ID: 917496635

View in Genome Browser
Species Human (GRCh38)
Location 1:175546403-175546425
Sequence CAAGCAAGAAGCAGAATTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 363}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917496635 Original CRISPR CAAGCAAGAAGCAGAATTGC CGG Intronic
900269870 1:1781551-1781573 CGGGCAAGAAGCAGAATTGGTGG + Intergenic
902177730 1:14663798-14663820 ATAACTAGAAGCAGAATTGCTGG - Intronic
903922228 1:26808212-26808234 ACAGCCAGAAGTAGAATTGCTGG + Intergenic
905147518 1:35899400-35899422 ATACCCAGAAGCAGAATTGCTGG + Intronic
905861719 1:41356484-41356506 CAAGAAACATGCAGGATTGCTGG + Intergenic
905888770 1:41506991-41507013 CAACACAGAAGCAGAATTGGTGG + Exonic
907070724 1:51532353-51532375 CAAGCAAGAGAGGGAATTGCTGG + Intergenic
907728843 1:57046262-57046284 CAAGCACTAAGCACACTTGCTGG + Intronic
907875264 1:58480373-58480395 AAAGCAAGAAACAGAATTGGGGG - Intronic
908223467 1:62032673-62032695 CAAACAAGAAGCTGAATTAGAGG + Intronic
908695965 1:66842136-66842158 CAAGCCAGAAGCAGACCTGGAGG - Intronic
908873763 1:68646003-68646025 CAAGATAGAAGCAGATTTGCAGG - Intergenic
908891304 1:68851284-68851306 ATACCAAGTAGCAGAATTGCTGG + Intergenic
908920366 1:69183820-69183842 CAAGCAAGTAGTCAAATTGCAGG - Intergenic
909205499 1:72752015-72752037 GAAGCAAGCACCAGAATTGTAGG + Intergenic
910824362 1:91389951-91389973 AAACCCAGAAGTAGAATTGCTGG - Intronic
911850859 1:102818275-102818297 CAAGAAAGAAGAAAAATTGATGG - Intergenic
912224149 1:107712932-107712954 AAAGCAAGAGGAAGAATTTCGGG + Intronic
914745211 1:150496586-150496608 GAGGGAGGAAGCAGAATTGCGGG + Exonic
914941385 1:152026027-152026049 CAACCCAGAAATAGAATTGCTGG - Intergenic
915871323 1:159562614-159562636 CATGCAAGATGCTGAATTACTGG + Intergenic
916870302 1:168906861-168906883 AAAGCAAAAAGCAAAAATGCTGG + Intergenic
917496635 1:175546403-175546425 CAAGCAAGAAGCAGAATTGCCGG + Intronic
919100774 1:193094746-193094768 CAAGTAAGAAGCATCATTGATGG + Intergenic
919315667 1:195968305-195968327 CAAGTAAGAATCACAATTACAGG + Intergenic
919843388 1:201625616-201625638 AACTCAAGAAGCAGAAATGCAGG + Intronic
921248308 1:213271059-213271081 ATTGCTAGAAGCAGAATTGCTGG - Intronic
921428793 1:215038807-215038829 CATTCAAAAAGCAGAAGTGCTGG - Intronic
922623164 1:227006996-227007018 CCACCACCAAGCAGAATTGCTGG - Intronic
922875586 1:228937503-228937525 CAAGCAAGAAGCACGGCTGCGGG - Intergenic
922927819 1:229364976-229364998 AAAGCAAGTAGGATAATTGCTGG + Intergenic
923503422 1:234585137-234585159 TCCGCAGGAAGCAGAATTGCTGG + Intergenic
924190712 1:241549373-241549395 AAAGAAAGAAAAAGAATTGCAGG + Intronic
924328773 1:242921788-242921810 AAAGCAAGAGGCAGAATGGAAGG + Intergenic
924714035 1:246555643-246555665 ACAGCTAGAAGTAGAATTGCAGG - Intronic
924875588 1:248099916-248099938 CAGGCAAGAAGCAACATGGCTGG - Exonic
1063694658 10:8322076-8322098 CAAGCAAGAAGGAGACTGGATGG + Intergenic
1063782026 10:9336050-9336072 GAACCCAGAAGTAGAATTGCTGG - Intergenic
1064328258 10:14371016-14371038 AAAGCAAGAAGCAGAAATAGAGG - Intronic
1064877400 10:20010080-20010102 CAAGCAAGGAACAGAAGTTCAGG - Intronic
1065345778 10:24746889-24746911 AAACCCAGAAGCAGGATTGCTGG - Intergenic
1065550714 10:26866037-26866059 AAAAAAAGAAGAAGAATTGCAGG + Intergenic
1067052912 10:43034521-43034543 ATACCCAGAAGCAGAATTGCTGG - Intergenic
1068392232 10:56413474-56413496 CAAGCAGAAAGCAGAAATTCTGG - Intergenic
1070014206 10:72509289-72509311 AAAGTAAGAGGCAGCATTGCAGG + Intronic
1072076308 10:91977591-91977613 ATATCAAGAAGCACAATTGCTGG + Intronic
1072690034 10:97566684-97566706 GAAGCAAGGAAGAGAATTGCAGG - Intronic
1072995525 10:100240367-100240389 CAATCAAAAAGAATAATTGCAGG + Intronic
1073097176 10:100987021-100987043 CAAGCGAGAAGGAGGATAGCGGG + Intronic
1073634739 10:105186136-105186158 CAAGCCAGAAGTGGAATTGGTGG + Intronic
1074666890 10:115737761-115737783 TTAGAAAGAAGCAGAATTGGGGG - Intronic
1074830441 10:117244375-117244397 TGAGTAAGAAGCAGAATTCCAGG - Intronic
1074856358 10:117476947-117476969 CAGGCAAGAAGCAGAAAGACAGG - Intergenic
1075600018 10:123760976-123760998 CAAGCAAGAAGCATTATGCCTGG + Intronic
1076235705 10:128862396-128862418 CAAGCAAGAAGCAGTGATCCAGG + Intergenic
1076718573 10:132381865-132381887 CAAGCAAGTACCAGAATTTAGGG + Intergenic
1076851154 10:133093742-133093764 CAAGTCAGAAGCAGAGTTCCTGG - Intronic
1077736830 11:4800266-4800288 CAAGCATGAAGGAGGCTTGCAGG - Intronic
1078576415 11:12506751-12506773 GAAGCAAGACTCAGAATTGGTGG + Intronic
1078783842 11:14467518-14467540 ATATCTAGAAGCAGAATTGCTGG - Intronic
1078793267 11:14566504-14566526 CAAGCAGTAAGCAGAGTTGTAGG - Intronic
1079142568 11:17822223-17822245 CAGGCAGGCAGCAGAATTACTGG + Intronic
1079378790 11:19918357-19918379 CAAGCCAGAAGCAAAGTTGATGG - Intronic
1081984174 11:47289619-47289641 CAAGCCAGAATGAGAAGTGCTGG - Intronic
1082081562 11:48016209-48016231 CAAGCAAGAAGCAGAGGTATGGG - Intronic
1083512613 11:63225964-63225986 GAATCAAGAAGCAGAAATTCTGG - Intronic
1083882881 11:65557241-65557263 CCCGCAAGAAGCAGACTTGCTGG - Intronic
1084852337 11:71951951-71951973 ATACCTAGAAGCAGAATTGCTGG - Intronic
1084896411 11:72273705-72273727 TAAGCTAGGAGTAGAATTGCTGG + Intergenic
1085131535 11:74043494-74043516 AAAACTAGAAGCAGAATTACTGG + Intronic
1086763808 11:90669174-90669196 CAGGCAAGAAGCAGGATTCAGGG - Intergenic
1088248588 11:107842770-107842792 ATATCTAGAAGCAGAATTGCTGG - Intronic
1088751250 11:112844033-112844055 CAACCAAGAAGGAAAAGTGCAGG + Intergenic
1088951596 11:114576818-114576840 ATACCAAGAAGCAGGATTGCTGG - Intronic
1089108843 11:116038020-116038042 CAAGCCAGCAGCAGAACTGTAGG + Intergenic
1089151440 11:116367377-116367399 CAGGCAGGAAGCAGAAGGGCCGG - Intergenic
1089814442 11:121159900-121159922 CAGGCAGCAAGCAGATTTGCTGG - Intronic
1092295307 12:7192402-7192424 CAAGAAAGAAGATAAATTGCAGG - Intronic
1093074475 12:14743487-14743509 CAAGCTAAAAGCAGACTTGGGGG - Intergenic
1093261842 12:16948524-16948546 GAAGCAAGAAGAAGAATATCTGG - Intergenic
1093336614 12:17912600-17912622 CAAGGAAGGAGCAGAAAGGCTGG - Intergenic
1094628779 12:32151807-32151829 GAAGAAAGAAGCAGATGTGCAGG - Intronic
1095682102 12:44989778-44989800 ATACCTAGAAGCAGAATTGCTGG - Intergenic
1095812045 12:46382442-46382464 CATCTAAGAACCAGAATTGCAGG - Intergenic
1098491825 12:71091244-71091266 CAAGCATGAAGAAGAAATACAGG - Intronic
1098574178 12:72022431-72022453 CAAGCAAGAAGGGCAACTGCGGG + Exonic
1099294281 12:80810603-80810625 CTCCCCAGAAGCAGAATTGCTGG + Intronic
1100769853 12:97909934-97909956 CCAGGTAGAAGCAGAATTGAGGG - Intergenic
1100888135 12:99095199-99095221 CGACCAAGAAACAGAATTGCTGG - Intronic
1102987401 12:117289818-117289840 GAAGCTAAAAGCAGACTTGCGGG - Intronic
1103185888 12:118956719-118956741 TGAGTAAAAAGCAGAATTGCAGG - Intergenic
1104622111 12:130322739-130322761 AAATCCAGGAGCAGAATTGCTGG + Intergenic
1105023469 12:132833520-132833542 CAAGTAAGAAACGGAGTTGCTGG + Intronic
1105612090 13:21977613-21977635 AAAACCAGAAGCAGAATTGAGGG + Intergenic
1106317808 13:28610438-28610460 ACACCTAGAAGCAGAATTGCTGG + Intergenic
1106353664 13:28958305-28958327 CAAGCAAGCAGTAGGCTTGCGGG - Intronic
1107005887 13:35611168-35611190 AAACCAAGAAGCAGGGTTGCTGG - Intronic
1107182450 13:37477074-37477096 CATGGAAGAAGCACAAATGCCGG + Intergenic
1107507627 13:41050517-41050539 ATATCAAGAAGCAGAATTGCTGG + Intronic
1108963497 13:56266902-56266924 AAACCAAGGAGCAGAATTGCTGG - Intergenic
1109101219 13:58185766-58185788 CAGGCAATATGGAGAATTGCAGG + Intergenic
1109279864 13:60343680-60343702 GAAGCAAGAAACAGAAATGCAGG + Intergenic
1110544949 13:76745752-76745774 CCAGCATGAAGCAGAAATGGTGG - Intergenic
1111068066 13:83123512-83123534 CATGCTAGAAGCCGAAATGCTGG + Intergenic
1111381605 13:87460904-87460926 CAAGTAAGTAGGAGAATTTCAGG - Intergenic
1112123831 13:96442639-96442661 CAAGGGAGAAGCAAAACTGCAGG + Intronic
1112692670 13:101915781-101915803 AAAGAAAGAATCCGAATTGCGGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114168519 14:20247043-20247065 TAACCAAGAAGTGGAATTGCTGG - Intergenic
1115101451 14:29705977-29705999 AAACCAAGAAGTAGAATTGCTGG + Intronic
1115219673 14:31046861-31046883 AAAAGAAGAAGTAGAATTGCTGG + Intronic
1117425516 14:55591352-55591374 CTAGCTAGAAATAGAATTGCTGG + Intronic
1117741563 14:58824225-58824247 CAAGCAAGGAGCAGCAGGGCAGG + Intergenic
1118592088 14:67409642-67409664 CGAGAAAGAAGCAGAGTTCCAGG - Intronic
1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG + Intronic
1119808328 14:77497386-77497408 AAAGGAAGAAGAAGAATGGCTGG + Intronic
1119916022 14:78403007-78403029 CAAACAAGAAGCAGAAATCCGGG - Intronic
1121870212 14:97400404-97400426 CAAGAAACAAGCAGAAATACAGG + Intergenic
1122274919 14:100586543-100586565 CAAGCAGGAAGCGGAAACGCTGG + Intronic
1123137923 14:106047153-106047175 CATGCCAGCAGCAGGATTGCTGG + Intergenic
1123171849 14:106380043-106380065 AAAGAAAGAAACAGAATTGAGGG - Intergenic
1123494703 15:20814321-20814343 CAAGGAAGAAGCAGAAGGACAGG - Intergenic
1123551198 15:21383414-21383436 CAAGGAAGAAGCAGAAGGACAGG - Intergenic
1123736167 15:23185717-23185739 GAAGGAAAAAGCAGAATTGAAGG - Intergenic
1124102690 15:26710564-26710586 TACTTAAGAAGCAGAATTGCTGG + Intronic
1124286875 15:28408690-28408712 GAAGGAAAAAGCAGAATTGAAGG - Intergenic
1124295826 15:28502937-28502959 GAAGGAAAAAGCAGAATTGAAGG + Intergenic
1124358890 15:29019837-29019859 AGAGCAAGAAGCAGAAGTGCTGG + Intronic
1124870288 15:33534666-33534688 CAAACAAGATGCTGACTTGCTGG + Intronic
1125555180 15:40578812-40578834 CAAGAAACAAGCAGAAATGCAGG - Intergenic
1128518250 15:68357554-68357576 TAAGAAAGAAGCATAATTGTTGG - Intronic
1129675068 15:77628192-77628214 ACAGCTAGGAGCAGAATTGCTGG - Intronic
1130088751 15:80801523-80801545 AAAGAAAGCAGCAGAAGTGCTGG - Intronic
1130189953 15:81724540-81724562 AAAGCAAGGAGCTGAATTGAGGG + Intergenic
1130538027 15:84800754-84800776 AATCCTAGAAGCAGAATTGCTGG - Intronic
1131964180 15:97821324-97821346 ATACCAAGAAGCATAATTGCTGG + Intergenic
1202959540 15_KI270727v1_random:110657-110679 CAAGGAAGAAGCAGAAGGACAGG - Intergenic
1132539674 16:502894-502916 AAAGCAGGCAGCAGCATTGCAGG - Intronic
1133478014 16:6142074-6142096 GAAGCAAGAAGCAGTATTCCAGG - Intronic
1134027479 16:10965443-10965465 AAAGCAAACAGCAGAATGGCTGG - Intronic
1134753701 16:16647846-16647868 ACAGCAAGAAGCAGAATTCCTGG - Intergenic
1134793821 16:17015719-17015741 CAAGCAACATGCCGAAGTGCTGG + Intergenic
1134992358 16:18711197-18711219 ACAGCAAGAAGCAGAATTCCTGG + Intergenic
1137794551 16:51204501-51204523 CAAGAAAGAAGAAGAGTTTCAGG + Intergenic
1137820474 16:51440084-51440106 CAAGAACGAAGAAGACTTGCGGG - Intergenic
1137825787 16:51493722-51493744 CAAGCTAAAAGAATAATTGCTGG + Intergenic
1140032247 16:71348233-71348255 CAAGGAAGAAGTAGAGGTGCAGG + Intergenic
1140442139 16:74996328-74996350 CTAGGTAGGAGCAGAATTGCTGG + Intronic
1140998713 16:80287499-80287521 GTACCTAGAAGCAGAATTGCTGG - Intergenic
1141002990 16:80325452-80325474 CAACTCAGAGGCAGAATTGCTGG + Intergenic
1141135424 16:81461758-81461780 CAAGCAACAAGAGGCATTGCTGG - Intronic
1142106641 16:88307352-88307374 CCAGCTACAAGCAGCATTGCTGG + Intergenic
1142923320 17:3210314-3210336 TAAGCAGAAAGCAGAATGGCTGG + Intergenic
1143914635 17:10280512-10280534 ATACCCAGAAGCAGAATTGCTGG + Intergenic
1143998776 17:11033056-11033078 AAAGTCAGAAGCAGGATTGCTGG - Intergenic
1145897499 17:28468595-28468617 ATACCAAGAAGCAGTATTGCTGG - Intronic
1146418817 17:32663211-32663233 AAAGAAAGTAGCACAATTGCCGG - Intronic
1147797889 17:43058414-43058436 AAAGAAAGAAAAAGAATTGCTGG + Intronic
1148271150 17:46262845-46262867 AGAGCAAAAAGCAGAATTGATGG + Intergenic
1149272781 17:54999417-54999439 GAAGCAAAAAGCATAATTACCGG + Exonic
1150176988 17:63067662-63067684 CAAACAAGAAGCAAACTTGATGG + Intronic
1150742183 17:67788225-67788247 CTAGCAAGAAATAGAATTGGAGG - Intergenic
1151010991 17:70495765-70495787 ACACCAAGCAGCAGAATTGCTGG + Intergenic
1153004654 18:486948-486970 AAACCTAGGAGCAGAATTGCTGG - Intronic
1153322057 18:3783280-3783302 ATAGCTAGGAGCAGAATTGCTGG - Intronic
1153733948 18:8044983-8045005 CTAGCTAGAAGTAGAATTACTGG - Intronic
1153765744 18:8373248-8373270 CAAAATAGAATCAGAATTGCAGG - Intronic
1155314312 18:24556364-24556386 ATAACCAGAAGCAGAATTGCTGG - Intergenic
1156247525 18:35316270-35316292 ATATCAAGAAGTAGAATTGCTGG - Intergenic
1156904272 18:42335637-42335659 GAAGCATGAAGCAGACTGGCTGG + Intergenic
1157232143 18:45927437-45927459 CATGTGAGAAGTAGAATTGCTGG - Intronic
1157510131 18:48265216-48265238 CAATCAAAGAGCAGAGTTGCAGG - Intronic
1159546070 18:69840363-69840385 CAAGTATGAAGAATAATTGCTGG + Intronic
1159897879 18:74013893-74013915 CAAACAAGTAACAGAATTGCAGG - Intergenic
1160166344 18:76515927-76515949 ATACCTAGAAGCAGAATTGCTGG - Intergenic
1160212039 18:76889044-76889066 CTAGCAAGAGTCAGAAGTGCAGG - Intronic
1160442163 18:78901371-78901393 CAAGCAAGCACCAGGAGTGCCGG + Intergenic
1160628710 18:80230659-80230681 CATGCATGAACCAGAATGGCAGG - Intronic
1164767213 19:30781252-30781274 CAGGCAGGAGGCAGAAATGCAGG + Intergenic
1164814117 19:31181296-31181318 CATGCAGGAAGCAGATTGGCAGG + Intergenic
1165332945 19:35151437-35151459 CAGGCAAGAAGGTGAAGTGCAGG + Exonic
1165548085 19:36559260-36559282 ATAGCCAGAAGCAGAATTGCTGG - Intronic
1166378489 19:42342336-42342358 TAAGCAAAAAGGAGAATTTCTGG + Intronic
1166497909 19:43317692-43317714 GAATCCAGAAGTAGAATTGCTGG - Intergenic
1167471804 19:49679754-49679776 CCACCAAGAAGGAGAATTGCTGG + Intronic
1168586281 19:57596015-57596037 AAACCAAGAAGCAGTATTACTGG - Intergenic
925211601 2:2052916-2052938 CAACCCAGAAGTGGAATTGCTGG - Intronic
925378389 2:3405372-3405394 CCAGCAAAAAGCACAGTTGCTGG + Intronic
925636530 2:5946549-5946571 CAAGCAGGAAGAAGAATTGGAGG - Intergenic
927399763 2:22697328-22697350 GAAGGAAAATGCAGAATTGCTGG - Intergenic
928007345 2:27575180-27575202 CAACCATGACCCAGAATTGCAGG + Intergenic
928136109 2:28688620-28688642 CATCCAAGAAGCAGCATTGTTGG - Intergenic
928793771 2:34991749-34991771 CAAGGAATAAGCAGAAGTGCTGG + Intergenic
928994676 2:37275062-37275084 CAAGTAAGAAGCAGAAATAATGG + Intronic
929973392 2:46606600-46606622 AATCCAAGAAGTAGAATTGCTGG + Intronic
932963138 2:76439355-76439377 AAACCTAGAAGCAGAATTGCTGG - Intergenic
933974440 2:87497101-87497123 CAGGCAGGAAGCAGGAGTGCAGG + Intergenic
934526582 2:95055884-95055906 CCAGCAAGAAGCAGCTTTGGGGG - Intergenic
934764094 2:96870557-96870579 CTAGAAAGAGGCAGAATTGGGGG - Intronic
935949376 2:108314832-108314854 AAAGCAGGAAGTAGAATTTCAGG + Intergenic
936319384 2:111453718-111453740 CAGGCAGGAAGCAGGAGTGCAGG - Intergenic
938191951 2:129291456-129291478 TAGGCAAGAAGCAGAACTGTGGG + Intergenic
938479480 2:131647327-131647349 CAAGGAAGAAGCAGAAGGACAGG + Intergenic
938750638 2:134326241-134326263 CAAGCAAAAAGAAGAAAAGCTGG - Intronic
938811553 2:134858011-134858033 ATAGCCAGAAGTAGAATTGCTGG - Intronic
939695519 2:145318667-145318689 CTACCAAGAAGTGGAATTGCTGG + Intergenic
939798043 2:146672299-146672321 ATACCAAGAAGCACAATTGCTGG - Intergenic
941070412 2:160948441-160948463 CATGCATGAAGCAGACTTGGTGG + Intergenic
941415170 2:165211688-165211710 CAAGCACCAAGAAGAGTTGCTGG - Intergenic
942848561 2:180455333-180455355 CAGGCAAGAAACAGACTTCCTGG - Intergenic
943625564 2:190195334-190195356 ATACCAAGAAGCAGAACTGCTGG + Intronic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
943874755 2:193051150-193051172 TTAGCTAGTAGCAGAATTGCTGG - Intergenic
944430559 2:199629075-199629097 GAAGCAGGAAGCAGCAGTGCAGG + Intergenic
945240248 2:207670013-207670035 GTAGCTAGAAGTAGAATTGCTGG + Intergenic
945435021 2:209809126-209809148 CAAGGAAGAAGCTGAAGTGGAGG - Intronic
945622755 2:212162070-212162092 ATACCAAGAAGTAGAATTGCTGG - Intronic
946639431 2:221767537-221767559 CAAGAAAGAAGCAGATGTTCAGG - Intergenic
947250109 2:228093263-228093285 AAACCAAGAAGTAGAATTGCTGG - Intronic
948124101 2:235552219-235552241 CCAGCAATAAGCAGAACTGCAGG - Intronic
1169628879 20:7602495-7602517 CAAGCATGAAGGAGAATTAAAGG + Intergenic
1170392809 20:15893827-15893849 CAAGATGGAAGCAGAAGTGCAGG + Intronic
1170484332 20:16800965-16800987 CAAGCAAAAACTAGAATTGTAGG + Intergenic
1172804141 20:37599004-37599026 CAAGCAAGTTGCAGAATGACAGG - Intergenic
1173005769 20:39138624-39138646 TCAGCAGGAAGCAGAATTGGGGG - Intergenic
1173103329 20:40107841-40107863 CAGCCAAGAAGCAGCATTGTAGG - Intergenic
1173167601 20:40696770-40696792 AAAGCAAGAAATAAAATTGCTGG + Intergenic
1174009013 20:47434096-47434118 AATCCTAGAAGCAGAATTGCTGG - Intergenic
1174286295 20:49476091-49476113 CAATCAGGATTCAGAATTGCTGG + Intronic
1177017428 21:15809630-15809652 ACACCAAGAAGCAGAATTGCTGG - Intronic
1179636710 21:42716244-42716266 ATACCAAGAAGCACAATTGCTGG + Intronic
1180111775 21:45660487-45660509 AAAACAAGAAGCAAAATGGCTGG - Intronic
1180245241 21:46542865-46542887 CCTGCAAGAGGCAGAGTTGCAGG - Intronic
1180841048 22:18959059-18959081 CATGCAACCAGCAGAATTGACGG + Intergenic
949805078 3:7946054-7946076 CAAGCAAGAAACAGAGTTGATGG + Intergenic
950197493 3:11019128-11019150 CTACTCAGAAGCAGAATTGCTGG - Intronic
950270634 3:11611836-11611858 CAGGCAAGCAGAAGAATTCCTGG - Intronic
951377640 3:21940531-21940553 TCAGCAAGAAGCAGAGTTTCTGG - Intronic
952361038 3:32630229-32630251 AAAGCAAAAGGCAGAAATGCAGG - Intergenic
952434024 3:33254476-33254498 ATACCAAGAAGCACAATTGCTGG - Intergenic
952551616 3:34485086-34485108 CAAGGAAGAAGCAGAGATGTGGG + Intergenic
952820182 3:37479756-37479778 CAAGGAAGACTCAGAATTCCTGG + Intronic
953769262 3:45766122-45766144 GCAGCAGGAAGCAGAATTGTAGG + Intronic
954960991 3:54564837-54564859 CCAGCAAGAAGCACACTTACTGG + Intronic
955040285 3:55310154-55310176 CAAGAAAGCAGCAGATTTGAAGG + Intergenic
955045481 3:55355511-55355533 ATAGCCAGAAGCGGAATTGCTGG + Intergenic
956023121 3:64953287-64953309 ACAGCAAGAACTAGAATTGCTGG - Intergenic
957118842 3:76062545-76062567 CAAGTAAGAAGAAGAATGCCAGG - Intronic
957378106 3:79386769-79386791 GAAGCCAGAAGCAGGATTGTGGG + Intronic
957656115 3:83078207-83078229 AAACCTAAAAGCAGAATTGCTGG - Intergenic
957845333 3:85725773-85725795 CAACCAAGTACCAAAATTGCTGG + Intronic
957849179 3:85783369-85783391 CAAATAAGAAGCAGAAGTGTTGG - Intronic
958148551 3:89658696-89658718 CCAGTAAGTAGCAGGATTGCTGG + Intergenic
958933537 3:100233047-100233069 CAACCAAGGAGCACAATTGCTGG - Intergenic
960601130 3:119459356-119459378 CCAGCAAGCAGCAGAATTTAGGG + Intronic
960761208 3:121075403-121075425 CAAGGAAAAGGCAGACTTGCTGG - Intronic
962272885 3:133991132-133991154 CAAGCAAAAAACAAAACTGCAGG + Intronic
963548715 3:146694663-146694685 CAAGAAAGAAGCACAATGGTGGG - Intergenic
963568862 3:146966387-146966409 CAAGCAAAGGGGAGAATTGCTGG - Intergenic
963801568 3:149681051-149681073 AATACAAGAAGTAGAATTGCTGG + Intronic
965013629 3:163128268-163128290 CCAGCAAGACACAGAAATGCTGG + Intergenic
965138732 3:164808030-164808052 CCATCAAGAACCAGGATTGCTGG - Intergenic
965346337 3:167555552-167555574 AAAGGAAGAAGCAGACTTGTGGG + Intronic
965354788 3:167660346-167660368 CCAGCAAGAAGTAGAAAAGCTGG + Intergenic
966641945 3:182201776-182201798 CAAACAAAAAGCAGAAAGGCTGG + Intergenic
967674776 3:192283909-192283931 CAGGAAAGAAGGAGAATTTCAGG - Intronic
967911207 3:194544077-194544099 ATACCAAGAAGCACAATTGCTGG + Intergenic
968149336 3:196324683-196324705 GGACCAAGAAGCAGAATCGCAGG + Intronic
970294518 4:14614283-14614305 AAAGCAAAAAACAGAGTTGCAGG + Intergenic
970504726 4:16716227-16716249 GAAGCAAGAAGCATTGTTGCAGG - Intronic
970582869 4:17489478-17489500 CAAGCATGAAGCATGATTCCTGG + Intronic
971127534 4:23770901-23770923 CAAGGAAGAAGCAGAAGTAGTGG - Intronic
971488681 4:27188639-27188661 GAAACAAGAAGCAGAAATACAGG - Intergenic
973730713 4:53819782-53819804 AAAGAAATAAGCAGAATTCCAGG + Intronic
974060368 4:57027954-57027976 CAAGCAAAAATCAGAATTTTAGG - Intronic
974307195 4:60156849-60156871 CAAGCTAGGATCATAATTGCTGG - Intergenic
975126806 4:70792060-70792082 TAAGTAGGAAGCGGAATTGCAGG - Intronic
977771982 4:100870694-100870716 GAAGGAAGAAGCAAAATTGCAGG - Intronic
979217072 4:118178693-118178715 ATACCCAGAAGCAGAATTGCTGG + Intronic
981133185 4:141181520-141181542 CAAACAAAAAGCAGAGCTGCAGG - Intronic
981621830 4:146709349-146709371 CAATGAAGTAGAAGAATTGCTGG - Intronic
983353944 4:166631435-166631457 CAAGTAATAGGCAGAATTCCAGG + Intergenic
984302301 4:177937220-177937242 TCAGCAAGAATCAGACTTGCTGG - Intronic
984613089 4:181863669-181863691 CAGGCAAGAATCATTATTGCAGG + Intergenic
989686244 5:44090462-44090484 CAAGGAAGAAGAAGAATAGTGGG - Intergenic
989781657 5:45272955-45272977 CAAGAAAAAAGCAGAAAGGCTGG - Intronic
990010738 5:50994535-50994557 ATATCAAGAAGCAGAATTGAAGG + Intergenic
990085817 5:51975261-51975283 CAAGCAAGAAGGGGAAGAGCTGG + Intergenic
990145731 5:52758192-52758214 CAAGCAAACAGGAGAATTGGTGG - Intergenic
990902479 5:60767523-60767545 ATACCCAGAAGCAGAATTGCTGG + Intronic
991393939 5:66183867-66183889 CTAGCAAGAAGCTGAATTTGTGG - Intergenic
991438946 5:66625769-66625791 CTAACCAGAAGTAGAATTGCTGG - Intronic
991460917 5:66857417-66857439 ATGCCAAGAAGCAGAATTGCTGG + Intronic
991730475 5:69582310-69582332 CAAGCAAACAGCAGAATTCTAGG - Intronic
991864476 5:71045541-71045563 CAAGCAAACAGCAGAATTCTAGG + Intronic
992210621 5:74476215-74476237 GCAGCAAGAATCAGAATTGAAGG - Intergenic
992788920 5:80196509-80196531 ATATCTAGAAGCAGAATTGCTGG - Intronic
992993961 5:82314489-82314511 ATAGCCAGAAGCAGAGTTGCTGG - Intronic
993142077 5:84046921-84046943 AAAGCAAGAAACAGAAGTGTAGG - Intronic
993272224 5:85810946-85810968 CAAGATAGAAGCTGGATTGCTGG - Intergenic
993826996 5:92701981-92702003 CTAGCAAGAAGCTGAATTTATGG + Intergenic
994739866 5:103604505-103604527 CAGGCATGAAGCTGAATTCCAGG + Intergenic
995635920 5:114190219-114190241 CTACCTAGAAGCAGAATGGCTGG - Intergenic
997721958 5:136085486-136085508 AAAGGAAGAAGTAGAATTGTTGG + Intergenic
998076642 5:139241921-139241943 CAATCAAGAGGCAGAATCTCAGG - Intronic
998687055 5:144539966-144539988 TAAGCAAAAAGCAGAGTTACAGG - Intergenic
998761279 5:145434720-145434742 CAAGGAAGATGCAGAAGTGGGGG + Intergenic
1000422916 5:161058368-161058390 CAAGAAAGAAGCACAATGTCTGG - Intergenic
1000733508 5:164868011-164868033 TAAGCATGAAGCAGCATTGCAGG - Intergenic
1001158918 5:169297317-169297339 TAAGCCAGAATCAGAATTGGGGG - Intronic
1004192903 6:13479909-13479931 CAAGCAAGAACTGGAAATGCAGG + Intronic
1004280563 6:14276250-14276272 CAGGCAAAAAGCAGAATGCCAGG + Intergenic
1004655956 6:17661016-17661038 CAAGCAAGAAGAAGACAGGCAGG + Intronic
1005227936 6:23664820-23664842 ATACCAAGAAGCACAATTGCTGG + Intergenic
1006244412 6:32717714-32717736 GAAGCAGGGAGCAGAAGTGCTGG - Intergenic
1007343718 6:41210282-41210304 CAAGGGAAAAGCAGATTTGCTGG - Intergenic
1007346570 6:41235922-41235944 CAAGAGAAAAGCAGATTTGCTGG + Intronic
1009344712 6:62599144-62599166 ATACCCAGAAGCAGAATTGCTGG + Intergenic
1009466924 6:63982498-63982520 CCAACAAGAAGCAGAGTTGAGGG - Intronic
1010176279 6:73031845-73031867 GAAGGAAGAAGCAGATTTTCTGG + Intronic
1010674909 6:78731587-78731609 CCAGAAAGAAACTGAATTGCTGG + Intergenic
1011259228 6:85454208-85454230 CTACCCAGGAGCAGAATTGCTGG + Intronic
1012283134 6:97353899-97353921 GAAGCAAGAAGCAAAATTGGAGG - Intergenic
1014949759 6:127541162-127541184 CAAGCAGGATGCAGGATTCCTGG + Intronic
1015001371 6:128220629-128220651 AAACCTAGAAGTAGAATTGCCGG - Intronic
1017562032 6:155638403-155638425 CAAGCATGAAGCAGCAATGTTGG - Intergenic
1017644721 6:156528114-156528136 CCAGCAAGATGCTGAATTACAGG + Intergenic
1017727536 6:157285916-157285938 CAATCAGGGAGCAGCATTGCTGG - Intergenic
1018024351 6:159792029-159792051 AAAGCAAGTAGCATAATTCCTGG - Intronic
1020386352 7:7607373-7607395 CACTCTAGAAGCAGAATTTCTGG + Exonic
1021118195 7:16767560-16767582 TAACCTAGAAACAGAATTGCTGG + Intronic
1021851013 7:24808659-24808681 CAAGCAAGAAAGAGAAATGATGG - Intronic
1022896503 7:34755135-34755157 GTAACTAGAAGCAGAATTGCTGG + Intronic
1023104585 7:36750908-36750930 CAAGCTAGAAGCCCACTTGCCGG + Intergenic
1023227329 7:37984356-37984378 CAACCAAGAAACACAATTGGTGG - Intronic
1024632627 7:51262222-51262244 CAAGGCAGAAGAAGAAGTGCAGG + Intronic
1027839760 7:83294004-83294026 GAAGCAAGAACCAGATTTTCTGG + Intergenic
1028289668 7:89048988-89049010 CAAGGAAGAAACACAATTTCAGG + Intronic
1028730364 7:94140800-94140822 CAATCCAGAAGTGGAATTGCTGG + Intergenic
1029663477 7:101979091-101979113 TGAGCAAGAAGCAGAAATCCTGG + Intronic
1030887403 7:114955176-114955198 CAAGCAATCAGCATAATTCCAGG + Intronic
1030990512 7:116293342-116293364 CAGGCAAGCAGGAGAGTTGCAGG + Intronic
1031956826 7:127951047-127951069 ATACCCAGAAGCAGAATTGCTGG - Intronic
1032540879 7:132702072-132702094 CAGGCAGGAAGAAGAATTGGTGG + Intronic
1032869827 7:135972950-135972972 CAAGGAAGAAACAGGATGGCAGG + Intronic
1033116293 7:138628557-138628579 AAACCTAGGAGCAGAATTGCCGG + Intronic
1033704920 7:143877106-143877128 CAAGGAAGACCAAGAATTGCTGG + Intronic
1035152737 7:156888454-156888476 CAATTCAGAAGTAGAATTGCTGG - Intronic
1036535248 8:9643751-9643773 ATACCCAGAAGCAGAATTGCCGG - Intronic
1037508786 8:19560785-19560807 CAACCCAGAAGTGGAATTGCTGG - Intronic
1039915985 8:41860674-41860696 CCAACAAGAAGCAGTGTTGCTGG + Intronic
1040673540 8:49721410-49721432 CAAGCCTGAAGCAGAATGGTAGG + Intergenic
1040890302 8:52310202-52310224 CAACCAAGATTCATAATTGCCGG - Intronic
1041007556 8:53509994-53510016 CAGGCATGAAGCAGCATTTCTGG - Intergenic
1041902764 8:63000090-63000112 ATATCAAGAAGCAGAATTGCTGG - Intergenic
1043179611 8:77070717-77070739 ATAGCCAGAAGTAGAATTGCTGG + Intergenic
1043290162 8:78589036-78589058 GAAGCAAGAGGCAGAATTGAAGG + Intronic
1044020257 8:87096949-87096971 CAAGCAAGAAGCAGCAGCTCAGG + Intronic
1044886723 8:96786538-96786560 ATACCAAGAAGTAGAATTGCTGG + Intronic
1045174385 8:99706063-99706085 CAAAAAACAAGCAGAATTCCTGG + Intronic
1048351003 8:133616437-133616459 ATAGCTAGGAGCAGAATTGCTGG + Intergenic
1049829457 8:144691058-144691080 CAAGAAAGAAGCCGAGTGGCAGG - Intergenic
1052695945 9:31878340-31878362 AAAACAAGAAGCATAATGGCAGG - Intergenic
1052715685 9:32114198-32114220 GTAGCCAGAAGCAGAATTTCTGG - Intergenic
1052751354 9:32495034-32495056 TACACCAGAAGCAGAATTGCTGG + Intronic
1053119295 9:35533970-35533992 ATACCTAGAAGCAGAATTGCTGG + Intronic
1053729728 9:41041277-41041299 CAAGGAAGAAGCAGCATTTCTGG + Intergenic
1054698777 9:68390785-68390807 CAAGGAAGAAGCAGCATTTCTGG - Intronic
1054729668 9:68688421-68688443 CTATCTAGAAGTAGAATTGCAGG - Intergenic
1055086838 9:72323148-72323170 GAAGCTAAAAGCAGAATTGGGGG - Intergenic
1055211582 9:73801343-73801365 ATACCCAGAAGCAGAATTGCTGG - Intergenic
1056230405 9:84537744-84537766 AAAGGAAGAAGCAGAAATTCTGG - Intergenic
1056247687 9:84712989-84713011 ACAGAAAGAAGCAGAATTGTTGG + Intronic
1056486182 9:87060282-87060304 CAAGCAAGAAACAAAAAAGCAGG + Intergenic
1056825763 9:89875303-89875325 CTAAGAAGAAGCAGCATTGCAGG - Intergenic
1056875667 9:90327767-90327789 ACATCAAGGAGCAGAATTGCTGG + Intergenic
1057582963 9:96303752-96303774 CACCCTAGAAGCAGAATTGCTGG + Intergenic
1057895029 9:98902416-98902438 AAACCAAGAAACGGAATTGCTGG + Intergenic
1058337749 9:103853928-103853950 CAAGCATAAAGCAGATTTGATGG - Intergenic
1059310075 9:113382235-113382257 TAAGCATGAAGCAGAAGTGGGGG + Intergenic
1060621657 9:125073046-125073068 AAACCTAGAAGTAGAATTGCTGG + Intronic
1185789970 X:2921768-2921790 CAAGGAAGACGATGAATTGCAGG + Intronic
1187119477 X:16390340-16390362 CTAAAAAGGAGCAGAATTGCTGG - Intergenic
1188305377 X:28555546-28555568 GAAGCAAGAAGGAGTATTTCTGG - Intergenic
1190356218 X:49607962-49607984 CCAGTAAGAAGCAGATTTGGGGG + Exonic
1191149398 X:57204656-57204678 AAAGAAAGAAGCAGAACTACTGG - Intergenic
1192659921 X:73031305-73031327 ATAGCCAGAAGCAGACTTGCTGG + Intergenic
1193147334 X:78091403-78091425 AAAGAATCAAGCAGAATTGCTGG - Intronic
1195501091 X:105600763-105600785 CTACTAAGAAGTAGAATTGCTGG + Intronic
1196290235 X:113931825-113931847 AAACCCAGAAGGAGAATTGCTGG + Intergenic
1196613923 X:117745051-117745073 AAAGCATCAAGCAGAAATGCTGG + Intergenic
1197062802 X:122201531-122201553 ATACCAAGAAGCAGGATTGCTGG - Intergenic
1197071349 X:122301665-122301687 ATACCAAGAAGCATAATTGCTGG + Intergenic
1198140401 X:133797044-133797066 CAAGACAGAGGCAGAACTGCTGG - Intronic
1198397291 X:136232939-136232961 AAACCTAGAAGTAGAATTGCTGG - Intronic
1199713789 X:150491612-150491634 GAAGCCAGAAGCTGAATGGCTGG + Intronic
1200175955 X:154116481-154116503 GAGGCAGGAAGCAGAATGGCCGG - Intergenic
1201226153 Y:11820833-11820855 AAAGCAAGAGGCAGAATGGAAGG + Intergenic