ID: 917500229

View in Genome Browser
Species Human (GRCh38)
Location 1:175578919-175578941
Sequence GCCATGACATCCAGGGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917500229_917500236 6 Left 917500229 1:175578919-175578941 CCAGGAACCCTGGATGTCATGGC 0: 1
1: 0
2: 0
3: 22
4: 225
Right 917500236 1:175578948-175578970 TGTCTCAACTCACCAAGGCCAGG 0: 1
1: 0
2: 1
3: 8
4: 134
917500229_917500238 21 Left 917500229 1:175578919-175578941 CCAGGAACCCTGGATGTCATGGC 0: 1
1: 0
2: 0
3: 22
4: 225
Right 917500238 1:175578963-175578985 AGGCCAGGAACTCTTTGCCTTGG 0: 1
1: 0
2: 1
3: 27
4: 255
917500229_917500233 1 Left 917500229 1:175578919-175578941 CCAGGAACCCTGGATGTCATGGC 0: 1
1: 0
2: 0
3: 22
4: 225
Right 917500233 1:175578943-175578965 GGCCCTGTCTCAACTCACCAAGG 0: 1
1: 0
2: 1
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917500229 Original CRISPR GCCATGACATCCAGGGTTCC TGG (reversed) Intronic
900034063 1:392351-392373 GCCCAGATATCCAGGGTTTCTGG - Intergenic
900054899 1:622241-622263 GCCCAGATATCCAGGGTTTCTGG - Intergenic
900311588 1:2035903-2035925 GCCATGACATGTTGGGTCCCTGG + Intergenic
901545239 1:9951555-9951577 GCCTTGACTTCCTGGGTTCACGG + Intronic
905582927 1:39095789-39095811 GCCATGACCTCCTGGGCTCAAGG - Intronic
905685558 1:39905041-39905063 GCCTTGACTTCCTGGGCTCCAGG + Intergenic
906118826 1:43373901-43373923 GCCCTGACTTTCAGGGTTCCAGG - Intergenic
906501825 1:46346922-46346944 TCCATGACACCCAGGCTGCCAGG - Exonic
907538200 1:55185038-55185060 GCCTTGACCTCCAGGGCTCAAGG + Intronic
911188342 1:94925880-94925902 CCCATGACATCAGGGGTTTCTGG - Intronic
911301764 1:96183380-96183402 GCCTTGACCTCCCGGGTTCAAGG - Intergenic
912333150 1:108837578-108837600 GCCAAGTCATCCAGGGTAACTGG + Exonic
914222033 1:145689804-145689826 GCCATGGCTTCTAGGGTGCCTGG - Intronic
914767033 1:150647408-150647430 GCCTTGACCTCCAGGGCTCAAGG - Exonic
916280025 1:163040196-163040218 GGCAAGAAATCCAGGGTTCCAGG - Intergenic
916709564 1:167391650-167391672 GCCTTGACCTCCAGGGGTCAAGG + Intronic
917500229 1:175578919-175578941 GCCATGACATCCAGGGTTCCTGG - Intronic
917957558 1:180116004-180116026 GCCTTGACCTCCTGGGTTCAAGG - Intergenic
921101423 1:211932255-211932277 GCCCTGACCTCCTGGGTTCAAGG - Intergenic
922256417 1:223896515-223896537 GCCCAGATATCCAGGGTTTCTGG - Intergenic
923251423 1:232182404-232182426 TCCAGGGCTTCCAGGGTTCCAGG + Intergenic
923436490 1:233972105-233972127 GCCATGACAACTAAGGTTGCTGG + Intronic
923552351 1:234973971-234973993 GTCATGACCTCCAGTGTCCCTGG + Intergenic
924337625 1:242999374-242999396 GCCCAGATATCCAGGGTTTCTGG - Intergenic
1062802672 10:391664-391686 TCCAAAACAGCCAGGGTTCCAGG + Intronic
1063152881 10:3352760-3352782 GACATGACGTCCATGGCTCCAGG - Intergenic
1069710655 10:70486437-70486459 GCCCTGTCAACCAGGGTGCCGGG - Intronic
1072701271 10:97643071-97643093 GCCTTGACATCCAGGGCTCAAGG + Intronic
1073725609 10:106226852-106226874 GCCTTGATATCCAGGGTTGGTGG - Intergenic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1075474387 10:122720967-122720989 TCCATGAGATCCAGGGCTCCTGG + Intergenic
1075999215 10:126902396-126902418 GCCACAACCTCCAGGGCTCCTGG + Intergenic
1077313707 11:1905899-1905921 GCCTTGACCTCCAGGGCTCAAGG + Intergenic
1077315263 11:1916835-1916857 GGCCTGACCTCCAGGTTTCCAGG - Intergenic
1078465082 11:11544105-11544127 CCTATGGCATCCAGGGGTCCTGG - Intronic
1080280197 11:30548294-30548316 GCCTTGAACTCCTGGGTTCCAGG + Intronic
1082989877 11:59198060-59198082 GCCATGTCATTCAAGTTTCCAGG + Intronic
1082997647 11:59266216-59266238 GCCTTGACTTCCTGGGTTCAAGG - Intergenic
1089286156 11:117409406-117409428 GCCATGAGAAACAGGTTTCCAGG - Intronic
1089341568 11:117761430-117761452 GCCATCACATCTGGGGCTCCTGG - Intronic
1091836189 12:3587912-3587934 GCACAGACAGCCAGGGTTCCAGG + Intronic
1093891676 12:24528850-24528872 GCTATAACATCCAGGCTTTCAGG - Intergenic
1097171612 12:57117490-57117512 GCCTTGACATCCTGGGCTCAGGG - Intronic
1097283642 12:57861387-57861409 GCCTTGACTTCCTGGGCTCCAGG + Intergenic
1101037729 12:100721612-100721634 ACAATGACTTCCAGGATTCCAGG - Intronic
1102302282 12:111779642-111779664 GCCAGGACATGCAGGGATGCTGG + Intronic
1102740071 12:115199245-115199267 GCCCTGGAATCCAGGGCTCCTGG - Intergenic
1104774637 12:131384127-131384149 GCCCTGGGATCTAGGGTTCCAGG - Intergenic
1105882472 13:24616316-24616338 GACATGACAGCAAGGCTTCCAGG + Intergenic
1105998444 13:25695329-25695351 GCCATGACATTCATGGCTGCTGG + Intronic
1106117561 13:26830495-26830517 GCCATGAAATCAAGGGATCCTGG + Intergenic
1106994546 13:35466548-35466570 GCCTTGACTTCCAGGGCTCAAGG + Intronic
1107850709 13:44570271-44570293 GCCTTGACCTCCAGGGCTCAGGG + Intronic
1107975673 13:45686529-45686551 GCCATTACATCCAGAAATCCAGG + Intergenic
1112569184 13:100578507-100578529 GCCAGCAGAACCAGGGTTCCGGG - Intronic
1112596868 13:100815435-100815457 ACCATGACATCCAAGGTGCTAGG - Intergenic
1113548826 13:111176050-111176072 CCCATGACACGCAGGGTTTCTGG + Intronic
1113611074 13:111645451-111645473 GCCAGGGCTGCCAGGGTTCCAGG + Intronic
1114149782 14:20025099-20025121 GCCAGGAGATCCAGGATGCCTGG + Intergenic
1115748454 14:36462471-36462493 GCCTTGACATCCTGGGCTCAAGG - Intergenic
1117558302 14:56909276-56909298 GCCTTGACATCCGGGGCTCAAGG + Intergenic
1118164913 14:63326612-63326634 GCCATGACCTCCTGGGCTCAAGG - Intergenic
1118218583 14:63833124-63833146 GCCTTGAAATCCTGGGATCCAGG - Intergenic
1118567215 14:67154889-67154911 ACCAAGACAGCCAGGATTCCGGG + Intronic
1118620213 14:67608159-67608181 GCCTTGACATCCTGGGCTCAAGG - Intergenic
1119778489 14:77262668-77262690 GCCTTGAAATCCTGGGTTCAAGG - Intergenic
1121621814 14:95355437-95355459 GCTATGGAAGCCAGGGTTCCAGG - Intergenic
1121803499 14:96795082-96795104 GCCATCAGATCAAGGGTGCCAGG + Intergenic
1122216149 14:100205972-100205994 GCCCTGACCTCCAGGGCTCAGGG + Intergenic
1122645065 14:103188950-103188972 GCCGTGGCCTCCAGGGTTCCTGG - Intergenic
1122959024 14:105086095-105086117 GCCCTGACCTGCAGGGTCCCAGG + Intergenic
1125553863 15:40568335-40568357 GCCCTCACTTCCAGGGTGCCTGG - Intergenic
1125618959 15:41041915-41041937 GCCTTGACATCCTGGGTTCAAGG + Intronic
1126685671 15:51246814-51246836 GCCCTCACATCCAGGGTGGCTGG - Intronic
1128495618 15:68196832-68196854 GCCGAGACAGGCAGGGTTCCTGG - Intronic
1130966254 15:88700025-88700047 CCCATGGCAGCCAGGGTTTCTGG + Intergenic
1131070955 15:89465485-89465507 CCCATGACATACAGAGTTACCGG - Intergenic
1132581940 16:688778-688800 GCCAGGACTTCCAGGTTTCCTGG - Intronic
1134062112 16:11205602-11205624 CCCATGAGGTCCAGGGCTCCAGG + Intergenic
1134417623 16:14058089-14058111 CCCATTCCATCCAGGCTTCCTGG - Intergenic
1137706658 16:50540158-50540180 CCCATGGCAGGCAGGGTTCCTGG - Intergenic
1141031467 16:80592536-80592558 GCCACCACATCCATGTTTCCAGG + Intergenic
1143015900 17:3891049-3891071 TCCATGACATTCCGAGTTCCTGG - Intronic
1143692504 17:8581172-8581194 ACCATGACCTCCAGGGTCCATGG - Intronic
1143707798 17:8711594-8711616 GACATACCAGCCAGGGTTCCAGG - Intergenic
1146914926 17:36672293-36672315 GCCCTGACCTCCAGGCTCCCTGG + Intergenic
1147674302 17:42194096-42194118 GCCTTGACATCCTGGGCTCAAGG - Exonic
1149035945 17:52134806-52134828 GCAGTGACATCCATGGTGCCAGG - Intronic
1152325605 17:79634119-79634141 GCCCTGGCCTCCAGGGCTCCAGG - Intergenic
1152562395 17:81085118-81085140 GCCATGACACGCTGGGCTCCAGG + Intronic
1158578147 18:58657703-58657725 GCTAAGAAATCCAGGGATCCAGG - Intergenic
1160021449 18:75184977-75184999 GCTCTCACATCCAGGGTCCCTGG + Intergenic
1160448255 18:78943738-78943760 GCCATGACAGCCAGGGGACACGG + Intergenic
1160616489 18:80133913-80133935 GCCTTGACCTCCTGGGTTCGAGG + Intronic
1160983235 19:1826323-1826345 GCCAGGAGACCCAGGGGTCCAGG + Intronic
1161323186 19:3650582-3650604 GCCCTCACATCCAGTGTCCCAGG + Intronic
1163665189 19:18599907-18599929 GCCAGGACCTCCAGGGTTCATGG + Intronic
1164484276 19:28641444-28641466 GCCATGTCATCGTGGGGTCCTGG + Intergenic
1166432822 19:42741316-42741338 GCCATGTCCCCCGGGGTTCCTGG - Intronic
1166448791 19:42880531-42880553 GCCATGTCCCGCAGGGTTCCTGG - Intronic
1167142564 19:47662034-47662056 GCCTTGACTTCCTGGGCTCCAGG - Intronic
1167285774 19:48598237-48598259 GCCATGAGCCCCAGGTTTCCAGG + Intronic
1168438529 19:56342848-56342870 GCAATGATATCCAGGATTCCAGG - Intronic
1168719982 19:58549520-58549542 GCACTGTCATCCAGGGTTCCCGG - Exonic
925802899 2:7619024-7619046 GCCATGTAATCAATGGTTCCTGG - Intergenic
926040812 2:9671441-9671463 GCCTTGACCTCCCGGGTTCAAGG - Intergenic
926110710 2:10181845-10181867 GCCTTGACCTCCAGGGCTCAAGG + Intronic
926235557 2:11040739-11040761 CTCATTACATCCAGGTTTCCTGG - Intergenic
926249592 2:11146770-11146792 GCCAGGACAGCCAGGGGTCCTGG + Intronic
926834989 2:17009059-17009081 GCCTTGACATCCTGGGCTCAAGG - Intergenic
927559172 2:24057276-24057298 GCCTTGACCTCCTGGGTTCAAGG + Intronic
929231056 2:39560657-39560679 GCCTTGACATCCTGGGCTCAAGG + Intergenic
930058319 2:47268956-47268978 GCCTTGACCTCCTGGGTTCAAGG - Intergenic
930138072 2:47922785-47922807 GCCATGACCTCCTGGGCTCAAGG + Intergenic
930218932 2:48726042-48726064 GCACCGACATCCAGGGCTCCTGG + Intronic
930760083 2:55024173-55024195 GAAATGAAATCCAGGGTTCCTGG + Intronic
934070457 2:88379426-88379448 GCCTTGACCTCCAGGGCTCAAGG + Intergenic
935501371 2:103843976-103843998 GCCTTGACTTCCTGGGTTCAGGG - Intergenic
938049221 2:128151786-128151808 GCCTTGACCTCCAGGGCTCAAGG - Intronic
939234598 2:139475213-139475235 ACCATGAGAGCCATGGTTCCTGG - Intergenic
940097306 2:149992158-149992180 TCCATGAGATCCAGGTTTCCTGG + Intergenic
940562601 2:155319574-155319596 TCCATGACCTCCAAGGTCCCTGG + Intergenic
942380894 2:175388938-175388960 GACATGGAATCCAGGGTTCCAGG - Intergenic
943395109 2:187324095-187324117 GCCTTGGCATCCTGGGCTCCAGG + Intergenic
944242012 2:197495567-197495589 GCCCTGACATCCTGGGCTCAAGG + Intronic
945845178 2:214935712-214935734 GCCTTGAACTCCTGGGTTCCAGG - Intronic
1169246176 20:4027024-4027046 GCCTTGACCTCCAGGGCTCAAGG + Intergenic
1169372963 20:5042890-5042912 GCCCTGACCTCCAGGGCTCAGGG + Intergenic
1169755313 20:9037080-9037102 TCCATGACTTTCAGGGGTCCTGG + Intergenic
1170608710 20:17894471-17894493 GCCTCAACCTCCAGGGTTCCAGG - Intergenic
1170879714 20:20285836-20285858 GCCTTGACCTCCCGGGTTCAAGG - Intronic
1172714758 20:36954496-36954518 GCCCTGACATCAAGGTTTCCTGG + Intergenic
1172890883 20:38263126-38263148 GACATGACAGCCAGCGTTCTGGG + Intronic
1174112376 20:48205451-48205473 GCCAGGACATCCAGGAAGCCAGG - Intergenic
1174855926 20:54045127-54045149 GCCTTGACCTCCAGGGCTCAAGG - Intronic
1175380861 20:58562974-58562996 GCCATGACCTCCGGGGCTCATGG + Intergenic
1176154571 20:63611971-63611993 GCCGTGACCTCCTGGGTTCAAGG - Intronic
1176605737 21:8828860-8828882 GCCGTGACCTCCTGGGCTCCGGG - Intergenic
1178549062 21:33519743-33519765 GCCTTGACCTCCTGGGTTCAAGG - Intronic
1179784958 21:43724280-43724302 GTGCTGACATCCAGGGTTCCAGG - Intronic
1179812747 21:43882936-43882958 CCCATGAGATGCAGGATTCCTGG + Intronic
1180001861 21:44998738-44998760 TCCCTGCCAGCCAGGGTTCCAGG + Intergenic
1180103314 21:45600127-45600149 GCCATCACAACGAGGGTTACAGG - Intergenic
1180348034 22:11720465-11720487 GCCGTGACCTCCTGGGCTCCGGG - Intergenic
1183658269 22:39203485-39203507 ACATTTACATCCAGGGTTCCTGG - Intergenic
1183667565 22:39254358-39254380 GCCATGGCAACCTGGGGTCCAGG - Intergenic
1183727522 22:39597840-39597862 TCCCTGACAGCCAGGCTTCCGGG + Intronic
1184527094 22:45030776-45030798 TTCATGAGATCCAGGGATCCAGG + Intergenic
1184792866 22:46711365-46711387 GCGATGACATGCAGCGTTCCTGG + Intronic
1185336976 22:50275105-50275127 GCCCAGACATCCTGGGGTCCTGG - Exonic
950117999 3:10463834-10463856 GCCCTGACCTCCAGGTTTCAGGG - Intronic
950696024 3:14701807-14701829 GCCATGTCTCCCCGGGTTCCAGG - Intronic
955025713 3:55165570-55165592 ACCATGACATCCAGGTTGCCTGG - Intergenic
955164109 3:56493733-56493755 GCCTTGACCTCCTGGGTTCAAGG - Intergenic
956337951 3:68185827-68185849 GCCTTGACTTCCTGGGTTCAAGG - Intronic
958815933 3:98915601-98915623 GCCATGAGTTCCAGTGTGCCAGG + Intergenic
960879576 3:122331261-122331283 GCCATGACATGCTAAGTTCCAGG - Intronic
961245395 3:125448205-125448227 GCCTTGACCTCCAGGGCTCAAGG + Intronic
961745756 3:129062596-129062618 GCCATGAGACCCAGAGTCCCAGG - Intergenic
962214419 3:133508409-133508431 GACGTGACATCCCAGGTTCCTGG - Intergenic
962382971 3:134911877-134911899 GCCATCCCACCCAGGGATCCTGG + Intronic
965873374 3:173286927-173286949 TCCATGTCATCCAGGGACCCAGG + Intergenic
965921685 3:173924538-173924560 GCCTTGACATCCTGGGCTCAAGG - Intronic
968522046 4:1038448-1038470 GCCATGGCAACCAGGGTGGCAGG + Intergenic
972096908 4:35359167-35359189 GCAATGACAGCCAGCGTTTCTGG + Intergenic
972717915 4:41666858-41666880 GCCTTGGCAGCTAGGGTTCCTGG - Intronic
973372372 4:49262134-49262156 GCCGTGACCTCCTGGGCTCCGGG + Intergenic
973388628 4:49533004-49533026 GCCGTGACCTCCTGGGCTCCGGG - Intergenic
978404374 4:108363960-108363982 GCCTCCACCTCCAGGGTTCCAGG + Intergenic
979239509 4:118435929-118435951 GCCCAGATATCCAGGGTTTCTGG + Intergenic
983593831 4:169443231-169443253 GCCTTGACCTCCTGGGTTCAAGG - Intronic
985089897 4:186351798-186351820 TCAATGACTTGCAGGGTTCCAGG - Intergenic
987358426 5:17084923-17084945 GCCTTGAAATCCTGGGCTCCAGG + Intronic
991044928 5:62212686-62212708 GACAGGACAGCCCGGGTTCCGGG + Intergenic
994296598 5:98096837-98096859 GCCTTGACCTCCTGGGTTCAAGG + Intergenic
996524341 5:124462118-124462140 GCCATGATTTGCAGGGTTTCAGG - Intergenic
999149684 5:149418436-149418458 GCATGGACCTCCAGGGTTCCAGG - Intergenic
1001305449 5:170569119-170569141 ACCATGGCCTCCAGGGGTCCTGG + Intronic
1001556438 5:172640802-172640824 GACAGTACACCCAGGGTTCCCGG - Intergenic
1001711654 5:173783719-173783741 GCCTTGACATCCTGGGCTCAAGG - Intergenic
1002463969 5:179394808-179394830 ACCATGATATTCAAGGTTCCAGG + Intergenic
1002739757 5:181426517-181426539 GCCCAGATATCCAGGGTTTCTGG + Intergenic
1003314990 6:5003998-5004020 GCCATGCTCTCCTGGGTTCCTGG + Exonic
1004671956 6:17806000-17806022 GCCTTGACCTCCTGGGCTCCAGG + Intronic
1005974648 6:30788851-30788873 GTCAAGACATCCTGGGTCCCAGG + Intergenic
1009838899 6:69041685-69041707 GCCTTGACCTCCAGGGCTCAAGG + Intronic
1010727603 6:79353069-79353091 GCCAGGACAGCGAGGGTTTCTGG + Intergenic
1014226248 6:118850905-118850927 GCCTTGACCTCCTGGGTTCAAGG + Intronic
1018324133 6:162646353-162646375 GCCTTGACACCCTGGGCTCCAGG + Intronic
1019244870 6:170702103-170702125 GCCCAGATATCCAGGGTTTCTGG + Intergenic
1020976338 7:15011981-15012003 GCCATGACATTGAAGGTTCCAGG + Intergenic
1023010867 7:35923934-35923956 GCCTTGACCTCCTGGGTTCAAGG + Intergenic
1023624463 7:42102286-42102308 CCCAAGACAGCCAGGGTACCTGG + Intronic
1024578475 7:50782961-50782983 GCCATGAGAACCAGGGATCCGGG - Intronic
1025124501 7:56334033-56334055 GCCTTGACCTCCTGGGTTCAAGG + Intergenic
1026930307 7:74219977-74219999 GCCATGTCCGCCAGGGGTCCTGG - Exonic
1027480320 7:78687617-78687639 GCCATGACATCCAATTTTTCTGG + Intronic
1028187697 7:87807446-87807468 GCATTGACATCCAGAGCTCCTGG - Exonic
1030787966 7:113685457-113685479 GCCTTGACCTCCTGGGTTCAGGG + Intergenic
1032071900 7:128812969-128812991 GCCATGACCTCTATGGCTCCAGG - Intronic
1032189498 7:129755963-129755985 GTCATGAGATCAAGGATTCCTGG - Exonic
1035374929 7:158401565-158401587 GCCATGACACACTGGGTCCCAGG + Intronic
1035503253 8:106084-106106 GCCCAGATATCCAGGGTTTCTGG - Intergenic
1037736560 8:21571651-21571673 GCCATGAGATACATGGCTCCAGG + Intergenic
1038654013 8:29431938-29431960 GCCTTGACCTCCTGGGTTCAAGG - Intergenic
1038766133 8:30429412-30429434 GCAATGAAATCCAGGCCTCCTGG + Intronic
1039048334 8:33470335-33470357 GCCTTGACCTCCAGGGCTCAAGG - Intronic
1039389127 8:37163006-37163028 GGCCTGAGAACCAGGGTTCCTGG + Intergenic
1040771449 8:50982430-50982452 GCCATGAGACCCAGCGTTGCTGG + Intergenic
1041273819 8:56136905-56136927 GCCTTGACCTCCTGGGTTCGAGG + Intergenic
1041737634 8:61128551-61128573 GGCATGAAATCCAGGGTCCAGGG + Intronic
1042024973 8:64413712-64413734 GCTAGGACATCCAGGGTTCTGGG - Intergenic
1045292601 8:100846736-100846758 GCCTTGACCTCCTGGGTTCAAGG + Intergenic
1047983884 8:130212850-130212872 GTCATCACCTCCAAGGTTCCTGG - Intronic
1049329884 8:142044763-142044785 GGCAGGACCTCAAGGGTTCCAGG + Intergenic
1049433750 8:142576906-142576928 GCCAGGGCATCCAGGCTTGCAGG - Intergenic
1049436868 8:142590462-142590484 GCCATGTCGCCCATGGTTCCTGG + Intergenic
1049977987 9:878013-878035 TCTATGACCTCCAGGGTTGCTGG - Intronic
1052981762 9:34455372-34455394 GCCATAAAAACCAGGGTCCCAGG - Intronic
1054352520 9:64029968-64029990 GCCTTGACCTCCTGGGCTCCGGG - Intergenic
1054799586 9:69334119-69334141 TCCATGAGGTCCTGGGTTCCAGG - Intronic
1055397387 9:75890496-75890518 GCTGTAACCTCCAGGGTTCCGGG - Intergenic
1056144674 9:83717909-83717931 ACCATGTTTTCCAGGGTTCCAGG + Intergenic
1058417341 9:104802606-104802628 GCCCAGAGATCCAGGGGTCCTGG + Intronic
1060065937 9:120501178-120501200 GGCAAGACAGCCAGGGTTGCTGG - Intronic
1060404932 9:123368435-123368457 GCCATGGCCTCCTGGGTACCTGG + Intronic
1060593067 9:124831624-124831646 GCCTTGACCTCCAGGCTTACAGG - Intergenic
1061012968 9:127966187-127966209 GCCAGGTCATCCAGGCTTGCTGG + Intronic
1061399671 9:130361542-130361564 GCCATGATGCCCAGGGTCCCAGG - Intronic
1061757670 9:132826722-132826744 GTCTTGACTTCCAGGGTCCCAGG + Intronic
1061925648 9:133804926-133804948 GCCATGGCTTGGAGGGTTCCCGG - Intronic
1203553131 Un_KI270743v1:180862-180884 GCCGTGACCTCCTGGGCTCCGGG - Intergenic
1203605063 Un_KI270748v1:51324-51346 GCCCAGATATCCAGGGTTTCTGG + Intergenic
1186566710 X:10671017-10671039 GCCCTGATGTCCAGGCTTCCAGG + Intronic
1187781121 X:22826378-22826400 GCCATTGCTTCCAGGCTTCCAGG - Intergenic
1187943655 X:24405970-24405992 GCCATGAATTTCAGGGTTACTGG - Intergenic
1189277516 X:39797530-39797552 GCCATGACATCAAGGCCTGCAGG + Intergenic
1189632379 X:42968691-42968713 GGGATGACACCCAGGGTTCTTGG + Intergenic
1189850355 X:45171156-45171178 CCGATGATGTCCAGGGTTCCTGG - Intronic
1190048961 X:47135029-47135051 GCCTTGACATCCTGGGCTCAAGG + Intergenic
1190736164 X:53256946-53256968 GCCATGGCAACCAGGCTGCCAGG + Intronic
1190793386 X:53720659-53720681 GCCTTGACCTCCTGGGTTCAAGG + Intergenic
1192351919 X:70363003-70363025 GCCTTGACTTCCTGGGTTCAAGG + Intronic
1198521425 X:137456980-137457002 GCCTTGACTTCCTGGGTTCAAGG + Intergenic
1199119071 X:144029549-144029571 GCCATGAAACAAAGGGTTCCAGG + Intergenic
1199519225 X:148716536-148716558 CCCATGACATACAGGGTGGCAGG + Intronic
1201786650 Y:17789917-17789939 GGCCTCACATCCAGGGTTCAAGG + Intergenic
1201814903 Y:18116071-18116093 GGCCTCACATCCAGGGTTCAAGG - Intergenic