ID: 917496886

View in Genome Browser
Species Human (GRCh38)
Location 1:175548597-175548619
Sequence CAGCAGAAAGAGGGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 1, 2: 3, 3: 49, 4: 451}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917496886_917496891 -8 Left 917496886 1:175548597-175548619 CCTCAGGGCCCCTCTTTCTGCTG 0: 1
1: 1
2: 3
3: 49
4: 451
Right 917496891 1:175548612-175548634 TTCTGCTGGTTACCTGCTACTGG 0: 1
1: 0
2: 1
3: 8
4: 108
917496886_917496893 4 Left 917496886 1:175548597-175548619 CCTCAGGGCCCCTCTTTCTGCTG 0: 1
1: 1
2: 3
3: 49
4: 451
Right 917496893 1:175548624-175548646 CCTGCTACTGGCTCTCCTCCTGG 0: 1
1: 0
2: 2
3: 24
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917496886 Original CRISPR CAGCAGAAAGAGGGGCCCTG AGG (reversed) Intronic
900251379 1:1671969-1671991 CTGCAGAGAAAGAGGCCCTGTGG + Intronic
900394346 1:2447016-2447038 AGGCAGGAAGAGGAGCCCTGAGG - Intronic
900802401 1:4745487-4745509 CCACAGAAGGAGGGGGCCTGGGG + Intronic
901199902 1:7460866-7460888 CGGCAGAGAGATGGGCCCAGTGG + Intronic
901815064 1:11789150-11789172 GGGCAGAGGGAGGGGCCCTGGGG + Exonic
901850431 1:12011556-12011578 CAGCAGATAGTGGGCACCTGAGG + Exonic
902049375 1:13549711-13549733 CAGAGGAAGGAGGGGCGCTGGGG + Intergenic
902056045 1:13601263-13601285 CTGCAGACAGAGGGCCCATGTGG + Intronic
902272205 1:15312764-15312786 CAGCAGAGAGAGGGACCAGGAGG - Intronic
902423353 1:16299343-16299365 CAGCCAACAGCGGGGCCCTGAGG + Intronic
903679315 1:25086774-25086796 CAGAAGAGAGAGGTGGCCTGGGG - Intergenic
904813877 1:33181444-33181466 CAGCAGAGAGGGGGGCCCGAGGG + Exonic
904991753 1:34598809-34598831 CATTAGAAAGAGTGGCTCTGTGG - Intergenic
905322967 1:37130764-37130786 AAGCAGAAAGATGGGAACTGTGG - Intergenic
906295749 1:44648078-44648100 CAGCAGAAACAGAGGCCAAGAGG - Intronic
906323700 1:44831634-44831656 CAGCAGAAAGGAGGGGTCTGGGG - Intronic
907400539 1:54222338-54222360 CAGCAGGAACAAAGGCCCTGGGG + Intronic
909489435 1:76209816-76209838 CAGCAGGAAGGGTGGCCCGGGGG - Intronic
913281023 1:117185255-117185277 CAGCAGAAACCAGGGCCCTATGG + Intronic
913412085 1:118563410-118563432 TAGCAGAAAAAGGGGCAGTGAGG + Intergenic
914382542 1:147130603-147130625 CAGCAGAGACAGGAGCCCTTTGG - Intergenic
914506514 1:148294615-148294637 CAGCATAAAGTGGGCCCATGGGG + Intergenic
915283110 1:154836265-154836287 CAACAGCAAGAGGGACCCAGGGG - Intronic
916691052 1:167190445-167190467 CAGCAGTGAGAGGTGCTCTGGGG - Intergenic
917154181 1:171978403-171978425 CAGCTTATAGAGAGGCCCTGAGG + Intronic
917496886 1:175548597-175548619 CAGCAGAAAGAGGGGCCCTGAGG - Intronic
917544523 1:175949462-175949484 CAGCAGAAAGAGGCACTGTGTGG + Intronic
917704300 1:177616111-177616133 CAGCAGTAAGAGGGGCACTGTGG - Intergenic
917790033 1:178493554-178493576 CAGGACAGAGAGGGGCCCGGTGG + Intergenic
917966362 1:180181465-180181487 CAGTAGTCAGAGGGGCCCTTTGG - Intronic
919207580 1:194437299-194437321 CAGCAGACAGAGGGGTCCTAGGG - Intergenic
919739862 1:200974970-200974992 TACTAGCAAGAGGGGCCCTGGGG - Intronic
919824587 1:201494315-201494337 GAGCAAAGAGAGGGGCCCTTAGG + Intronic
921936539 1:220801534-220801556 CAGGAGAAAGGGGGGCACTGAGG + Intronic
922893915 1:229085627-229085649 AAGCAGAATCATGGGCCCTGAGG - Intergenic
923533188 1:234827838-234827860 CAGAAGCAAGAGGCGCCATGGGG + Intergenic
1063409711 10:5827997-5828019 CAGAAAAAACAGGGGGCCTGAGG + Intronic
1063903538 10:10760276-10760298 CAGGATAAAGAGGGGGACTGGGG - Intergenic
1064033057 10:11894965-11894987 CAGCAGAAAGCGGGGCGAGGGGG + Intergenic
1064127469 10:12675884-12675906 TATCAGAAACAAGGGCCCTGTGG - Intronic
1067364288 10:45610734-45610756 CAGCAGAGTGAGGGGCAGTGGGG - Intergenic
1067408250 10:46043124-46043146 ATGCAGAAAGAGGGCTCCTGGGG + Intronic
1067427681 10:46222010-46222032 CTGGAGAAAGAGGAGCCCTTCGG - Intergenic
1067697130 10:48543394-48543416 CCCCAGAAGCAGGGGCCCTGAGG - Intronic
1068778707 10:60896391-60896413 CAGCTGAAACAGGACCCCTGAGG - Intronic
1068928386 10:62563566-62563588 AAGCAGAAAGAGTAGGCCTGTGG + Intronic
1069891189 10:71653361-71653383 GAGCAGAGGGAGAGGCCCTGTGG - Intronic
1069957448 10:72060702-72060724 CAGGAGAAAGAGGGGACTGGGGG + Exonic
1070669112 10:78365686-78365708 CAGCACAAAGAGCAGTCCTGGGG - Intergenic
1071500825 10:86203265-86203287 CAGTGGGAGGAGGGGCCCTGAGG + Intronic
1071564574 10:86665161-86665183 GAGCAGCCAGAGGGACCCTGGGG + Intronic
1072036360 10:91566402-91566424 CAGCATAGAGCTGGGCCCTGTGG + Intergenic
1072663883 10:97380341-97380363 CAGGAGAGAGTGGGGGCCTGAGG - Intronic
1073327504 10:102651133-102651155 CAGCAGAGACAGGAGCCCAGTGG + Intronic
1073345530 10:102780086-102780108 TATTAGAAAGAAGGGCCCTGAGG - Intronic
1073700790 10:105924971-105924993 AAGCAGCAAGAAGAGCCCTGTGG + Intergenic
1074899587 10:117804618-117804640 CAGCAGAAAGCTGGCCCCTGGGG + Intergenic
1076461008 10:130647442-130647464 CAGGAGCAGGAGTGGCCCTGTGG - Intergenic
1076869521 10:133186491-133186513 CAGCACGGACAGGGGCCCTGGGG + Exonic
1077063353 11:627117-627139 CAGCAGCAGGAGGGGCCGGGGGG + Exonic
1077241203 11:1511242-1511264 CAGAAGACAGCGGGGCCATGGGG + Intergenic
1077273274 11:1691789-1691811 CAGCAGTGAGATGGGCCATGGGG - Intergenic
1077443936 11:2581497-2581519 TGGCAGAGAGGGGGGCCCTGGGG - Intronic
1077892296 11:6427992-6428014 GGGAAGAAAGAGGGGCCCTGGGG + Intergenic
1078068456 11:8093271-8093293 CAGCAGGAGCAAGGGCCCTGTGG + Intronic
1079082090 11:17420728-17420750 CAGCAGGAACCAGGGCCCTGAGG - Intronic
1080745553 11:35105491-35105513 CAGCAGCCAGAGAGGACCTGAGG - Intergenic
1081714281 11:45237558-45237580 AAGCAGAACAAGGTGCCCTGAGG - Intergenic
1083785803 11:64946101-64946123 CAGCAAAAAGAAGCCCCCTGTGG - Intronic
1084147284 11:67271853-67271875 CAGCAGAAGGAAGTCCCCTGGGG - Intronic
1084174760 11:67417461-67417483 CTGGAGGAAGAGGGCCCCTGGGG + Exonic
1084272369 11:68036180-68036202 GAGCAGTGACAGGGGCCCTGGGG + Intronic
1084654856 11:70509218-70509240 CAGCAGACAGAGATGCACTGTGG - Intronic
1084671400 11:70608660-70608682 AAGCAGGGAGAGAGGCCCTGAGG - Intronic
1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG + Intronic
1085053085 11:73389674-73389696 CAGCAGAAAGATGGGCCCCAGGG - Intronic
1085113263 11:73907555-73907577 AGGCACAAAGAGGTGCCCTGAGG - Intronic
1085282986 11:75342795-75342817 CAGCAGGAACAAAGGCCCTGAGG + Intronic
1085691413 11:78667341-78667363 CAGCAGAAACAGGGTCCAGGTGG + Intronic
1085753014 11:79178406-79178428 GAACAGAAAGAAGAGCCCTGGGG + Intronic
1085893803 11:80612578-80612600 CAGCAGAAGGATGTGCCTTGTGG - Intergenic
1086962164 11:92989536-92989558 CAGCTGAGAGAGGACCCCTGAGG + Intergenic
1086968390 11:93053948-93053970 CATCAGAAACATGGGCTCTGGGG + Intergenic
1088470856 11:110186667-110186689 CTGCGGAAAGATGGGCCATGAGG - Intronic
1089342696 11:117770132-117770154 CAGCAGAAAGAGTGGTCCTGCGG + Intronic
1089772485 11:120813702-120813724 CAGAAGAAAGAGCGTCCATGTGG + Intronic
1089780414 11:120869736-120869758 CTGGAGGAAGAGGGGGCCTGGGG + Intronic
1090185719 11:124738067-124738089 CAGCAGGAAGAAGGGCCCAGAGG + Intergenic
1092160327 12:6312159-6312181 CAGGAGAAAGAGGTCCCCTAGGG - Exonic
1093538231 12:20248229-20248251 GAGCTGACAGAGGAGCCCTGGGG + Intergenic
1094454372 12:30616051-30616073 CAGCACAAAGCAGAGCCCTGGGG + Intergenic
1096519213 12:52174688-52174710 CAGCAGCAACAGGGGCTCCGGGG - Intronic
1096778680 12:53979376-53979398 CAGGGGAGAGAGGGGCTCTGAGG + Intergenic
1097115980 12:56697628-56697650 CAGCATAAAAAGGAGGCCTGAGG - Intergenic
1097263079 12:57730634-57730656 CAGAAGAAAGAGGCTCACTGAGG - Intronic
1097625688 12:61997465-61997487 CAGTGGAAAGAGAGGCCCAGTGG + Intronic
1098307044 12:69112803-69112825 CAGCAGAGAGTGGGGCACTGAGG + Intergenic
1098538022 12:71617828-71617850 GAGCAGAAAGAAGGGCCCTTTGG + Intronic
1099467879 12:83009345-83009367 CAGGAGAAAGAGAAACCCTGAGG - Intronic
1099576526 12:84390598-84390620 GAGGTGAAGGAGGGGCCCTGCGG + Intergenic
1100150998 12:91737614-91737636 CAGCACTAAAAGGGGCCCTGGGG - Intergenic
1102057336 12:109906516-109906538 CACCAGACAGATGGGCACTGTGG - Intronic
1102498172 12:113333676-113333698 CAGCAGGGAGAGGGGCTCAGAGG + Intronic
1102964638 12:117116375-117116397 CTGCAGAAAGAGGGAAACTGAGG + Intergenic
1103450129 12:121022855-121022877 CAGCAGAACCAGGGGCTCTGGGG - Intronic
1104050295 12:125190072-125190094 CTGCTGAAGGAGGGGCTCTGAGG - Intronic
1104232970 12:126903211-126903233 CTGCAGACAGAGGAGCCCTGAGG + Intergenic
1104625918 12:130354590-130354612 CAAGAGAAGGCGGGGCCCTGGGG + Exonic
1105255188 13:18739619-18739641 CAGCTGAAAGAGGAGGCCAGAGG - Intergenic
1105838750 13:24234711-24234733 GAATAGAGAGAGGGGCCCTGTGG + Intronic
1105980783 13:25514335-25514357 CAGAAGAAAGGGGAGACCTGAGG - Intronic
1106414902 13:29538364-29538386 GAGCAGGAAAAGGGCCCCTGAGG + Intronic
1106633245 13:31499210-31499232 CAGTAGAAAGTGGGTCCCTGAGG + Intergenic
1106700337 13:32222186-32222208 CAGCAGATACAAGGGCCCTGAGG + Intronic
1107392491 13:39981803-39981825 GTGGAGAAAGAGAGGCCCTGAGG - Intergenic
1108340957 13:49497427-49497449 CGGAGGAAAGAGAGGCCCTGAGG - Intronic
1109803825 13:67410776-67410798 CAGCAGAACAAGGGACCATGAGG - Intergenic
1110639753 13:77809094-77809116 CAACAGAAAGAAGGCCACTGAGG - Intergenic
1113936357 13:113997061-113997083 AAGACAAAAGAGGGGCCCTGTGG + Intronic
1113961868 13:114130764-114130786 CAGCAGGCAGAGGCGGCCTGGGG - Intronic
1114211560 14:20620054-20620076 CAGCACATAGAGGGGTCCTCAGG + Intergenic
1116751407 14:48890056-48890078 AAGCAGAATGAGGGGCTCAGTGG - Intergenic
1117061764 14:51971104-51971126 CAACAGAAAGACGGGGCCTGGGG + Intronic
1117909584 14:60624299-60624321 GTGGAGAAAGAGGGGCCCTGGGG - Intergenic
1118614728 14:67567593-67567615 CAGGAGACAGAGGGGCGGTGAGG - Intronic
1118963268 14:70555752-70555774 CAGCAGAAAAAGTTGCACTGAGG - Intergenic
1119195507 14:72714355-72714377 CACAGGGAAGAGGGGCCCTGGGG + Intronic
1119263917 14:73253336-73253358 CAGAGGAAAGAGCAGCCCTGTGG - Intronic
1119642798 14:76327595-76327617 GAGGAGAAAGATGGGCCCTGGGG + Intronic
1119644397 14:76338008-76338030 AATCAGAAAGAGGGGCCCCGAGG - Intronic
1119787684 14:77325328-77325350 AAGCAGAAACAAGGGCCCTGTGG + Intronic
1119790565 14:77346151-77346173 CAGTACAATGATGGGCCCTGTGG + Intronic
1120706795 14:87753903-87753925 CATCATCAAGAGGAGCCCTGAGG + Intergenic
1120827509 14:88969049-88969071 CAGCAGGAACAAGGGTCCTGAGG - Intergenic
1121584304 14:95052332-95052354 CAGCTGAAAGGCGGGGCCTGGGG - Intergenic
1122268145 14:100556338-100556360 CTGCAGAAAGAGGGGGGCAGCGG - Intronic
1123035778 14:105471359-105471381 CACCAGAAGGAGGGGTCCGGTGG + Intergenic
1123063613 14:105605533-105605555 CAGGAGAATGAGGCGCACTGAGG + Intergenic
1125550063 15:40538440-40538462 CAGCAGAAAGAGGTGCCCACAGG - Intronic
1126686352 15:51251938-51251960 CAGAGATAAGAGGGGCCCTGTGG - Intronic
1127827539 15:62718270-62718292 CACCATTAAGAGGAGCCCTGGGG - Intronic
1128809206 15:70557799-70557821 CACCAGAAAGAGGAGCACTCAGG - Intergenic
1129113577 15:73352518-73352540 CAGAAGAAACAGGGGGCCTGGGG + Intronic
1129151921 15:73694580-73694602 CAGCAGACAGAAGAACCCTGAGG - Intronic
1129320809 15:74773650-74773672 AAGCAGGAAAAGAGGCCCTGGGG - Intergenic
1129880545 15:79003707-79003729 GAGCAGGAAGAGCAGCCCTGAGG + Intronic
1130174167 15:81550233-81550255 CAGCAGCAGGAGGGGGCCTGTGG + Intergenic
1130298670 15:82664434-82664456 CAGCAGTGAGAGCGGCTCTGGGG - Exonic
1130903954 15:88227050-88227072 CAGCATAAAGTGAGGCTCTGTGG + Intronic
1131183696 15:90257614-90257636 CTGTGGAAAGAGTGGCCCTGTGG - Intronic
1132526253 16:416760-416782 CAGCCTGCAGAGGGGCCCTGAGG - Intergenic
1132552119 16:557834-557856 AGGCAGAAGGAGGGGCCATGGGG + Intergenic
1132576293 16:665902-665924 CAGCACTCACAGGGGCCCTGAGG - Intronic
1132628250 16:902637-902659 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628267 16:902729-902751 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628274 16:902775-902797 CAGCAGAGACAGGAGTCCTGTGG - Intronic
1132628290 16:902868-902890 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628330 16:903101-903123 CAGCAGAGACAGGAGTCCTGTGG - Intronic
1132628346 16:903194-903216 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628353 16:903240-903262 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628360 16:903286-903308 CAGCAGAGACAGGAGTCCTGTGG - Intronic
1132628376 16:903379-903401 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628383 16:903425-903447 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628417 16:903612-903634 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628424 16:903658-903680 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628431 16:903704-903726 CAGCAGAGATAGGCGTCCTGTGG - Intronic
1132628456 16:903844-903866 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628464 16:903889-903911 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628471 16:903935-903957 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628478 16:903981-904003 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628510 16:904168-904190 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628517 16:904214-904236 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628538 16:904353-904375 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628546 16:904398-904420 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628563 16:904491-904513 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628570 16:904537-904559 CAGCAGAGATAGGCGTCCTGTGG - Intronic
1132628595 16:904677-904699 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628603 16:904722-904744 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628611 16:904768-904790 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628636 16:904908-904930 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628644 16:904953-904975 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628652 16:904999-905021 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628674 16:905139-905161 CAGCAGAGACAGGCGTCCTGTGG - Intronic
1132628682 16:905185-905207 CAGCAGAGACAGGTGTCCTGTGG - Intronic
1132863310 16:2082007-2082029 CAGAAGCAGTAGGGGCCCTGTGG + Intronic
1132863684 16:2083558-2083580 CAGCAGTAAGCAGAGCCCTGGGG + Intronic
1133246227 16:4450620-4450642 CAGTTGAAAGAGGGGGGCTGTGG + Intronic
1133305324 16:4804687-4804709 CTCCAGACAGAGGGGCCCTTGGG - Exonic
1133427351 16:5704362-5704384 TAGCACACAGAGGGGCCCTGGGG + Intergenic
1134331194 16:13252495-13252517 CAGCATGAAGAAGGGTCCTGGGG - Intergenic
1134826099 16:17285595-17285617 CAGCAGAAAGCAGGGCCCCCGGG - Intronic
1136614994 16:31393236-31393258 CAGCAGGAAGAGGGGCACAGTGG - Intergenic
1137572616 16:49576627-49576649 CAGCAGAGAGTTGGGCTCTGGGG - Intronic
1138200854 16:55087347-55087369 CTTCAGCAACAGGGGCCCTGGGG + Intergenic
1139698892 16:68695168-68695190 CTGCAGTTAGAGGGGCTCTGAGG + Intronic
1141183552 16:81771178-81771200 CAGCAGAAGGAAGGACCTTGAGG - Intronic
1142207667 16:88791660-88791682 CAGCAGCAAAGGGGGCACTGAGG + Intergenic
1142742835 17:1940959-1940981 CTGCAGCAAGAGAGGCCTTGCGG + Intronic
1142758411 17:2029152-2029174 CAGGAGAAAGACCAGCCCTGAGG + Intergenic
1143130279 17:4673129-4673151 GAGCAGAAAGAGGAGACCTGAGG + Exonic
1143337926 17:6187418-6187440 CTGCAGGAGGAGAGGCCCTGTGG - Intergenic
1143512957 17:7405884-7405906 CTGCAGGAAGGGGGGGCCTGCGG + Intronic
1143635517 17:8162206-8162228 AAGCAGTAGGAGGGACCCTGGGG - Intronic
1144825421 17:18103101-18103123 CAGCAGGAGGAGAGGACCTGAGG - Intronic
1146349584 17:32083738-32083760 CCGCAGACAGAGGGCCCCAGGGG + Intergenic
1146533921 17:33633480-33633502 CAGCAGAAACAGGCTCCCTGTGG - Intronic
1147668448 17:42163390-42163412 GAGCAGACAGAGGGGGACTGGGG + Intronic
1147911467 17:43858553-43858575 CAGCAGGCAGAGGGGCTCTAGGG + Intronic
1148192968 17:45692696-45692718 CAGGAGGAAGATGGACCCTGAGG + Intergenic
1148838433 17:50478922-50478944 CAGCAGCCAGAGCGGCCCAGAGG + Exonic
1149691218 17:58578365-58578387 CAGGGGAAAGTAGGGCCCTGGGG + Intronic
1150551580 17:66215596-66215618 AAGCAGAAAGAGGAACTCTGGGG - Intronic
1151733167 17:75922886-75922908 GAGAAGACAGAGGGTCCCTGAGG - Intronic
1151756990 17:76080663-76080685 CACCCTAGAGAGGGGCCCTGAGG - Intronic
1152140654 17:78534541-78534563 GAGCAGAAAGAGGGGCCATGAGG - Intronic
1152307411 17:79529440-79529462 CAGCAGACAGAGGGAGACTGGGG + Intergenic
1152382352 17:79948634-79948656 CAGGGGATAGAGGGGCTCTGTGG + Intronic
1152834014 17:82517784-82517806 CAGCAAATAGAGGAACCCTGGGG + Intergenic
1153466302 18:5391486-5391508 CAGCAGAAAGACTGGCTCCGAGG - Intergenic
1153765577 18:8371731-8371753 CAGCAGAAAGAGGGGGAATAAGG - Intronic
1154435832 18:14340983-14341005 CAGCTGAAAGAGGAGGCCAGAGG + Intergenic
1155315386 18:24566210-24566232 AAGCAGAGAGAGGGGACTTGAGG + Intergenic
1156192699 18:34738108-34738130 CAGCAGAAGCAAAGGCCCTGAGG + Intronic
1157473563 18:48007762-48007784 CAGCAGAGTGAGGGGTGCTGAGG + Intergenic
1157951638 18:52044674-52044696 GAGGAGAAAGAGTGGCACTGAGG + Intergenic
1157977383 18:52341666-52341688 CAGGAGAAAGAGGGACCTGGAGG + Intronic
1160814973 19:1030947-1030969 CAGCAGATAGAGCGGCCTGGAGG - Intronic
1161162297 19:2768166-2768188 CAGCAGAGAGAGGGGCCCTGTGG - Intronic
1161795050 19:6381553-6381575 CAGCAGGAGGAGGGGCCCAAGGG - Exonic
1161801565 19:6419172-6419194 CATCACAATGAGAGGCCCTGTGG + Intronic
1161849661 19:6731823-6731845 GGGCAGAAAGAAGGGCCCGGAGG + Intronic
1162535527 19:11261487-11261509 CAGGTGAAAGAGCTGCCCTGTGG - Intronic
1162791228 19:13064085-13064107 AAGAAAAGAGAGGGGCCCTGGGG - Intronic
1163250798 19:16125273-16125295 CAGCAGAAAGAAGGGCCACAGGG + Intronic
1163927062 19:20356009-20356031 CAGCAGCTTGGGGGGCCCTGAGG + Intergenic
1164644122 19:29845391-29845413 CAGCAGGAAGGGGGCCCCGGTGG - Intergenic
1164818395 19:31224959-31224981 CAGGGGGAACAGGGGCCCTGGGG - Intergenic
1164903635 19:31949117-31949139 CAGCAGGGAGGGGGACCCTGGGG + Intergenic
1164904297 19:31954400-31954422 CAGCAGACACAGGGTCACTGAGG + Intergenic
1165141618 19:33703277-33703299 CAGCATGAAGAAGGGCCCGGTGG + Intronic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1165722631 19:38090553-38090575 CAGCAAAAAGAGGGGACCCAGGG + Intronic
1165765195 19:38346212-38346234 CAGGAGAAACAGAGGCCCTGAGG + Intronic
1165914970 19:39252893-39252915 CAGCACAGGGAGGAGCCCTGGGG + Intergenic
1166046264 19:40232837-40232859 CTGCAGAACGTGGGGCCCTGGGG + Exonic
1166686039 19:44796893-44796915 CAGCAGGAAGCGGGGCGGTGGGG + Intronic
1166731200 19:45059967-45059989 CAGCAGACAGAGTGGCCCAGGGG - Intronic
1167606222 19:50482293-50482315 CAGCAGAAAGGGAGGCCCCTGGG - Exonic
1168601484 19:57722329-57722351 CCACAGAAAGAGAGGCCCAGAGG - Exonic
925011894 2:492270-492292 GAGCACCAAGAGGTGCCCTGTGG - Intergenic
926357884 2:12057622-12057644 CGGCAGCAGGAGGGGCCGTGGGG + Intergenic
926505141 2:13704899-13704921 CAGCAGTAAGAGTGGCAGTGAGG + Intergenic
926796666 2:16625278-16625300 CAGCAGCAAGAGGGCACCTCAGG + Intronic
927085857 2:19673413-19673435 CATCGGTCAGAGGGGCCCTGAGG - Intergenic
929855244 2:45632110-45632132 GAGCAGGAAGAGGGCCCCTGCGG + Intergenic
931759541 2:65404642-65404664 GTGCAGAGAGAGGGGACCTGGGG + Intronic
931922750 2:67038494-67038516 GAGCTGAAAGAAGGCCCCTGAGG - Intergenic
931984029 2:67724302-67724324 CAACAGAAATAGGGATCCTGAGG - Intergenic
932818334 2:74879147-74879169 CAGCAGCCAGAGGAGCTCTGCGG - Intronic
934490165 2:94756852-94756874 CAGCTGAAAGAGGAGGCCAGGGG - Intergenic
934552574 2:95271419-95271441 AGGCAGCCAGAGGGGCCCTGGGG + Intergenic
934568020 2:95351285-95351307 CAGCAGCCAGTGGGACCCTGCGG - Intronic
935577315 2:104724299-104724321 CAGCATAAAGAAGGGCCAGGTGG + Intergenic
936090509 2:109498890-109498912 CAGCATATGGAGGAGCCCTGAGG + Intronic
936250669 2:110866150-110866172 CAGCAGGATGTGGGGGCCTGGGG + Intronic
937799042 2:126059852-126059874 CAGCAGCAAGAAGAGCCTTGAGG - Intergenic
938103367 2:128513129-128513151 CTGAAGAAAGATGGGTCCTGAGG + Intergenic
939219267 2:139281236-139281258 CAGCAGCAGGAAGAGCCCTGTGG + Intergenic
940796895 2:158089664-158089686 CAGCAGCGAGAAGAGCCCTGTGG - Intronic
941918580 2:170828214-170828236 CAGCAGAAAGAGGAGGGGTGAGG - Intronic
942037849 2:172028308-172028330 GAGCAGAAAGGGGGCCCCTGTGG + Intronic
942249890 2:174038550-174038572 GAGCAGAAAGAGGACCACTGTGG + Intergenic
943451838 2:188052208-188052230 CAGCTGAATGAAGGTCCCTGAGG + Intergenic
947543358 2:230993535-230993557 AAGCAGAGAGAGGGCACCTGTGG - Intergenic
947875496 2:233464882-233464904 TAGAACACAGAGGGGCCCTGAGG + Intronic
1168753181 20:297919-297941 CCGCAAAAAGAAGGGCGCTGCGG + Exonic
1168761514 20:353220-353242 CAGCAGAAGCAGGGTCCCCGAGG - Exonic
1168888857 20:1280719-1280741 AACCAGGAAGAGGGCCCCTGAGG - Intronic
1169366562 20:4997369-4997391 CAGCAGATACAAAGGCCCTGAGG - Intronic
1169477121 20:5941707-5941729 CTGCATCAAGATGGGCCCTGTGG - Intronic
1169990481 20:11497719-11497741 CATCAGAAAGAGGGTCCTTGTGG - Intergenic
1171202353 20:23252228-23252250 CAGCAGAGAGTGGGTCCATGTGG + Intergenic
1171349971 20:24494661-24494683 CAGCAGGGACCGGGGCCCTGAGG + Intronic
1172778226 20:37420386-37420408 GAGCACAAAGCGGGGCCCTGGGG - Intergenic
1172788087 20:37483073-37483095 CTGCAGAAAGATGTGCACTGTGG - Intergenic
1172970594 20:38870574-38870596 TAGCACAAGCAGGGGCCCTGGGG + Intronic
1173213707 20:41059146-41059168 CAGCAGATACAGGGGCCTTTTGG + Intronic
1174143301 20:48432285-48432307 CCGCAGACAGAGCAGCCCTGAGG + Intergenic
1174163229 20:48566300-48566322 AGCCAGAAAGAGGGGCGCTGTGG + Intergenic
1175808566 20:61845191-61845213 GAGCAGCATGAGGGGCCCCGAGG - Intronic
1176841202 21:13844651-13844673 CAGCTGAAAGAGGAGGCCAGAGG - Intergenic
1177760574 21:25398577-25398599 CAGCAGACACAGAGGGCCTGAGG + Intergenic
1178699639 21:34822040-34822062 CAGCAGAGTGAGGGGCTCTGGGG + Intronic
1179512708 21:41884491-41884513 CAGCACAAAGTGGGTCCCTCTGG + Intergenic
1179615778 21:42582316-42582338 CAGAGGGAAGAGGTGCCCTGTGG - Intergenic
1179980506 21:44893301-44893323 CAGCACACTGAGGGGTCCTGGGG - Intronic
1180999393 22:19981044-19981066 CAGAAGAAAGGTGGACCCTGGGG - Intronic
1181048506 22:20227803-20227825 CATCAGTCAGAGGTGCCCTGTGG + Intergenic
1182086282 22:27563406-27563428 CAGCAGCCAGAGGGACCCTAAGG - Intergenic
1182698179 22:32210182-32210204 CTGCAGAAAGAAAGTCCCTGTGG + Intergenic
1183030410 22:35099724-35099746 CAGGAGACAGACTGGCCCTGTGG + Intergenic
1183224839 22:36542550-36542572 CTGCAGAAAGTGGGGGCCTGAGG - Intergenic
1183511440 22:38237495-38237517 CAGCAGAAGGCTGGGCCATGAGG - Intronic
1183674418 22:39291671-39291693 CTGCAGACAGGGGGGCCATGGGG - Intergenic
1184186071 22:42866317-42866339 CAGCAAGCAGAGGGGCCCTCAGG - Intronic
1184560572 22:45260712-45260734 CTACAGGAAGAGGGGCCTTGGGG + Intergenic
1184855018 22:47142120-47142142 CAGTAGGAAGATGGGACCTGTGG + Intronic
1184889274 22:47369556-47369578 CAGCAGAACCAGGGCCCCAGCGG + Intergenic
1185118888 22:48953945-48953967 CTGAAGACAGAGGGGCGCTGGGG + Intergenic
1185255313 22:49828111-49828133 ATGGAGAATGAGGGGCCCTGAGG + Intergenic
950053319 3:10008087-10008109 CCCCAGAAAGAGGGCCCCTGTGG + Intronic
950364690 3:12474710-12474732 AATCAGACAGAGGGGCTCTGGGG + Intergenic
950414965 3:12863918-12863940 CCCCAGAGAGAGGGTCCCTGTGG + Intronic
950416711 3:12873058-12873080 CCCCAGAGAGAGGGTCCCTGTGG + Intergenic
952201290 3:31130815-31130837 CAGTGGAAAGCAGGGCCCTGTGG - Intergenic
952219327 3:31308910-31308932 CAGCAGGAAGTGGGGTTCTGAGG + Intergenic
952500250 3:33955267-33955289 CAGCCTAAAGAGGGGGTCTGAGG - Intergenic
952586671 3:34901116-34901138 CAGCAGATGGAGGTGGCCTGGGG - Intergenic
953327511 3:42025143-42025165 CAGCAGAAAGCGGGGCAGGGAGG - Intronic
954326767 3:49868306-49868328 GAGCTGTAAGAGGGGCTCTGGGG - Intronic
954632986 3:52056852-52056874 CTGCGGGAAGAGAGGCCCTGGGG + Intergenic
954865399 3:53724754-53724776 CAGCAGACAGCTGGGTCCTGTGG + Intronic
956214447 3:66833926-66833948 CAGCAGAAAGAGGGAGAGTGGGG + Intergenic
957482488 3:80816405-80816427 CAGCATACAGAGGGGCCCTCAGG - Intergenic
957868550 3:86057260-86057282 CTTCAGAAAGAGGGGCACTATGG - Intronic
959730714 3:109598445-109598467 AAGCAGAAAGAGGGGCTAGGGGG - Intergenic
960595511 3:119404387-119404409 GGGCAGAAAGAGGGGCCTTGTGG + Intronic
961565617 3:127761411-127761433 CTGGAGAAGGAGGAGCCCTGGGG - Intronic
961713294 3:128843112-128843134 CCCCAGAGAGAGGGTCCCTGTGG - Intergenic
961745542 3:129061705-129061727 CTGCAGAGAGAGGGGCTGTGAGG - Intronic
961978175 3:131048457-131048479 CAGCAGCAGGAAGAGCCCTGTGG - Intronic
962236855 3:133714056-133714078 CAGCAGGCAGAGGGGTCATGTGG + Intergenic
962986850 3:140544059-140544081 CAGCAGAGTGGTGGGCCCTGTGG - Intronic
963974097 3:151461147-151461169 AAACATAAAGAGGGGCCCGGTGG - Intergenic
964212786 3:154246633-154246655 CAGGAACAACAGGGGCCCTGGGG + Intronic
966005561 3:175007509-175007531 CATCAGAAAGAAGGCCCCTGGGG + Intronic
968450733 4:674878-674900 CCGCAGGAAGAGGGGCCTGGAGG - Intronic
968662795 4:1805744-1805766 CAGCACGTACAGGGGCCCTGGGG - Exonic
968705331 4:2074957-2074979 CAGCAGAGAGGGGTGGCCTGTGG + Intronic
968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG + Intergenic
969049915 4:4365409-4365431 CTCCAGACAGAAGGGCCCTGAGG - Intronic
969313524 4:6368094-6368116 CAGCAGATCGGGGGCCCCTGTGG - Intronic
969566832 4:7983718-7983740 CTGCAGGCAGAGGGGCCCTGAGG + Intronic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
970078646 4:12254322-12254344 CAGCAGAAAGAAAGGTCTTGAGG + Intergenic
971159332 4:24117703-24117725 CAGATGACAGAGGGACCCTGTGG + Intergenic
971257453 4:25028464-25028486 CTGCACAATGGGGGGCCCTGAGG - Intronic
973850186 4:54954403-54954425 GAGGAGGAAGAGGGGCTCTGAGG + Intergenic
973878870 4:55248755-55248777 CAACAGATATAGAGGCCCTGAGG + Intergenic
976105026 4:81607086-81607108 CAGCAGAAAGAAGGTCACAGGGG + Intronic
976356399 4:84122671-84122693 CCGCAGGAGGAGAGGCCCTGAGG - Intergenic
979205629 4:118033831-118033853 CACCCGGACGAGGGGCCCTGGGG + Intronic
981836886 4:149064854-149064876 GAGCACAAAGAGGGCTCCTGAGG + Intergenic
982821340 4:159943794-159943816 CAGAAGAAAGAGGGGACCAAGGG + Intergenic
983317414 4:166149692-166149714 CACCCAACAGAGGGGCCCTGTGG - Intergenic
984865852 4:184280009-184280031 CAGCTGAAAGATGAGCCCAGAGG - Intergenic
984951876 4:185014135-185014157 CGGCAGTGAGAGGGGTCCTGGGG - Intergenic
985669716 5:1201147-1201169 CAGCGGGAGCAGGGGCCCTGGGG - Intergenic
985732208 5:1555700-1555722 CAGCAGAAAGAGCTGCACAGTGG + Intergenic
985851072 5:2389490-2389512 CAGCAGAAGGAGGGGGCCAGAGG - Intergenic
985911220 5:2884863-2884885 CAGAAGAAAGAGCTGCCCAGAGG + Intergenic
986271521 5:6235369-6235391 CATTAGAAATAGGGGCACTGGGG + Intergenic
987134158 5:14885348-14885370 CAGCAGAAATGTGGTCCCTGAGG + Intergenic
987312889 5:16697829-16697851 AAGCAGGAAGAGGAGACCTGGGG + Intronic
988067442 5:26239775-26239797 CAGCAGAGTGAGGGGCACAGAGG - Intergenic
989724732 5:44574773-44574795 CAGGATACACAGGGGCCCTGTGG - Intergenic
990248575 5:53889495-53889517 CAGCAGATAAAGGGGCCTAGTGG + Intronic
991655323 5:68898464-68898486 AGGCAGAGAGAGGGGCCTTGAGG - Intergenic
993733619 5:91450306-91450328 CAGAAGAAAGAGAATCCCTGGGG + Intergenic
994043916 5:95286486-95286508 CAGCAGATACAGAGGTCCTGAGG + Intergenic
994531887 5:100982751-100982773 CATCAGACAGAGAAGCCCTGAGG + Intergenic
996245944 5:121263811-121263833 CAGCTGACAGAGGGGCACTCAGG + Intergenic
997759681 5:136433137-136433159 TACCAGAAAGGGGGGTCCTGAGG - Intergenic
998370313 5:141656490-141656512 GAGAAGAAAGTGAGGCCCTGGGG - Exonic
998403699 5:141862043-141862065 CTGCAGGGAGCGGGGCCCTGGGG - Intronic
999266178 5:150268352-150268374 CAGCAGGTACAGAGGCCCTGAGG - Intronic
999507712 5:152215400-152215422 CAGCAGCATCAGGAGCCCTGAGG - Intergenic
999711169 5:154319898-154319920 CAGCAGACAAAGGGGACCTGGGG - Intronic
999888693 5:155952842-155952864 CAGATGAAAAATGGGCCCTGAGG + Intronic
1000250654 5:159491719-159491741 CATCAGAAAGGTGGGCCCTGGGG + Intergenic
1002284342 5:178152336-178152358 CAGAAGAAAGAGTGGGCCTCTGG - Intronic
1002591414 5:180293323-180293345 AAGCAGGAAGAGAGGCACTGAGG + Intergenic
1002787190 6:411184-411206 CAGCAGAAAGTGGGGTACGGGGG - Exonic
1002792029 6:443961-443983 CGGAAGAGAGAGGGGGCCTGCGG - Intergenic
1002925675 6:1604665-1604687 CAGCAGAAAAAGGGACGATGTGG - Intergenic
1003646986 6:7920901-7920923 AAGGAGAGAGAGGGGCCCAGAGG + Intronic
1003900112 6:10647168-10647190 CAGCACCAAGGGAGGCCCTGGGG + Intergenic
1004202705 6:13564424-13564446 CAGCAGAGAGAGTGTGCCTGGGG + Intergenic
1004722160 6:18277292-18277314 CAGCAGCCAGAGAGGCTCTGAGG + Intergenic
1005118015 6:22359608-22359630 AAGCAGCAAGAGGGTCCCTCAGG + Intergenic
1005893727 6:30160881-30160903 AAGCAGAGAGAGTGGCCTTGAGG - Exonic
1005968624 6:30744137-30744159 CAGCAGAAAGAGAAGCCTTTTGG + Exonic
1006895104 6:37463174-37463196 CAGCAGGATGGGGGTCCCTGAGG - Intronic
1007120733 6:39378616-39378638 TACCAGAAGGAGTGGCCCTGGGG - Intronic
1007240042 6:40418199-40418221 CAGCACATACAGAGGCCCTGGGG - Intronic
1007898367 6:45385912-45385934 AAGAAGAAAAAGGGGCACTGTGG - Intronic
1010688324 6:78877873-78877895 TAGCAGCAAGAGAGGCTCTGTGG - Intronic
1012523970 6:100155302-100155324 CAGCAGTAGGAGGGCGCCTGTGG - Intergenic
1013597502 6:111673214-111673236 CAGAAGAAAGGGCCGCCCTGGGG - Intronic
1013803323 6:113970929-113970951 CAGCAGGAGGAGGAGCCCGGTGG - Exonic
1014624159 6:123705118-123705140 GAGCAGCAAGAGGTGCCCAGTGG + Intergenic
1016739628 6:147513579-147513601 CAGTAGAGGGAGGAGCCCTGGGG + Intronic
1018060289 6:160084710-160084732 CAGTAGAAAGAAGGGCTCCGGGG - Intronic
1018240801 6:161772254-161772276 CAGAAGAAAGCAGGGCCATGTGG - Intronic
1018384062 6:163287180-163287202 CTGCAGAATCAAGGGCCCTGAGG + Intronic
1018434656 6:163749356-163749378 AGGCAGACAGAGGGGCCCTGTGG + Intergenic
1019073940 6:169371617-169371639 CAGCACCAGGAAGGGCCCTGAGG + Intergenic
1019394578 7:810626-810648 CAGGAGCAAGAGAGGCCGTGAGG + Intergenic
1019561884 7:1663586-1663608 CAGCAGACAGAGGTACCCAGAGG - Intergenic
1019668249 7:2263524-2263546 CGGGAGAAAGGGTGGCCCTGGGG + Intronic
1022355545 7:29611191-29611213 CCACAGAGAGACGGGCCCTGAGG - Intergenic
1022955641 7:35377758-35377780 CAGCTCACAGAGGGGCCCTATGG + Intergenic
1022971200 7:35518897-35518919 CAGGAGAAAGAGGGGCTATTTGG + Intergenic
1023932865 7:44717038-44717060 CCGTAGAAAGAGCAGCCCTGAGG + Intergenic
1024909252 7:54426607-54426629 GAAAAGAAAGAGAGGCCCTGCGG + Intergenic
1026098923 7:67368844-67368866 CTGCAGAACCTGGGGCCCTGAGG + Intergenic
1026131166 7:67622072-67622094 CTGCAGAGGGAGGGGTCCTGGGG - Intergenic
1026479291 7:70764463-70764485 CAGGAGCGAGAGAGGCCCTGAGG + Intronic
1026537992 7:71256179-71256201 CAGCTGAAAGCGGGGGCTTGCGG - Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028340328 7:89711475-89711497 ATGCAGAAACAGGGGCACTGAGG - Intergenic
1028371179 7:90094059-90094081 TGGCAGAAAGAGTGGCCATGAGG - Intergenic
1029113065 7:98223276-98223298 GGGTAGAAAGAGGGGCCCAGAGG + Intronic
1029373993 7:100167077-100167099 CAGGAGAGAGAGGGCCCATGTGG + Exonic
1029403144 7:100357612-100357634 CAGCAGGAAGATGGGCACTGGGG + Intronic
1029436803 7:100568265-100568287 CAGCAGGGACAGGGGCCCTTTGG + Intergenic
1030686257 7:112490073-112490095 CTGCAGAAAGTGGGCCCCAGGGG - Exonic
1031971206 7:128066299-128066321 CACCAGCAAGAGGGGCCAAGAGG - Intronic
1032429119 7:131846559-131846581 CAGCAGGAAGATGGGACATGAGG + Intergenic
1032781720 7:135169578-135169600 AAGCAGCAATAGGGGCCCGGAGG + Intronic
1033549034 7:142428794-142428816 TAGCAGAAAGAGGGGGTATGTGG - Intergenic
1034300484 7:150010891-150010913 CAGCAGCAGGAAGGGCACTGTGG - Intergenic
1034805570 7:154086417-154086439 CAGCAGCAGGAAGGGCACTGTGG + Intronic
1034912578 7:155009478-155009500 CAGCAGAAAGCTGGGCAGTGAGG + Intergenic
1034978648 7:155461923-155461945 CAGAAGCAGGAGGCGCCCTGAGG - Intronic
1035057239 7:156043782-156043804 CAGCAGAAGCAGGTGCCCCGAGG + Intergenic
1035638461 8:1164253-1164275 AACCAAAACGAGGGGCCCTGGGG - Intergenic
1035660176 8:1341789-1341811 CTGCAGATGGAGGGACCCTGCGG - Intergenic
1035746968 8:1968065-1968087 CAGCAGCAGGAGGTGGCCTGTGG - Intergenic
1036528411 8:9556469-9556491 CAGCAGTGAGCGGGGCCCTACGG + Exonic
1036916089 8:12805515-12805537 TAGTAGAAAGAGTGGCCCTTTGG + Intergenic
1037829483 8:22179327-22179349 CTGCAGAAGCAGGGGCCCAGTGG + Intronic
1037860113 8:22399018-22399040 CAGCAGGAAGAGCTGGCCTGGGG + Intronic
1039448196 8:37649084-37649106 CAGCACTAAGTGGGGCCCTAAGG + Intergenic
1039733268 8:40302859-40302881 CAGCAGAAAGGGTGACCCTTAGG + Intergenic
1040038894 8:42896945-42896967 AAGGAGAAGGAGGGGCGCTGGGG + Exonic
1040278605 8:46026337-46026359 AAGCAGCAAGAAGGCCCCTGGGG - Intergenic
1041566896 8:59288858-59288880 CAGCAGAAGGAGAGGCAATGTGG - Intergenic
1043151816 8:76727225-76727247 CAGCAGAAAGAGGCTCCTTTTGG - Intronic
1048715690 8:137266095-137266117 CAGTAAAAAGAGAGGCCCGGAGG - Intergenic
1048727244 8:137400544-137400566 CAGCAGACAGAAGGGCACTCAGG - Intergenic
1048833698 8:138498509-138498531 CTGCAGAAAGAGGTGTCCTAAGG + Intergenic
1049092942 8:140530406-140530428 CAGCAGGAAGAGGGGACCTACGG + Intergenic
1049106977 8:140620141-140620163 CAGGAGGAAGAGGGGCCTTCAGG + Intronic
1049166088 8:141127496-141127518 CATCAGAAAAGGGAGCCCTGAGG - Intronic
1049171946 8:141166981-141167003 CAGCAGCAGCAGGTGCCCTGGGG - Intronic
1049605007 8:143525312-143525334 GACCAGAAAGGAGGGCCCTGAGG + Intronic
1049988097 9:970760-970782 CGGCAGCAAGAGGCGGCCTGGGG - Intergenic
1050183338 9:2943605-2943627 CATCAGAAAAAGGGGCCAAGTGG + Intergenic
1051031176 9:12680950-12680972 TGGCAGATAAAGGGGCCCTGTGG + Intergenic
1052455890 9:28697792-28697814 CAGCAATAAGAAGCGCCCTGGGG - Intergenic
1052857908 9:33418408-33418430 CAGCAGGAAGAGGGGGCTTGAGG + Intergenic
1053161807 9:35818622-35818644 CTGCAGATACAGGGGCCCTCTGG - Intronic
1053917419 9:42953964-42953986 CAGCTGAAAGAGGTGGCCAGGGG + Intergenic
1054965850 9:71026267-71026289 CAGCAGATGGAGGGGCGCTCAGG - Intronic
1055873367 9:80913240-80913262 TAGCAGGAAGCTGGGCCCTGTGG - Intergenic
1056502543 9:87223978-87224000 CAGGAGAGGGAGGGTCCCTGGGG - Intergenic
1057280833 9:93710359-93710381 CAGCAGAGAGAATGGCCCCGGGG - Intergenic
1058836889 9:108865210-108865232 CAGCAGAAAGAGAGCCACAGAGG + Intergenic
1059288371 9:113198128-113198150 CAGCAGCAGGAGGAGCACTGGGG - Intronic
1060267776 9:122122226-122122248 CAGGAGCAAGAGGTGGCCTGGGG - Intergenic
1060486908 9:124053540-124053562 CAGCAAAAAGAGGTGACATGAGG - Intergenic
1060789434 9:126476092-126476114 CAGCAGCAAGGGGGGCCCTCAGG - Intronic
1061178714 9:129011915-129011937 CAGGAGGTGGAGGGGCCCTGGGG + Intronic
1061306753 9:129736745-129736767 CTGGGGAAAGAGGGGCTCTGTGG - Intergenic
1061394010 9:130333429-130333451 GAGAAGCAAGAGGGGCCCAGGGG - Intronic
1061400354 9:130365038-130365060 CAGCTGAGTCAGGGGCCCTGAGG - Intronic
1061455112 9:130692026-130692048 ATGCAGAAAGAGGAGCACTGGGG + Intergenic
1061475418 9:130862527-130862549 CAGCAGGTACAGAGGCCCTGAGG + Intronic
1061562961 9:131418271-131418293 CAGAAGGAAGAGGGGGCCAGGGG - Intronic
1061579121 9:131526057-131526079 CAGCAGGAGGGGCGGCCCTGGGG + Intronic
1062117171 9:134815690-134815712 CACCAGAAAGAGGGGAAATGGGG - Intronic
1062145044 9:134984461-134984483 CAGCAGCAGCAGGAGCCCTGTGG - Intergenic
1062352649 9:136146871-136146893 CATCAGCAAGGGGGGCTCTGCGG - Intergenic
1062426230 9:136507447-136507469 CGACAGAACGAGGGGCCCTTCGG + Intronic
1185616746 X:1426550-1426572 CAGCTGAAAGATGGGGCCTCAGG + Intronic
1186757057 X:12682766-12682788 TATCAGAAAGAGGGGCAATGTGG - Intronic
1187060937 X:15786786-15786808 CAACAGAAAAAGGTGCACTGAGG - Exonic
1187449401 X:19383198-19383220 AGGCAGAAAGGGAGGCCCTGAGG - Intronic
1188405044 X:29797471-29797493 CAGAAGGATGAGGGGGCCTGAGG - Intronic
1189446192 X:41084532-41084554 CAGCGGAAGGAGGGGGCGTGGGG - Intergenic
1189504133 X:41594220-41594242 AGGCAGAATGAGGGGTCCTGGGG - Intronic
1190947262 X:55108114-55108136 CAGCATGGAGAGGAGCCCTGAGG + Intronic
1191890217 X:65931978-65932000 CAACACTAAGAGGGGCCCCGAGG - Intergenic
1193347685 X:80423407-80423429 CAGCAGACAGTGGGGCCCAAAGG + Intronic
1193670304 X:84376416-84376438 GAGCACAAAGAGGGCCCTTGAGG + Intronic
1193887353 X:86998802-86998824 CAGAAGAAAGAGAGACCATGGGG + Intergenic
1194512628 X:94814483-94814505 CAGCAGATAGAGGGGTGCTGAGG + Intergenic
1196552545 X:117045981-117046003 AAGCTGAAAGAAGGGCCCTTGGG + Intergenic
1196828210 X:119757709-119757731 TTGTAGAAAGCGGGGCCCTGGGG + Intergenic
1199606036 X:149580333-149580355 CAACAAAAAGAAGGACCCTGAGG - Intergenic
1199633085 X:149789035-149789057 CAACAAAAAGAAGGACCCTGAGG + Intergenic
1199978435 X:152907722-152907744 CAGCACAGAGAGGGGTACTGTGG + Intergenic
1200031752 X:153302762-153302784 AAGTAGAATGAGGGGCACTGGGG + Intergenic
1200090325 X:153632966-153632988 CAGCAGCAACAGGGACCCAGCGG + Intergenic