ID: 917497639

View in Genome Browser
Species Human (GRCh38)
Location 1:175555814-175555836
Sequence CTCCTATCAAGGCTGAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917497639_917497643 -8 Left 917497639 1:175555814-175555836 CCTGAGTTCAGCCTTGATAGGAG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 917497643 1:175555829-175555851 GATAGGAGGATTTGGCTAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 118
917497639_917497645 17 Left 917497639 1:175555814-175555836 CCTGAGTTCAGCCTTGATAGGAG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG 0: 1
1: 0
2: 2
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917497639 Original CRISPR CTCCTATCAAGGCTGAACTC AGG (reversed) Intronic
900466052 1:2826015-2826037 CCCCCATTAGGGCTGAACTCTGG - Intergenic
901388237 1:8925291-8925313 CTCTTGGCAAGGCTGAATTCAGG - Intergenic
902757904 1:18561330-18561352 TTCCCATCAAGGCTGATTTCAGG - Intergenic
906929255 1:50152781-50152803 CTCCTATCAAAGCTCAATTTTGG - Intronic
907004347 1:50895294-50895316 CACCTACCAAGACTGAACCCTGG + Intronic
907699274 1:56767379-56767401 CTCCTATTCAGACTGAACACAGG + Intronic
912677990 1:111703761-111703783 CACCTTTCAAAGCTCAACTCAGG - Intronic
913531543 1:119737435-119737457 CTGCTATCAAGGCTGGAGACGGG - Intronic
915602809 1:156932917-156932939 ATCCCATCAAGGCCAAACTCAGG + Exonic
916239993 1:162630045-162630067 CTGGTGTCAAGGCTGAACACTGG + Intergenic
917497639 1:175555814-175555836 CTCCTATCAAGGCTGAACTCAGG - Intronic
919316973 1:195983136-195983158 CTCATCTCAAGGCAGAACTGGGG - Intergenic
919885360 1:201929967-201929989 CCTCTTTCAAGGCTCAACTCAGG - Intronic
922954558 1:229588119-229588141 CTCATCTGAAAGCTGAACTCGGG + Intergenic
1066986100 10:42468165-42468187 CTCATATCCAGGCTGTATTCTGG - Intergenic
1067250046 10:44578468-44578490 CTCTTATCCTGGCTGAACCCAGG - Intergenic
1072549138 10:96463889-96463911 GTCCTGTCAGGGCTGAACTGGGG + Intronic
1078241084 11:9531249-9531271 CCCCTTTCAAGGCTCAACTAAGG - Intergenic
1079386007 11:19980262-19980284 CACCTATCATGGCAGAACTCGGG + Intronic
1086951769 11:92897935-92897957 CTCCGATCATGGCTGATTTCAGG + Intergenic
1088990738 11:114951240-114951262 CTCATCTCAAGGCTCAACTGGGG + Intergenic
1090313950 11:125768522-125768544 CTCCTGACAAGGCTGAGCTTGGG - Intergenic
1090973805 11:131665127-131665149 CTCCTCTCAAGGCTGACACCTGG + Intronic
1091695173 12:2623499-2623521 CTTCTAGCCAGGCTGATCTCGGG - Intronic
1092252258 12:6906111-6906133 CTCCTATCAAAGCTGACCTGGGG + Intronic
1094332396 12:29308816-29308838 CTCCTAAGGAGGCTGAAATCAGG + Intronic
1097173946 12:57132157-57132179 CTGCTAACCAGGCTGAAATCTGG - Intronic
1097957905 12:65505597-65505619 CTTCTGCCCAGGCTGAACTCAGG - Intergenic
1100097809 12:91065001-91065023 CTCCTATTAAGGCTCACCACTGG + Intergenic
1100117284 12:91322258-91322280 TTCCTATCTCGGTTGAACTCTGG + Intergenic
1100838042 12:98585810-98585832 CTGCTCTCAAGGCTGAACTTAGG + Intergenic
1107908550 13:45084141-45084163 CTCCTATCAAGACTCCATTCTGG + Intergenic
1110730568 13:78875474-78875496 CTCATCTCAAGGCTCAACTGGGG + Intergenic
1121823514 14:96991198-96991220 CTCATATGAAGGCTCAACTGGGG + Intergenic
1122338164 14:101007318-101007340 CCCTTATGAAGTCTGAACTCTGG - Intergenic
1202847762 14_GL000009v2_random:196511-196533 CTCATAACAAGGCAGAACTATGG - Intergenic
1123935136 15:25190427-25190449 CTTGGATCAAGGCTGAGCTCTGG + Intergenic
1125030113 15:35067655-35067677 CTCTTCTCTAGCCTGAACTCTGG - Intergenic
1129558813 15:76543538-76543560 CTCCTACCAATGCTGAAATCTGG + Intronic
1131466273 15:92656876-92656898 CTCCTCTGAAGGCTCAACTGGGG + Intronic
1133648962 16:7791461-7791483 CTCCTTTCAAGGTTCAACTGGGG - Intergenic
1133661988 16:7927367-7927389 GTACTTTCAATGCTGAACTCTGG + Intergenic
1134467148 16:14489648-14489670 CACCGAGCAAGGCTGAAGTCTGG - Intronic
1136629732 16:31482976-31482998 GTCATATCAAGGCTGAAGGCTGG - Intergenic
1138625577 16:58248986-58249008 CTCCTAGGGAGGGTGAACTCTGG - Intronic
1143117124 17:4587389-4587411 CTCCTCTCAATGCTGGACACTGG - Intronic
1145970811 17:28955481-28955503 CTCCTCTCAACGGTGACCTCTGG - Exonic
1147922302 17:43925432-43925454 CTCCTCTGGAGGCTGAACTGGGG + Intergenic
1148150588 17:45394619-45394641 CCCCTACCCAGGCTGTACTCTGG + Exonic
1151905182 17:77043309-77043331 CTCCTATCAAGGCTTCTCTTGGG + Intergenic
1161330075 19:3682750-3682772 CTCCTCTGAAGGCTCAACTGGGG - Intronic
1167050546 19:47075303-47075325 CTCCCAGCAAGGCTCATCTCAGG - Intronic
1168276432 19:55280966-55280988 CTCCTATCCAGGATCAACACGGG - Intergenic
925463763 2:4088147-4088169 GTCCAGTCAAGGCTGAACTCAGG - Intergenic
927859628 2:26552585-26552607 TTCCTATCAAAGCAGAAGTCTGG + Intronic
928358246 2:30640375-30640397 CACCTTGCAAGTCTGAACTCAGG + Exonic
930066720 2:47333226-47333248 CTCCTATCAGAGCTGAGCTGAGG + Intergenic
934087849 2:88525232-88525254 CTCCTATCATGGCTCATTTCAGG - Intronic
935236333 2:101141467-101141489 CTCCAATCTAGACTGAACGCTGG + Intronic
938365830 2:130733209-130733231 CTCCAATCAAAACTTAACTCAGG + Intergenic
939275806 2:139994211-139994233 GTCCTCTCAAGGCTCAACTTGGG + Intergenic
946089377 2:217207433-217207455 CTCCTATTAAGCCAGACCTCAGG + Intergenic
947100356 2:226614238-226614260 ATGCTTTCAAGGCTGAAGTCTGG + Intergenic
948321177 2:237071060-237071082 CTCATCTCAAGGCTCAACTGGGG - Intergenic
948994480 2:241571504-241571526 CTCCTCTGAAGGCTGAATTGGGG + Intronic
949074129 2:242044452-242044474 CTCCTGTTAGGGATGAACTCAGG - Intergenic
1175738000 20:61400469-61400491 CTCTTATCAAAGCAGAACTAGGG - Intronic
1176636833 21:9253514-9253536 CTCATAACAAGGCAGAACTATGG + Intergenic
1180604599 22:17047737-17047759 CTAGTATAAATGCTGAACTCAGG + Intergenic
1180659755 22:17455964-17455986 CTCATATCAGGGCTCAACTGAGG + Intronic
1181867840 22:25873414-25873436 CTCCTTACAAGGCTGGACTGAGG + Intronic
1183291614 22:37005213-37005235 CTCATATCAAGGCTCAACTGGGG - Intronic
1184919924 22:47598861-47598883 CTCCTTACAAAGCTAAACTCAGG - Intergenic
951405263 3:22289492-22289514 CTCCTATCTAGCCTGAATTTGGG - Intronic
952991104 3:38831689-38831711 CTCCTCTCTGGGCTGACCTCAGG + Intergenic
953385765 3:42504860-42504882 CTCCTTCCCAGGCTGAAGTCAGG - Intronic
953745973 3:45574346-45574368 GTCCTATCAAGGCTGTAGTGTGG - Intronic
955503796 3:59611219-59611241 CTTCTTTCAAGGCAGAAGTCAGG + Intergenic
957354483 3:79063760-79063782 CTCCCATCAAAGCTGACTTCAGG - Intronic
959426380 3:106193991-106194013 CTTCTGTCAAGGCTCAGCTCAGG - Intergenic
960897191 3:122517242-122517264 CTGCTATCAAGGTTTAAGTCAGG - Intergenic
962626848 3:137234205-137234227 GTCATATCAAGGCTTAACTGGGG - Intergenic
965686060 3:171304023-171304045 CTCCTCTCATGGTTCAACTCAGG - Intronic
1202750062 3_GL000221v1_random:151505-151527 CTCATAACAAGGCAGAACTATGG - Intergenic
968458317 4:710217-710239 CTCCTCTGAAGGCTGGACTGGGG + Intronic
968981550 4:3852632-3852654 CTCCTATCAGGAAGGAACTCAGG - Intergenic
969597285 4:8156678-8156700 CTCCTACCAGTGCTGAGCTCTGG + Intronic
970999350 4:22304431-22304453 CTCCATGCAAGTCTGAACTCCGG - Intergenic
974933190 4:68383503-68383525 CTCCCACCATGGCTGAACACTGG - Intergenic
978097840 4:104801350-104801372 CTCCTATCAAAGCAAAACCCAGG + Intergenic
982277442 4:153651105-153651127 CTCATCTCAAGGCTCAACTAGGG + Intergenic
982805839 4:159761314-159761336 ATCCTATCAAGGCTGAGCTAGGG - Intergenic
983117370 4:163834991-163835013 CTCCTAGTATGGCTGAACTTAGG - Intronic
984678781 4:182582105-182582127 CTGCTATCACGGCTGGACTGGGG + Intronic
1202751718 4_GL000008v2_random:11956-11978 CTCATAACAAGGCAGAACTATGG + Intergenic
986496868 5:8351261-8351283 CTGCTATAAAGGCTGCTCTCAGG + Intergenic
988029881 5:25750592-25750614 GTCCTATGAAGACTGAGCTCTGG - Intergenic
990399188 5:55420201-55420223 CTCCTATCCAGCCTGGCCTCAGG - Intronic
994340302 5:98618870-98618892 CTTATATCAAAGCTGAACTGTGG - Intergenic
996873661 5:128217887-128217909 GTCCTCTCAAGGCTGCACTCTGG - Intergenic
1003703986 6:8502751-8502773 CTCATATCAAAACTTAACTCAGG - Intergenic
1006830203 6:36963849-36963871 GTCGTGTCAGGGCTGAACTCGGG + Exonic
1010609809 6:77940708-77940730 CTCCTATTAAGGCTCGACACGGG + Intergenic
1011553586 6:88551349-88551371 CTGTCATCAAGGCTGAACGCCGG - Intergenic
1013643577 6:112112591-112112613 ATCCTTTCAAAGCTGAAGTCAGG + Intronic
1017268765 6:152481788-152481810 CTCGTATGAGGCCTGAACTCTGG + Intronic
1017975858 6:159356718-159356740 TGCCCATGAAGGCTGAACTCTGG + Intergenic
1026969273 7:74458170-74458192 CCCCAATCAAAACTGAACTCAGG - Intronic
1028215111 7:88122090-88122112 CTCATCTCAAGGCTCAACTGTGG + Intronic
1031013917 7:116551787-116551809 ATCCTTTCAAGGCTGAGCTGGGG + Intronic
1035730061 8:1847813-1847835 CTCATATGAAGGTTTAACTCGGG - Intronic
1036125782 8:6061012-6061034 CTCCCATCAAGGCTGAAGCTGGG + Intergenic
1037508930 8:19562033-19562055 CTCCTACCAAGCCTGCACTGAGG + Intronic
1040538405 8:48329678-48329700 CTTTTATCAAGTCTGATCTCAGG - Intergenic
1045791798 8:105992150-105992172 CTCATCTCAAGGGTGAACTGGGG - Intergenic
1047735818 8:127764150-127764172 GTCTTCTCAAGGCTGGACTCTGG - Intergenic
1052685937 9:31756325-31756347 CTGCTTTCCAGGCTGAACACAGG - Intergenic
1057795979 9:98158546-98158568 CTCCTGTAAAGGCTGGGCTCAGG - Intronic
1059214703 9:112550281-112550303 ATTCTAGCAAGTCTGAACTCTGG + Intronic
1059261830 9:112984458-112984480 CTTCTATCAAGGATGAAGTATGG - Intergenic
1059392284 9:114006739-114006761 CTCATCTCAAGGCTCAACTGGGG + Intronic
1203718706 Un_KI270742v1:181595-181617 CTCATAACAAGGCAGAACTATGG - Intergenic
1203652932 Un_KI270751v1:145267-145289 CTCATAACAAGGCAGAACTATGG - Intergenic
1189680983 X:43515653-43515675 TTCCTATCATGGCTGATGTCAGG - Intergenic
1196699776 X:118655412-118655434 CTCTTCTCAAGGCTCAAGTCGGG + Intronic
1197286507 X:124601438-124601460 CTGCCATCAAGTCTGAAATCAGG - Intronic
1201172864 Y:11286428-11286450 CTCATAACAAGGCAGAACTATGG - Intergenic