGGATGGGACGG - Intronic
1041826225 8:62099180-62099202 CTGAGGAAGGGGTGAGTGAAGGG + Intergenic
1042083170 8:65078048-65078070 CTTTGGTAGGGGAGAGAGGAGGG + Intergenic
1042176518 8:66042684-66042706 AGGGGGAGGGGGAGAGAGGAGGG - Intronic
1042177832 8:66054877-66054899 CTGGGGTAGGGGAGGTGGGAGGG + Intronic
1042566011 8:70112772-70112794 ATGGGGAATGAGAGAGGGGAAGG + Exonic
1042810992 8:72824779-72824801 CTGGGAAGAGAGAGAGTGGATGG + Intronic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043003740 8:74792171-74792193 CTGGGGAAGGAGGGAGAGTACGG + Intronic
1043127496 8:76418064-76418086 CTGGAGAAAGAGAGAGTGAAGGG - Intergenic
1043314549 8:78904048-78904070 ATGAGGAGTGGGAGAGTGGAGGG - Intergenic
1043511608 8:80955526-80955548 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1043800928 8:84608540-84608562 CTGGGGAAGGGCAAAGTGGGAGG - Intronic
1044434707 8:92148373-92148395 TTGGGGAAGGGGTATGTGGAGGG + Intergenic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1045345676 8:101291438-101291460 CTGGGGATGGGGAGAGGGGTAGG + Intergenic
1045365270 8:101470237-101470259 GTGGGGTAGGGGAGAGAGGTGGG - Intergenic
1045947794 8:107816449-107816471 GTGGGGTAGGGGAGGGGGGAGGG - Intergenic
1046011805 8:108557501-108557523 CTGGGGGATGGGAGGGTGGTTGG + Intergenic
1046137803 8:110052533-110052555 CACTGGAAGGGGAGAGTGTAAGG + Intergenic
1047465799 8:125112734-125112756 TTGGGGAAGGGAAGGGTGGGAGG + Intronic
1047698117 8:127423391-127423413 CCAGGGAAGTGGAGGGTGGAAGG + Intergenic
1047811517 8:128414905-128414927 CAGGGGAAGGAGAAAGTGAAGGG + Intergenic
1047991321 8:130289553-130289575 CTGGGGAGGCGAAGACTGGAAGG + Intronic
1048049046 8:130799862-130799884 ATGGGGAATGGGGGAGTAGAAGG + Intronic
1048122616 8:131598802-131598824 CTGGGGACAGGGAAAGTGGTAGG - Intergenic
1048456696 8:134584788-134584810 CGGGGGAAGGGGAAAGAGGGCGG + Intronic
1048469002 8:134690687-134690709 CTGGGGATGGGTTGAGGGGATGG - Intronic
1048639091 8:136332975-136332997 ATGGGGAAGGGGAGAGCAAATGG - Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1048979840 8:139697324-139697346 ATGGTGAATGGGTGAGTGGATGG + Intronic
1049009029 8:139875154-139875176 CGGGGGAAGAAGAGAGAGGAGGG + Intronic
1049070605 8:140352690-140352712 CTGGGGAAGGGGTGAGTGGGAGG - Intronic
1049104174 8:140601104-140601126 CTGGGGAACTTGAGAGTGGAGGG - Intronic
1049153822 8:141055137-141055159 TGGTGGAAGGGGAGTGTGGAAGG - Intergenic
1049283482 8:141762304-141762326 CTGGGGAGGGTGAGAGGGGAGGG + Intergenic
1049301508 8:141872931-141872953 CAGGGGCAGGGGAGGGTGGTGGG + Intergenic
1049359994 8:142207808-142207830 ATGGGGAATGGGAGGATGGATGG + Intergenic
1049480646 8:142820932-142820954 ATGGGGCAGGGGGGAGGGGAGGG - Intergenic
1049575306 8:143387049-143387071 CTCGGGTTGGGGAGAGTGGTGGG - Intergenic
1049716087 8:144093347-144093369 GTGGGGTGGGGGAGAGGGGAGGG - Intergenic
1049737742 8:144218780-144218802 GGGGGGGAGGGGAGAGGGGAGGG - Intronic
1049776086 8:144405861-144405883 TGGGGACAGGGGAGAGTGGAGGG + Intronic
1049901892 9:176967-176989 CAAGGGAAGGGGGGAATGGAGGG + Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050498688 9:6271284-6271306 CTTGGGCAGGGGAGTGTGGAGGG - Intergenic
1050539334 9:6656709-6656731 GTGGGGAAGGAGGGAATGGAGGG + Intergenic
1051170786 9:14316066-14316088 CTGGGGGAGGGAAGAGGGGACGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051524768 9:18031602-18031624 CTGGGGAAGGGGAGATGGGAGGG + Intergenic
1051787955 9:20766966-20766988 GTGGGGTGGGGGAGAGGGGAGGG - Intronic
1052075804 9:24138602-24138624 ATGGGGAAGGGTAGCCTGGAAGG + Intergenic
1052164271 9:25304311-25304333 ATGGGGAAGGAGAGAGGGAAGGG + Intergenic
1052489661 9:29149597-29149619 CTAGGGAAGAGGTGAGTGAAGGG + Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052649976 9:31290411-31290433 CCAGGGAAGGGGTGAGTGAAAGG + Intergenic
1052821184 9:33138922-33138944 TTGGGGTTGGGGAGAGAGGAGGG - Intronic
1052915596 9:33922600-33922622 CTGAGGAAGAGGAGAAGGGAAGG + Intronic
1052951838 9:34219771-34219793 ATGGGAAAGGGGAGAGGAGAAGG - Intronic
1053000077 9:34573161-34573183 CTGGGCATGGGGTGAGGGGAGGG - Intronic
1053043881 9:34897380-34897402 CTGGGGAAGGGGCTAGAGAAGGG + Intergenic
1053605949 9:39658657-39658679 CTGGGGAAGGGATAAGTGAAGGG - Intergenic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053752011 9:41266612-41266634 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1053863867 9:42415281-42415303 CTGGGGAAGGGATAAGTGAAGGG - Intergenic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054247596 9:62683759-62683781 CTGGGGAAGGGATAAGTGAAGGG + Intergenic
1054257532 9:62830942-62830964 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1054333781 9:63784780-63784802 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1054561712 9:66718286-66718308 CTGGGGAAGGGATAAGTGAAGGG + Intergenic
1054775664 9:69121733-69121755 CCGGGGAGGGAGAGAGAGGAGGG - Intronic
1055018063 9:71640405-71640427 CCTGAGAAGGGGAGAGTGGGTGG - Intergenic
1055194558 9:73572804-73572826 AGTGGGAAGGAGAGAGTGGAGGG + Intergenic
1055420527 9:76136331-76136353 TTGGGGAAGTGGAGAATGCAGGG + Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1055776349 9:79770546-79770568 CTGGGCAAGGGCAGAGTTAAAGG - Intergenic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056211297 9:84367645-84367667 CTCGGCAAGGGGAGTGTGGCAGG + Intergenic
1056604936 9:88077828-88077850 ATGGGAGAGGGGAGAGGGGAGGG + Intergenic
1056688036 9:88782861-88782883 ATGGGGAAGGGAAGAGTGGAGGG + Intergenic
1057082469 9:92183337-92183359 CTGGGGAAGGGGCTAGTCTAGGG + Intergenic
1057426844 9:94958041-94958063 CTGGGGGAGGAAAGAATGGAGGG - Intronic
1057429383 9:94980131-94980153 CAGGGCCAGAGGAGAGTGGACGG - Intronic
1057429875 9:94983844-94983866 CCGGGGGAGGGGGGAGGGGAGGG - Intronic
1057483516 9:95463762-95463784 CTTGGAAAGGGGAGACTGGAGGG + Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057931304 9:99195909-99195931 GTGGGGAAGAGCAGAATGGAAGG - Intergenic
1057987304 9:99730182-99730204 CAGAGGAAGGGGAGAGTGAAAGG - Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058531143 9:105905596-105905618 CCGGGGGAGGAGAGAGCGGAGGG - Intergenic
1058607468 9:106738232-106738254 TTGGGGGATGGCAGAGTGGAGGG + Intergenic
1058748589 9:108016614-108016636 CTGGGGCATGAGAGTGTGGAAGG + Intergenic
1058750662 9:108035643-108035665 CTTGGGAAGTGAAGAGGGGAAGG - Intergenic
1058840516 9:108903218-108903240 GTGGGGTGGGGGAGGGTGGAGGG - Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1060188581 9:121578387-121578409 CTGGGGAAGGGGAGCTTTGCAGG - Intronic
1060191886 9:121599019-121599041 CTTGGGAAGGGGACAGTGCGGGG - Intronic
1060204920 9:121676800-121676822 CTGGGGAAGGGGAGCAGGAAGGG + Intronic
1060234237 9:121851409-121851431 CATGGGAATGGGAGAGTGCATGG + Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060438751 9:123618560-123618582 CTGGGGAAGGTGGGAGCGGCAGG + Intronic
1060797829 9:126524642-126524664 CTGGAGACAGGGACAGTGGAGGG - Intergenic
1060816897 9:126639692-126639714 CTGGGGAGGGGGGCAGAGGAGGG + Intronic
1060822068 9:126667094-126667116 CTGGGAAAGGGGTGAGGGAACGG - Intronic
1060828749 9:126700926-126700948 AGGTGGAAGGTGAGAGTGGAGGG - Exonic
1060943041 9:127554306-127554328 TTGGGGTAAGGGTGAGTGGAGGG - Intronic
1060982539 9:127802202-127802224 CTGGGAAGAGGGAGAGGGGAAGG + Intronic
1061022667 9:128026365-128026387 CTGGGGCAGACGAGAGAGGAAGG + Intergenic
1061060285 9:128246783-128246805 GGAGGGAAGGGGAGAATGGAAGG - Intronic
1061156060 9:128862549-128862571 CTGGGGCAGGGCAGAGAAGAGGG - Intronic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061241755 9:129378567-129378589 CGGGGGAAGGCGAGACTGGCTGG + Intergenic
1061271281 9:129544840-129544862 CTGGGGAGGTGGAGAGTAGGAGG - Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061365574 9:130171231-130171253 CTGGGGTAGGGGAGAGAGCGGGG - Intergenic
1061445317 9:130634179-130634201 CTGGGGTAGGGCAGAGGGAAAGG - Intronic
1061507995 9:131042916-131042938 GTGTGAAAGGGGAGAGTTGATGG - Intronic
1061517051 9:131096258-131096280 CCGGGGAGGGGCAGAGAGGAGGG + Intergenic
1061539919 9:131272619-131272641 CTGGGGCAGGGGAGACAGGAAGG + Intronic
1061624807 9:131835465-131835487 TGGGGGAGGGGGAGAGAGGAGGG - Intergenic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1061791284 9:133060651-133060673 CTGGGGCAGGGCAGAGGGAAAGG - Intergenic
1061794947 9:133081128-133081150 CTGGGGCAGGGGAGAGGGAAAGG - Intronic
1061832357 9:133304072-133304094 CTGGGGAAGGGGTGAGCCGAGGG - Intergenic
1061842438 9:133367130-133367152 CTGGAGAAGAGGGGAATGGAGGG + Intronic
1061921533 9:133785159-133785181 CTGGTGAAATGGAGAGGGGAAGG - Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062169091 9:135124563-135124585 CAGGGGAAGGGAAGAAAGGAAGG + Intergenic
1062169899 9:135129193-135129215 CTGGGGAAGTGGGGTGGGGATGG + Intergenic
1062215299 9:135385890-135385912 GTGGGCACGGGGAGGGTGGAGGG - Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062446556 9:136597705-136597727 CAGGGGGAGGGAAGGGTGGAGGG + Intergenic
1062448365 9:136605096-136605118 CTGGGGCAGGGGAGGGCGGCAGG + Intergenic
1062476997 9:136733161-136733183 ATGGGGAAGGGGAGAGTGCTGGG + Intergenic
1062546688 9:137066721-137066743 CTGGGTAAGGGAGGAGTGGGCGG + Intronic
1062549618 9:137079979-137080001 CTGGGGCACGGGAGAGCAGAGGG - Intronic
1062580671 9:137227956-137227978 GTGGGGGAGGGGAGAGGTGAGGG + Intronic
1203744842 Un_GL000218v1:35982-36004 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1203473969 Un_GL000220v1:134708-134730 TGGGGGAAGGGGAGAGAAGACGG - Intergenic
1203475222 Un_GL000220v1:144360-144382 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203362626 Un_KI270442v1:231031-231053 TGGGGGAAGGGGAGAGAAGACGG + Intergenic
1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203707786 Un_KI270742v1:68399-68421 CTGGGGATGCGGACAGAGGAGGG - Intergenic
1203565262 Un_KI270744v1:83502-83524 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
1185459511 X:328279-328301 AGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459521 X:328298-328320 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459569 X:328388-328410 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459580 X:328408-328430 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459591 X:328428-328450 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459659 X:328560-328582 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459670 X:328580-328602 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459681 X:328600-328622 GGGGGGACGGGGAGAGGGGAGGG - Intergenic
1185459748 X:328722-328744 GGGGGGAGGGGGAGAGGGGAGGG - Intergenic
1185459768 X:328754-328776 GGGGGGAGGGGGAGAGGGGAGGG - Intergenic
1185459843 X:328892-328914 GGGGGGAGGGGGAGAGAGGAGGG - Intergenic
1185459926 X:329070-329092 GGGGGGACGGGGAGAGAGGAGGG - Intergenic
1185459935 X:329090-329112 GGGGGGACGGGGAGAGAGGAGGG - Intergenic
1185640517 X:1587856-1587878 GAGGGGAAGGGGGGAGGGGAGGG - Intergenic
1185640553 X:1587925-1587947 CAGGGGAAGGGGGGAGGAGAGGG - Intergenic
1185682454 X:1899679-1899701 CTTGGCAAGGGGAGTGTGGCAGG + Intergenic
1185756752 X:2659392-2659414 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756762 X:2659414-2659436 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756867 X:2659631-2659653 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756877 X:2659653-2659675 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756887 X:2659675-2659697 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756897 X:2659697-2659719 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756907 X:2659719-2659741 GGAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756915 X:2659736-2659758 GGAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756923 X:2659753-2659775 AGGGGGAAGGGGAGGGGGGAGGG - Intergenic
1186202518 X:7168737-7168759 CTGGGTAAGGACAGAGAGGAAGG - Intergenic
1186293233 X:8121860-8121882 ATGGGGGAGGGGGGAGGGGATGG - Intergenic
1186660731 X:11665390-11665412 CGGGGCAAGGAGAGAGTGCAGGG - Exonic
1186741029 X:12518037-12518059 CTGAGGCTGGGGAGACTGGATGG - Intronic
1186821440 X:13291687-13291709 CTGGGGAAGCCGAGATGGGAGGG + Intergenic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187195579 X:17080403-17080425 CTTGGCAAGGGGAGAGTGAGGGG - Intronic
1187253464 X:17620866-17620888 GTGGGGAGGGGAAAAGTGGAGGG + Intronic
1187346907 X:18473841-18473863 CTGGGGGTGGGGAGAGGGGATGG + Intronic
1187580420 X:20601949-20601971 CTGAGGGAGGGAAGAGTTGAAGG + Intergenic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1187831708 X:23389075-23389097 CTGGGGAATGGGACAGAGAATGG - Intronic
1188079226 X:25815541-25815563 AGGGGGAAGGGGAGAGGGAAGGG - Intergenic
1188221883 X:27550680-27550702 GATGGGAAGGGGAGAGGGGAGGG - Intergenic
1189021975 X:37350036-37350058 CTGGGGGATGGGAGAGCGGGGGG + Intronic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189261591 X:39682769-39682791 ACGGGGAACGGGAGAGAGGAAGG + Intergenic
1189317223 X:40064600-40064622 CTGGGGGAGGGGAGACAAGAGGG + Intronic
1189363295 X:40369631-40369653 TTGGGGCAGGGGAGTGGGGAGGG + Intergenic
1190158424 X:48012380-48012402 CAGGGGAAAGGGAGATTAGAAGG + Intronic
1190204799 X:48394294-48394316 CTGCGGAAGGGGAGCGCAGATGG + Intergenic
1190205737 X:48401109-48401131 CTGCGGAAGGGGAGCGCAGATGG - Intergenic
1190227257 X:48555723-48555745 CTTGGCAAGGGGAGTGTGGCAGG + Intronic
1190324765 X:49199824-49199846 CAAGGGGAGGGGAGAGTGGAAGG - Intronic
1190789559 X:53686369-53686391 CTGGGGGAGGGGAGAGGAGGCGG + Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191671801 X:63755106-63755128 CGGGGGATGGGGAGAGAAGAGGG - Exonic
1191778371 X:64843050-64843072 TTCAGGAAGGGGAGAGTGGCTGG - Intergenic
1191858043 X:65643385-65643407 CTGGGCAAGGCAAGAGTGGGAGG + Intronic
1192053211 X:67746106-67746128 AGGGAGAAAGGGAGAGTGGAGGG - Intergenic
1192079444 X:68032958-68032980 TTGGGGAGGGGGAGAGTGCCAGG - Intergenic
1192172388 X:68865145-68865167 CTGAGGTGGGGGAGAGGGGAGGG - Intergenic
1192333544 X:70199467-70199489 CAAGGGTAGGGGAGAGGGGAAGG + Intronic
1192362623 X:70449163-70449185 CTGGGGAATTGGGGAGGGGATGG + Intronic
1192437571 X:71152406-71152428 CTGGGGTGGGGGAAAGGGGAAGG - Intronic
1192831817 X:74758156-74758178 TTGGGGAAGAGGAGAGTGGGTGG + Intronic
1193365174 X:80623244-80623266 CTGGAGCTGGGGAGACTGGATGG - Intergenic
1193389761 X:80912708-80912730 GTGGGGTAGGGGATAGGGGAGGG + Intergenic
1193612418 X:83648863-83648885 GTGGGGTAGGGGACAGGGGAGGG - Intergenic
1193705761 X:84819139-84819161 CTGGGGTGGGGGGGAGGGGAGGG + Intergenic
1193881595 X:86929490-86929512 CTGGGGAAGGGGAGTGGTTAGGG + Intergenic
1193938006 X:87645893-87645915 CTGGGCAAGGGAAGAGTAGGAGG + Intronic
1194288593 X:92040119-92040141 CTGGGGCTGGGGGGATTGGAGGG + Intronic
1194348513 X:92796029-92796051 AGGGGGAAGGGGAGGGGGGAAGG + Intergenic
1194348524 X:92796048-92796070 AAGGGGGAGGGGAGAGGGGAGGG + Intergenic
1194385417 X:93246494-93246516 CTGGGGTGGGGGGGAGGGGAGGG - Intergenic
1194391013 X:93318068-93318090 CTAGGAAAGGAGAAAGTGGAAGG + Intergenic
1194558549 X:95393105-95393127 CTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1195001131 X:100644534-100644556 TTGGGGTAGTGGAGTGTGGAGGG - Intronic
1195250066 X:103034931-103034953 CTGGGGAAACGTAGTGTGGAGGG - Intergenic
1195329198 X:103782947-103782969 CTGGGGATGGGGGGAGAAGAAGG - Intronic
1195425905 X:104730364-104730386 CTGGGGTGGGGGGGAGGGGAGGG - Intronic
1195687465 X:107599802-107599824 CTGAGGGTGGGAAGAGTGGAGGG - Intronic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196237507 X:113299905-113299927 GAGGGGGAGGGGAGAGGGGAGGG - Intergenic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196595692 X:117543054-117543076 ATGGGGTAGGGGAGAGTTCAGGG + Intergenic
1196599886 X:117589795-117589817 CTGGTGCTGGGGAGACTGGATGG + Intergenic
1196768645 X:119272214-119272236 CGGGGGGAGGGGAGAGAGGCTGG - Intergenic
1197001492 X:121444838-121444860 CTAAGGAAGGAAAGAGTGGAGGG - Intergenic
1197417835 X:126196942-126196964 CAGGAGCAGGAGAGAGTGGAGGG - Intergenic
1197704313 X:129622965-129622987 CTGGGGCAGGGGAGAGGGGTTGG - Intergenic
1197756854 X:130001701-130001723 CTGGGGGTGGTGAGAGTGGTGGG + Intronic
1197841687 X:130754736-130754758 AAGGGGGAGGGGAGAGAGGAAGG + Intronic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1198024043 X:132687503-132687525 CTGGGGGAGGGGAGAGTTAATGG + Intronic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198233363 X:134714334-134714356 CAGGGGAAGGGGAGAGAGAGAGG - Intronic
1198782960 X:140257184-140257206 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
1198867017 X:141133908-141133930 TTGAGGAAGAGGAGACTGGAGGG + Intergenic
1198920141 X:141716521-141716543 CGGGGTGAGGGGAGAGGGGAGGG - Intergenic
1199025080 X:142927097-142927119 CTGGGAAAGGTGAGTGGGGAAGG + Intergenic
1199736718 X:150692935-150692957 GTATGGAGGGGGAGAGTGGAGGG + Intergenic
1199854614 X:151750204-151750226 CTGGGGAAGGAGAGAATGTCAGG + Intergenic
1200039668 X:153355991-153356013 CTGGGGAGTTGGGGAGTGGAGGG - Intronic
1200064937 X:153499777-153499799 CTGGGGCCTGGGAGAGTGGCAGG + Intronic
1200097964 X:153673082-153673104 CAGGGGCAGGGGAGAGGTGATGG + Intronic
1200136216 X:153875945-153875967 CTGGGAGAGGGGAGAAGGGAAGG + Intronic
1200149107 X:153942797-153942819 CAGGGGAGTGGGGGAGTGGAAGG + Intronic
1200373240 X:155750279-155750301 GGGGGGAAGGGAAGAGTGTAAGG + Intergenic
1200606114 Y:5264684-5264706 CTGGGGCTGGGGGGATTGGAGGG + Intronic
1200656855 Y:5912685-5912707 AAGGGGGAGGGGAGAGGGGAGGG + Intergenic
1200689120 Y:6288810-6288832 GTGGGGTAGGGGGAAGTGGAGGG - Intergenic
1201046153 Y:9885912-9885934 GTGGGGTAGGGGGAAGTGGAGGG + Intergenic
1201158180 Y:11151025-11151047 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1201774286 Y:17646624-17646646 TGGGGGAAGGGGAGAGAAGAGGG - Intergenic
1201827271 Y:18259365-18259387 TGGGGGAAGGGGAGAGAAGAGGG + Intergenic
1202302745 Y:23434977-23434999 CTGAGGCAGGGGACACTGGAAGG + Intergenic
1202303875 Y:23447241-23447263 CTGGGCAAGGCGATAATGGAAGG - Intergenic
1202566935 Y:26223350-26223372 CTGGGCAAGGCGATAATGGAAGG + Intergenic
1202568066 Y:26235617-26235639 CTGAGGCAGGGGACACTGGAAGG - Intergenic