ID: 917502239

View in Genome Browser
Species Human (GRCh38)
Location 1:175596251-175596273
Sequence CTTCTTACCGTGCAGAAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917502239_917502246 14 Left 917502239 1:175596251-175596273 CCGTGTTTCTGCACGGTAAGAAG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 917502246 1:175596288-175596310 GAGTGGAGGGTCCTTCTAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 121
917502239_917502242 -8 Left 917502239 1:175596251-175596273 CCGTGTTTCTGCACGGTAAGAAG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 917502242 1:175596266-175596288 GTAAGAAGGAGCTGGAGCTGAGG 0: 1
1: 0
2: 5
3: 49
4: 536
917502239_917502244 0 Left 917502239 1:175596251-175596273 CCGTGTTTCTGCACGGTAAGAAG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 917502244 1:175596274-175596296 GAGCTGGAGCTGAGGAGTGGAGG 0: 1
1: 1
2: 11
3: 74
4: 677
917502239_917502243 -3 Left 917502239 1:175596251-175596273 CCGTGTTTCTGCACGGTAAGAAG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 917502243 1:175596271-175596293 AAGGAGCTGGAGCTGAGGAGTGG 0: 1
1: 0
2: 17
3: 98
4: 770
917502239_917502245 1 Left 917502239 1:175596251-175596273 CCGTGTTTCTGCACGGTAAGAAG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 917502245 1:175596275-175596297 AGCTGGAGCTGAGGAGTGGAGGG 0: 1
1: 1
2: 5
3: 73
4: 657

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917502239 Original CRISPR CTTCTTACCGTGCAGAAACA CGG (reversed) Intronic
910463380 1:87471352-87471374 CTTCTTAAGATGCAGCAACAAGG - Intergenic
910955972 1:92705395-92705417 GTTCTTACTGTGCAGGAATATGG - Intronic
917502239 1:175596251-175596273 CTTCTTACCGTGCAGAAACACGG - Intronic
918833490 1:189429626-189429648 ATTTTCACCGGGCAGAAACAAGG - Intergenic
923122956 1:231010547-231010569 CTTCTTCCCTTGGAGAAAAAAGG - Intergenic
1065926406 10:30437183-30437205 CTTCTTACCGCGAAGAAGCCAGG + Exonic
1067548492 10:47215026-47215048 CTGCTTAAAGTGCAGACACATGG + Intergenic
1070352008 10:75601323-75601345 CTTCTTAAAGTGAGGAAACAGGG + Intronic
1070441219 10:76445438-76445460 CTTCTGACCCTGCAGATGCAGGG + Intronic
1070497575 10:77038396-77038418 CTTCTCACTGGGAAGAAACAGGG - Intronic
1070845248 10:79517012-79517034 CTTATTAACATGCATAAACATGG - Intergenic
1073070307 10:100789041-100789063 CTTCTTACAGTGCTGAACCAGGG - Intronic
1078860986 11:15246001-15246023 CTTCTTACTCTGCAGCAACATGG + Exonic
1080642100 11:34164127-34164149 CTTATTACAGGGCAGAAACGGGG - Intronic
1086700480 11:89896079-89896101 CTCTCTACCGTCCAGAAACATGG - Intergenic
1086705689 11:89948447-89948469 CTCTCTACCGTCCAGAAACATGG + Intergenic
1092252059 12:6905054-6905076 CTTCTGATTGAGCAGAAACAGGG + Exonic
1095785512 12:46105010-46105032 CTTCTTGGAGTGCAGAAAGAGGG - Intergenic
1098569479 12:71972701-71972723 AATCTTACCTTTCAGAAACATGG - Exonic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1106777753 13:33025035-33025057 TTTCTGACAGTGCAGAAACTTGG - Intronic
1107561540 13:41561486-41561508 TCTCTTTCCTTGCAGAAACAGGG - Intergenic
1110953499 13:81523172-81523194 CTTCTGACAGTTTAGAAACAAGG - Intergenic
1113435033 13:110284674-110284696 CTTTTTAATGAGCAGAAACATGG + Intronic
1116118880 14:40695361-40695383 GTTGTTTCAGTGCAGAAACATGG + Intergenic
1125248769 15:37675350-37675372 CATCTTACTATGAAGAAACAGGG + Intergenic
1125673029 15:41486954-41486976 CTCCTTACACTTCAGAAACAAGG - Intergenic
1131338811 15:91576437-91576459 CTACTTACCTTGCAGAAATTAGG - Intergenic
1131684020 15:94751910-94751932 GTTCTTACCTTCCAGAAAAATGG - Intergenic
1134359272 16:13516206-13516228 CTTCTTACAGTGAAGCAAGATGG + Intergenic
1135791610 16:25401738-25401760 ATTGTTGCCATGCAGAAACAAGG - Intergenic
1141158816 16:81615897-81615919 ATTGTTACCGTGGACAAACATGG + Intronic
1141486128 16:84341512-84341534 GTTCTTCCCGTGCAGACACCTGG + Intergenic
1144812202 17:18007647-18007669 CTTCTTAGCGTGCAGACCCCAGG - Intronic
1152230529 17:79112086-79112108 CTTTTCACCGTCCAGAAATACGG - Intronic
1156005065 18:32430556-32430578 CTGCATTCCGTGGAGAAACAGGG - Intronic
1156958020 18:42992048-42992070 GTTCTTACCCTCCAGAAAAATGG - Intronic
1157099625 18:44717476-44717498 CTTCTGACTTTGCAGACACAGGG + Intronic
1157532482 18:48432910-48432932 CTCCATAGGGTGCAGAAACAAGG + Intergenic
925257243 2:2500572-2500594 CTTCTTACATGGCAGAAGCAAGG + Intergenic
926863579 2:17335294-17335316 CTCCTTAACAAGCAGAAACAAGG + Intergenic
926943255 2:18160293-18160315 CTTGTTTCCATCCAGAAACAAGG + Intronic
927562380 2:24083145-24083167 CTTCTTTCTCTGCAGAGACAAGG - Exonic
934937653 2:98476955-98476977 CTTCTAGCCATCCAGAAACAGGG - Intronic
937831616 2:126430646-126430668 CTGCTTAAGGTGCAGAAACTTGG + Intergenic
941240415 2:163029454-163029476 CTTCTTACCCTGAAGTAGCAGGG + Intergenic
943403246 2:187444032-187444054 CTCCTTACAGTGCAGTCACATGG - Intronic
946755358 2:222939804-222939826 CTCCTTCCCCTACAGAAACATGG - Intronic
948122035 2:235537844-235537866 CTTAATGCCGTGCAGAAAAATGG - Intronic
1173117366 20:40258242-40258264 CTTCTTACCTAGCAAAAACGAGG + Intergenic
1176054713 20:63138329-63138351 CTTTGTACCAAGCAGAAACAAGG + Intergenic
1178093050 21:29184321-29184343 CTTCTCACCCTGCAGAACCGTGG + Intergenic
1181396547 22:22627102-22627124 CTTTTTACTTTGCTGAAACAGGG - Intergenic
1185194284 22:49459041-49459063 CTTCATGCCGTCCAGAAACACGG - Intronic
955514986 3:59717534-59717556 ATTCTTATGGGGCAGAAACAAGG - Intergenic
960526941 3:118720993-118721015 CTTCTAACCTGGCAGTAACAAGG - Intergenic
967353621 3:188543281-188543303 CTTCTTACTGTGCACTAATAGGG - Intronic
969920980 4:10539513-10539535 CTTCATTCTATGCAGAAACAAGG + Intronic
970970784 4:21980976-21980998 CTTCTTATCGTGTAGGAACTTGG - Intergenic
972913099 4:43843246-43843268 CTTTTGACAGTGGAGAAACATGG + Intergenic
973717716 4:53693708-53693730 CTTCTCAGCCTGCAGAACCAAGG - Intronic
977136619 4:93312803-93312825 CTGATTAAGGTGCAGAAACATGG - Intronic
978284509 4:107060151-107060173 TTTCTTCCCGTGCATAAACAAGG - Intronic
979120195 4:116889240-116889262 CTTCTTGGCTTGCAGAAAGATGG + Intergenic
979993170 4:127399999-127400021 CTTCTTACCATGGAGAAATATGG + Intergenic
980241907 4:130188826-130188848 CTTCTTACCGTGGAGAATAACGG - Intergenic
984101494 4:175491959-175491981 GTGCCTACCGTGCAGAAAGACGG - Intergenic
992491489 5:77248570-77248592 GTACCTACCGTGAAGAAACAAGG + Intronic
992618372 5:78568298-78568320 CTCCTTAATGTGCAAAAACACGG - Intronic
993010635 5:82478582-82478604 CTTCTTACCATGCCCTAACATGG + Intergenic
994752134 5:103751393-103751415 TTTCTTACCTTGCTCAAACAAGG - Intergenic
996192748 5:120565091-120565113 GTTCTTGCAGTGCAGACACATGG + Intronic
1003095571 6:3140428-3140450 CTTCTCACCGTGCACAATCAAGG - Exonic
1003234050 6:4280734-4280756 CTTGTGGCCCTGCAGAAACAAGG - Intergenic
1004128148 6:12893853-12893875 CTTCTCTCCCTGCAGCAACAGGG - Intronic
1008694362 6:54016808-54016830 CTGCTTACCCTGCAGCACCAGGG + Intronic
1011310636 6:85975976-85975998 CTTCTTACCTTTCAGAATGAGGG - Intergenic
1016954586 6:149614264-149614286 CTTCTGACCTTGCAGTCACAGGG + Intronic
1021615457 7:22498858-22498880 CTCCTTACCATGCAGACAAATGG - Intronic
1028377042 7:90155772-90155794 CTCCTTACCATGCAGACAAATGG + Intronic
1031297699 7:120024279-120024301 CTTCTCACCGTGCACATACTTGG + Intergenic
1036780295 8:11642334-11642356 CTTCTTTCCGAGCAGAACCCAGG + Intergenic
1043382741 8:79720841-79720863 CTTATTAATGTGCAGAGACAAGG + Intergenic
1045683795 8:104690495-104690517 TTTCTTACTTTGTAGAAACAGGG - Intronic
1049812530 8:144581892-144581914 TTTGTTTCCGTGTAGAAACATGG - Intronic
1052688596 9:31784711-31784733 CTTTTTTCCCTGCATAAACAGGG + Intergenic
1056836022 9:89955987-89956009 CTTCTCACCTTGCAGAGACAGGG - Intergenic
1059462007 9:114437654-114437676 CTTCTTACCGTGTTGTCACATGG - Intronic
1059577965 9:115512159-115512181 CTTCTTACAGTTCAGGATCAAGG + Intergenic
1060738045 9:126079183-126079205 GTTCTTACCCTCCAGAAAAATGG + Intergenic
1185831365 X:3305939-3305961 CTTTTTAATGTTCAGAAACAGGG + Intergenic
1188478989 X:30618191-30618213 CTTTTTCCAGTGTAGAAACAGGG - Intergenic
1189070085 X:37854411-37854433 CTTCTTACTGGGAAGAAATAGGG - Intronic
1192362987 X:70450827-70450849 CTTCTTCCCCTCCAGAAACCAGG - Intronic
1193417380 X:81241026-81241048 CTTCTGAGCCTGCAGAAGCAGGG - Intronic
1195038084 X:100988363-100988385 CTTCTTGCTGTACAGAAAGAAGG + Intronic
1198277233 X:135106561-135106583 CTTACTACTTTGCAGAAACATGG - Intergenic
1198318879 X:135498703-135498725 CTTGTTTCAGTGCAGAAACATGG - Intergenic