ID: 917497645

View in Genome Browser
Species Human (GRCh38)
Location 1:175555854-175555876
Sequence CCTTCCAACCATGAGTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917497642_917497645 6 Left 917497642 1:175555825-175555847 CCTTGATAGGAGGATTTGGCTAG 0: 1
1: 0
2: 0
3: 3
4: 61
Right 917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG 0: 1
1: 0
2: 2
3: 6
4: 118
917497639_917497645 17 Left 917497639 1:175555814-175555836 CCTGAGTTCAGCCTTGATAGGAG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG 0: 1
1: 0
2: 2
3: 6
4: 118
917497638_917497645 18 Left 917497638 1:175555813-175555835 CCCTGAGTTCAGCCTTGATAGGA 0: 1
1: 0
2: 0
3: 11
4: 145
Right 917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG 0: 1
1: 0
2: 2
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917497645 Original CRISPR CCTTCCAACCATGAGTTGTG TGG Intronic
901946837 1:12711115-12711137 CCTTCCACTCATGACTTTTGAGG - Intergenic
902114894 1:14113307-14113329 CCTGCCAACCTTGTGATGTGTGG + Intergenic
902805819 1:18860690-18860712 CATTCCAGCCATGTGGTGTGTGG - Intronic
903663584 1:24993534-24993556 ACTTCCAATCATTAGCTGTGGGG + Intergenic
904479296 1:30783948-30783970 CCTTCCACCCATGAGTAGCCAGG + Intergenic
906676418 1:47696868-47696890 TTTTCCAACCATGAGTAATGAGG - Intergenic
907158238 1:52353633-52353655 CCTTCCATCCAGGACCTGTGAGG + Exonic
911361315 1:96880873-96880895 CCTTCCAACAAAGAATTGTTAGG + Intergenic
911739817 1:101375286-101375308 CCTTTCAAACATTATTTGTGAGG - Intergenic
915031879 1:152886787-152886809 GCTTCCACCGATGAGTTGGGGGG - Intergenic
915167658 1:153957665-153957687 CCGTCCGACCATAAGTTGTGTGG - Intronic
916275865 1:162992531-162992553 TCTTTCACCCAGGAGTTGTGGGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
918167942 1:181968802-181968824 CCTTCCAGCCATGACTTAGGTGG - Intergenic
919490769 1:198202628-198202650 ACTTTCCACCATGAATTGTGAGG - Intronic
919575285 1:199301062-199301084 CCTTCCAAGCAGGATTTTTGAGG + Intergenic
921245286 1:213232390-213232412 CCTCCCTACTTTGAGTTGTGAGG + Intronic
922712441 1:227844327-227844349 CCTACCCCCCATGAGTGGTGAGG + Intronic
1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG + Intronic
1069546020 10:69329611-69329633 CCTGTCATTCATGAGTTGTGTGG - Intronic
1071169581 10:82848713-82848735 CCCTCCCACCATGATATGTGGGG - Intronic
1078164642 11:8871341-8871363 CCATCCGACCAAGAGTTGTCTGG + Intronic
1081042492 11:38228613-38228635 CCTTCAGACCATGAGTTGTCTGG + Intergenic
1083375582 11:62217606-62217628 CCTTCCACTCATGACTTTTGAGG + Intergenic
1084524404 11:69686769-69686791 CCTTCTCCCCATGAGTTGTGTGG - Intergenic
1085769564 11:79312718-79312740 CCTTCCAACCAAGAAGTGTTGGG - Intronic
1086179526 11:83933790-83933812 CCTTGCAACCATGATCTGTATGG + Intronic
1086547458 11:88014664-88014686 CCTGACAACCATGTGTTTTGGGG + Intergenic
1092586780 12:9908637-9908659 CCTTCCACTCATGACTTTTGAGG - Intronic
1093639711 12:21512037-21512059 TTCTCCAACTATGAGTTGTGTGG - Intronic
1097397603 12:59094675-59094697 CCTGCAAACCCTGTGTTGTGAGG - Intergenic
1100577186 12:95903892-95903914 GCTTCACAGCATGAGTTGTGAGG + Intronic
1102074062 12:110045992-110046014 GCTTAAAACCATGAGTTGTTAGG + Intronic
1102702024 12:114847693-114847715 CTTTCCAAACAGGAGTTGGGGGG + Intergenic
1103159445 12:118716181-118716203 TCTTCCAACTGTGTGTTGTGAGG - Intergenic
1109981152 13:69909644-69909666 CATTCCATGCATGAGTTCTGGGG + Intronic
1111736181 13:92141998-92142020 CATTCCAAGCATGAGATGTGAGG - Intronic
1113263918 13:108595354-108595376 CCTTCCAGCCATGTGGGGTGGGG - Intergenic
1115794137 14:36913564-36913586 CCTTCCAAACATGCCTGGTGTGG - Intronic
1116920759 14:50571127-50571149 GCTTCCAACAATGAGAGGTGGGG + Intronic
1118488990 14:66241008-66241030 CCTTCTAACCCTGATTTTTGAGG + Intergenic
1119148536 14:72337538-72337560 CCATCCAAACATGAGCAGTGAGG + Intronic
1125896032 15:43302353-43302375 CCTTCCATCCCTGAGTCGGGCGG + Intergenic
1126009411 15:44288723-44288745 CCTCCCAACCGTGAGGTGTTGGG + Exonic
1126258171 15:46652985-46653007 CCTTTCAAAGTTGAGTTGTGGGG + Intergenic
1127284725 15:57522300-57522322 TCTGCCAACCATGTGATGTGGGG - Intronic
1128713771 15:69892058-69892080 CCCTCCAACCATGATTTATTTGG - Intergenic
1128983205 15:72200929-72200951 TCTGCCAACCATGGGCTGTGTGG - Intronic
1131009150 15:89002971-89002993 CCCACCAGCCATGAGATGTGTGG + Intergenic
1133764670 16:8829611-8829633 CCTTCCCACCTTGAGTGGAGTGG - Intronic
1135913520 16:26582556-26582578 TCTTCCAACCATAAGATTTGGGG + Intergenic
1136418011 16:30115133-30115155 CCTTGCACCCAGGAGTTTTGAGG + Intronic
1138315487 16:56066114-56066136 TCTTCCACCCATGACTTCTGTGG - Intergenic
1140675108 16:77320305-77320327 CCTTCCAACTATGTTTTCTGTGG + Intronic
1144692127 17:17274198-17274220 TCTTCCAATTTTGAGTTGTGGGG + Intronic
1144969272 17:19097241-19097263 CCTCCCAATCATGTTTTGTGTGG - Intergenic
1144978644 17:19154824-19154846 CCTCCCAATCATGTTTTGTGTGG + Intronic
1144989578 17:19223408-19223430 CCTCCCAATCATGTTTTGTGTGG - Intronic
1145732717 17:27203992-27204014 CTTTACCACCATGAGATGTGGGG + Intergenic
1148008860 17:44458133-44458155 CCTTAGACCCATGAGTAGTGGGG - Intronic
1150281854 17:63933533-63933555 CCTTCCAACCATGGCATGGGAGG - Intergenic
1153600203 18:6773606-6773628 CCTTCTGACCATAAGTTGCGTGG + Intronic
1157093112 18:44659960-44659982 CCTTTCAACCATGAAATGTCAGG + Intergenic
1160218361 18:76953900-76953922 CCTCCCAAGCATGAGGAGTGTGG - Intronic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1161525888 19:4754961-4754983 CCTACCAACCAAGAGTTATCTGG - Intergenic
1161748273 19:6075035-6075057 GCTTCCCACCATGTGATGTGAGG + Intronic
1163004912 19:14391105-14391127 CTTTCCATCCATGAGGTTTGGGG + Intronic
931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG + Intergenic
935048080 2:99499494-99499516 CCTTCCACTCATGACTTTTGAGG + Intergenic
937425957 2:121798571-121798593 CATTGCAACCATGAGCTCTGGGG - Intergenic
943470594 2:188290493-188290515 CCTCCAAACCATGAGATTTGGGG + Intergenic
943890484 2:193279674-193279696 CCTTCCAACAATGATTTATTTGG + Intergenic
944140339 2:196449248-196449270 CCTTGAAACTATGAGTTGTATGG + Intronic
945574953 2:211518998-211519020 CCTTCCAACTTCCAGTTGTGAGG + Intronic
946405095 2:219488289-219488311 CCTTTCATCCAGGAGATGTGCGG - Exonic
948155802 2:235779903-235779925 CATTCCAAGCACGAGTGGTGAGG - Intronic
948253474 2:236549700-236549722 CCTTTCACCCATGGGTTGGGTGG - Intergenic
1173616769 20:44408275-44408297 TCTTCCAAGGATCAGTTGTGGGG - Intronic
1176840548 21:13838928-13838950 TCTCCCAAACATGAGTTATGTGG - Intergenic
1177905662 21:26968313-26968335 CCTTCTAACCATAAGTCGTCGGG - Intergenic
1179710869 21:43212251-43212273 CCTCCCAACCTCTAGTTGTGTGG + Intergenic
1182116860 22:27761681-27761703 CCTGCCCATCATGAGTTGGGGGG - Intronic
953044605 3:39283268-39283290 CCTACCACACATGAGCTGTGTGG - Intergenic
954345971 3:49999634-49999656 TATTCCAACCATCGGTTGTGAGG + Intronic
956891999 3:73622648-73622670 CCTCCCAACTAAGAGTTATGGGG + Intronic
957540555 3:81563846-81563868 CCTTCTAAGCCAGAGTTGTGTGG + Intronic
958983286 3:100750661-100750683 CCTTCAATCTATGAGCTGTGAGG - Intronic
960050398 3:113233811-113233833 CCTTCCAAGCATGGGGTGGGTGG - Intronic
966665052 3:182463200-182463222 CCTTTCAGCCATGAGTGGAGCGG - Intergenic
966971408 3:185048770-185048792 CCTACGTACCATGAGCTGTGAGG + Intronic
968062981 3:195740064-195740086 CCAACCATCCATCAGTTGTGAGG - Intronic
968475579 4:805194-805216 CCTTCCAAACATGGGCTCTGCGG - Intronic
968613622 4:1567804-1567826 CCTTCCACCCATGTGTGGAGGGG - Intergenic
970204802 4:13645176-13645198 CCTTCCAACCCTGTGTTCTCTGG - Intergenic
972836855 4:42881426-42881448 CCATCCATCCAGAAGTTGTGAGG + Intergenic
976837872 4:89396382-89396404 CCTTATACCCATGAATTGTGAGG + Intergenic
981120306 4:141042776-141042798 CCTTCCGCCCATGTGTTCTGGGG + Intronic
982352465 4:154430638-154430660 AATTCTAAGCATGAGTTGTGTGG + Intronic
982449483 4:155535222-155535244 CCTTGCACACATGAGTTGTATGG - Intergenic
985886566 5:2684772-2684794 CCCGGCACCCATGAGTTGTGGGG - Intergenic
986626413 5:9727104-9727126 CCATCCAAGCATGTGTTTTGTGG - Intergenic
993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG + Intergenic
997837605 5:137208383-137208405 TCTCCCATCTATGAGTTGTGTGG - Intronic
1017965443 6:159260663-159260685 CCTGTCAACCATAAGTTGCGTGG + Intronic
1021432237 7:20573214-20573236 CCTTCCAACCATATTTTTTGAGG + Intergenic
1022256167 7:28660779-28660801 ACTTCCCAGAATGAGTTGTGAGG - Intronic
1022317101 7:29255461-29255483 CCTTCCAGCCATGAGGTCAGAGG + Intronic
1027160046 7:75795806-75795828 TCTGCCATCCATGAGTTTTGTGG - Intergenic
1028018506 7:85743497-85743519 CCTTCCACTCATGACTTTTGGGG - Intergenic
1030399144 7:109026732-109026754 CCTTGCATCCATGAATTCTGAGG + Intergenic
1033930616 7:146515780-146515802 CCTCCAAATCATGAGGTGTGAGG + Intronic
1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG + Intronic
1035635612 8:1141446-1141468 TCTTCTAACCATCAGCTGTGTGG - Intergenic
1039435555 8:37557045-37557067 TCTGCCAATCATGAGCTGTGTGG + Intergenic
1046754749 8:117961871-117961893 CCTTTCAACTATGAGATCTGTGG - Intronic
1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG + Intronic
1053619948 9:39804699-39804721 CATTCCAAACATGAATTTTGTGG + Intergenic
1053878126 9:42564001-42564023 CATTCCAAACATGAATTTTGTGG + Intergenic
1053894534 9:42730365-42730387 CATTCCAAACATGAATTTTGTGG - Intergenic
1054233568 9:62537693-62537715 CATTCCAAACATGAATTTTGTGG - Intergenic
1054264209 9:62902745-62902767 CATTCCAAACATGAATTTTGTGG - Intergenic
1055725574 9:79224621-79224643 CCTTGCAACCATCAGTTCTGGGG + Intergenic
1060796566 9:126516088-126516110 CCCTCCCACCAGGAGTTCTGAGG - Intergenic
1186616885 X:11198138-11198160 CCTTCCAAAAATGAGGAGTGGGG - Intronic
1189820847 X:44868870-44868892 ACTTCCACCCAGCAGTTGTGAGG - Intergenic
1190431276 X:50379854-50379876 CCTTCCTCCCATGAGCTGTGAGG + Intronic