ID: 917496212

View in Genome Browser
Species Human (GRCh38)
Location 1:175542345-175542367
Sequence GGAGGCATTTAGCCCACCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917496207_917496212 12 Left 917496207 1:175542310-175542332 CCACAGGAAGTTTGGAAGGGGGG 0: 1
1: 0
2: 1
3: 19
4: 193
Right 917496212 1:175542345-175542367 GGAGGCATTTAGCCCACCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917496212 Original CRISPR GGAGGCATTTAGCCCACCTC GGG Intronic
902512601 1:16974592-16974614 GGGGGGATGTAGCCTACCTCGGG + Exonic
902693701 1:18126459-18126481 AGAGGCATTTATCCCAGATCTGG - Intronic
911626197 1:100127701-100127723 GGAGGCACTGTGCCCAGCTCAGG - Intronic
916213308 1:162375356-162375378 TGAGGCATCCAGCCCAGCTCAGG - Exonic
917496212 1:175542345-175542367 GGAGGCATTTAGCCCACCTCGGG + Intronic
918308843 1:183270985-183271007 GGAAGCAGTTAGCCCACGGCTGG + Intronic
924744379 1:246818486-246818508 GGGGGGATGTAGCCTACCTCGGG - Intergenic
1063649500 10:7918914-7918936 GGAGGCACTCACCTCACCTCCGG + Intronic
1067527731 10:47048454-47048476 GGAGGCATTCAGCCCAGCCTGGG + Intergenic
1068949588 10:62763570-62763592 GGAAGCATTGAGCCCAGCACTGG - Intergenic
1069515412 10:69073152-69073174 GGGGTCATTTACCCAACCTCGGG + Intergenic
1069842216 10:71346985-71347007 AGAGGGAATTAGCCCACCCCTGG + Intronic
1071566705 10:86674892-86674914 GGATGCCTTCACCCCACCTCAGG - Intronic
1074069629 10:110052973-110052995 CCAGGTATTTTGCCCACCTCAGG - Intronic
1075064699 10:119281598-119281620 GGAGGGATCTGGCCGACCTCGGG + Intronic
1075709687 10:124523972-124523994 GGGGTCATTTAGCTCACCTGAGG + Intronic
1076399528 10:130172143-130172165 GGAGGTCTTTAGGCCACCTTTGG + Intronic
1081461744 11:43278687-43278709 GGAAGCATTCAGCACCCCTCAGG - Intergenic
1081565590 11:44259023-44259045 GGATGCAGGTAGCCCACCCCTGG - Intergenic
1081749616 11:45500653-45500675 GGAGGTCTTTAGTGCACCTCTGG + Intergenic
1083684772 11:64369614-64369636 CGAGGCAGCTCGCCCACCTCCGG - Exonic
1084898531 11:72293176-72293198 GGAGGAATTTCGCCCTACTCTGG - Exonic
1085032950 11:73283676-73283698 GGAGCCTTTGAGCCCAGCTCCGG - Intronic
1085449203 11:76621995-76622017 GGAGACATTTTTCCAACCTCAGG - Intergenic
1088040812 11:105379622-105379644 GGAGACATTCAGACCACATCAGG - Intergenic
1089271625 11:117305513-117305535 GGCGCCACTTACCCCACCTCTGG + Intronic
1091995012 12:4986650-4986672 GCTGGTATTTAACCCACCTCTGG + Intergenic
1093190793 12:16072735-16072757 AGAGGCATTTAGGCAATCTCTGG + Intergenic
1096732768 12:53627544-53627566 GGTGGCAGTGAGCCCACATCAGG + Intergenic
1110935214 13:81279172-81279194 AGAGGCATTGAGTCCACCTGGGG + Intergenic
1111946347 13:94669637-94669659 GGAGGCATTTGACTCAACTCTGG - Intergenic
1117282626 14:54255766-54255788 GGAGGCATTAAGGCCTCCGCAGG - Intergenic
1117956920 14:61130269-61130291 GGATACATGTAGCCCACCTGGGG + Intergenic
1121171627 14:91859367-91859389 TGAGGTCTTTAGCTCACCTCAGG + Intronic
1122142455 14:99671060-99671082 GGAGGAATCTAGCCCACTTCTGG - Intronic
1124056154 15:26242548-26242570 GGTGGCCTCTAGGCCACCTCTGG + Intergenic
1132866181 16:2093776-2093798 GGAGGCCTGTAGCCTACCCCTGG + Intronic
1134013771 16:10874340-10874362 GGAGGAATGAAGCCCACCCCAGG - Intergenic
1136102005 16:28003509-28003531 GGAGCCAATTGGCCCAGCTCAGG + Intronic
1137471275 16:48760871-48760893 GGAGGCATTTAGCCCATTTAAGG - Intergenic
1138555248 16:57767053-57767075 GGAGGCAGTGAGCACCCCTCAGG - Intronic
1139187079 16:64819393-64819415 GGAGGAATTTAGGTCACCTAGGG - Intergenic
1141576345 16:84966472-84966494 GGAGGCTCTGAGCCCACCTTTGG - Intergenic
1147521306 17:41176071-41176093 GGAGCCCTGTAGTCCACCTCTGG - Intergenic
1152830527 17:82494498-82494520 GGAGGCATTTTGCCCAAGCCAGG + Intergenic
1156362841 18:36399575-36399597 GGAGGCATTTTCTCCACCCCAGG + Intronic
1163762903 19:19146742-19146764 GGAGGTGTTTAGTCCCCCTCGGG + Exonic
1164375564 19:27680675-27680697 AGAGACCTTTGGCCCACCTCAGG - Intergenic
1164905742 19:31966595-31966617 GGGGACATTTAGCCCATCTTAGG - Intergenic
1165801287 19:38552184-38552206 TGAAGCAATCAGCCCACCTCAGG + Intronic
929758634 2:44788148-44788170 TGAGGCACTGACCCCACCTCCGG - Intergenic
932346035 2:70995540-70995562 GGATGCATTTACTACACCTCTGG + Intergenic
933340055 2:81012881-81012903 GGAGGAATTAAGCTGACCTCAGG - Intergenic
937984474 2:127632396-127632418 GGAGGCACTGGGCTCACCTCAGG - Exonic
939670573 2:145006801-145006823 GGAGGCATTTATGCCAAGTCAGG + Intergenic
942746542 2:179240748-179240770 GGAGGCATATAACACCCCTCAGG + Intronic
944904658 2:204250708-204250730 GGAGGCATTTTATCCAGCTCAGG + Intergenic
947228777 2:227864879-227864901 GGTGGCATTATGCCCACCCCAGG + Intergenic
947772520 2:232681900-232681922 GCAGGCATCTGGCCCACCCCAGG - Exonic
1179126314 21:38594347-38594369 GGAGGCATGTTGTCAACCTCAGG - Intronic
1179663459 21:42893173-42893195 GGAGGCACTTAGCCCTACTGGGG + Intronic
1179787920 21:43740289-43740311 GGAGCCATGGAGCCCTCCTCTGG + Intronic
1181591910 22:23890527-23890549 GGAGGCCTTTAGGCCACCCGAGG + Intronic
1183747693 22:39701106-39701128 TGAGGCGTTTTGCCCACATCTGG + Intergenic
949467850 3:4362022-4362044 GCAGGTATGTAACCCACCTCAGG + Exonic
960319144 3:116213098-116213120 TCATGCATTTATCCCACCTCTGG - Intronic
962399932 3:135049666-135049688 GGAGGCATAGACCCCACTTCTGG + Intronic
962973018 3:140422522-140422544 GGGGTAATTTAACCCACCTCTGG + Intronic
964203788 3:154148061-154148083 GGAGTCATTTTGTCCACCTGAGG - Intronic
964703381 3:159593253-159593275 ACAGGCCTTTAGCCCAACTCTGG + Intronic
964864388 3:161239943-161239965 GGTGGCATTTTGCCAACCTCTGG + Intronic
967230788 3:187335674-187335696 TGAGGCACTTAAACCACCTCAGG - Intergenic
983050224 4:163037909-163037931 GGAAGCATTTAGACCATTTCTGG + Intergenic
986711347 5:10490155-10490177 TCAGGAATTTAGCCCAGCTCAGG - Intergenic
987873937 5:23655726-23655748 GAAAGCATTTAGACCACATCTGG + Intergenic
988297249 5:29381326-29381348 GGAGGCATTTTTTCCACCTTTGG + Intergenic
990013558 5:51029423-51029445 GGAGGCACTTTGCCCAGCGCAGG - Intergenic
990023966 5:51162397-51162419 TGGGGCATTTAGCCCATTTCAGG - Intergenic
991442500 5:66665608-66665630 GGAGGCACTTAGGACATCTCGGG + Intronic
993060409 5:83031605-83031627 GGAGGCATTTAGTCCAACTATGG - Intergenic
995012535 5:107274140-107274162 GGATGCATTCAGCCCACCACAGG - Intergenic
999177005 5:149638829-149638851 GGAAGCAAACAGCCCACCTCTGG - Intergenic
1003006419 6:2386855-2386877 GTAGCCATTCAGCCCACCACAGG - Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1005944095 6:30583302-30583324 GGAGGCATTTTCCACACCTTAGG + Intronic
1005997314 6:30939388-30939410 GGAGTAATTTTGCCCACATCAGG - Intergenic
1012277308 6:97290000-97290022 GGATTCAGTTAGCCCACCTCCGG + Intergenic
1019456675 7:1131282-1131304 GGCAGCATTGAGCCCACCTAGGG + Intronic
1023192493 7:37597699-37597721 GAAGGTATTTAGCATACCTCAGG + Intergenic
1024065288 7:45727162-45727184 GGAGGCATTTGGCCTAGCTTGGG + Intergenic
1024208611 7:47184839-47184861 GGAGGCATCTAGAACACCTGGGG + Intergenic
1025844180 7:65180839-65180861 GGTGGCATTTAGCCCACCCAGGG - Intergenic
1025894506 7:65687150-65687172 GGTGGCATTTAGCCCATCCAGGG - Intergenic
1034983982 7:155496370-155496392 TGAGGCATTCAGGCCACATCGGG + Intronic
1035825642 8:2641860-2641882 GGAGGCACTTAGCTTAGCTCAGG + Intergenic
1039437070 8:37566990-37567012 GAAGACATTTACCCCACCTGCGG + Intergenic
1040429556 8:47325777-47325799 GGAGGCAATGATCCCACCTCAGG - Intronic
1040497877 8:47982672-47982694 CGAGGCAGGTAGACCACCTCTGG + Intergenic
1042031764 8:64483864-64483886 TAAGGGATTTTGCCCACCTCCGG - Intergenic
1042696103 8:71556684-71556706 GGAGGCTTTAAGCCCACCGAGGG + Intronic
1045009459 8:97944811-97944833 GGAGGCATGTACTCCACTTCTGG + Intronic
1045046631 8:98285250-98285272 GGAGGACTTGAGCCCACCTGTGG + Intronic
1046749686 8:117913894-117913916 TTAGGCAATTTGCCCACCTCAGG + Intronic
1047191320 8:122681493-122681515 GGCTGCATTTTCCCCACCTCTGG + Intergenic
1047389471 8:124438424-124438446 GCAGGCATGTAGCCCACATTTGG + Intergenic
1049992199 9:1000575-1000597 GGAGGCCTTTAGGCCACAACGGG - Intergenic
1053195934 9:36118600-36118622 CCCAGCATTTAGCCCACCTCAGG + Intronic
1060740562 9:126095287-126095309 GGAGGCTTTTAGGCCACATCTGG + Intergenic
1062725977 9:138073805-138073827 GGAGTCATGAAACCCACCTCAGG - Intronic
1186108959 X:6235865-6235887 GTAGGCATATAGACCACCTCTGG + Intergenic
1189198013 X:39167877-39167899 TGAGGCATTTAGCTCATCTCTGG + Intergenic
1191229342 X:58081807-58081829 AGAGACACTTAGCCAACCTCAGG + Intergenic
1191242606 X:58201236-58201258 GGAGGCACATGGCCCACCCCAGG + Intergenic
1198970857 X:142277977-142277999 GGAGGCACTGATCCCACTTCTGG - Intergenic