ID: 917504502

View in Genome Browser
Species Human (GRCh38)
Location 1:175615539-175615561
Sequence TCTGTGACCTCGAAGCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917504502_917504504 -3 Left 917504502 1:175615539-175615561 CCCTGAGGCTTCGAGGTCACAGA 0: 1
1: 0
2: 0
3: 13
4: 135
Right 917504504 1:175615559-175615581 AGAGCCTATGTGTCTCCTTACGG 0: 1
1: 0
2: 0
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917504502 Original CRISPR TCTGTGACCTCGAAGCCTCA GGG (reversed) Intronic
900595629 1:3478973-3478995 GCTGTGCCCTCGGGGCCTCAGGG - Intronic
901069250 1:6509102-6509124 TCAGTCCCCTGGAAGCCTCACGG + Intronic
902199853 1:14825182-14825204 TCTGTGCCTTCGCGGCCTCAGGG - Intronic
903675472 1:25061956-25061978 ACTGTGACCTACAACCCTCAAGG + Intergenic
904747265 1:32718926-32718948 TCCCTCACCTCCAAGCCTCAGGG + Intergenic
904997301 1:34640990-34641012 TCCAAGACCTCGAACCCTCAGGG + Intergenic
905226611 1:36482989-36483011 CCTGTGCCCTCGAAGGCGCAAGG - Exonic
910710433 1:90174274-90174296 TCTCTTTCCTCAAAGCCTCAGGG + Intergenic
914885717 1:151582766-151582788 ACTCTGACCCCAAAGCCTCAGGG - Exonic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916091998 1:161314611-161314633 TCAGTGACCCCGAAGCCCTACGG - Intronic
917504502 1:175615539-175615561 TCTGTGACCTCGAAGCCTCAGGG - Intronic
917966800 1:180183901-180183923 TCTGTGCCCTCACAGGCTCATGG + Exonic
918683426 1:187384348-187384370 TCTGTGCCCTTGAGCCCTCACGG + Intergenic
1067247241 10:44557309-44557331 TTGGTGACATCTAAGCCTCAAGG + Intergenic
1067441205 10:46310066-46310088 TCCCTGACCTCCCAGCCTCATGG - Intronic
1067577858 10:47419331-47419353 TCCCTGACCTCCCAGCCTCATGG - Intergenic
1071990660 10:91098015-91098037 TCTGAGACCTCCAAGTCTCTAGG + Intergenic
1075727748 10:124619162-124619184 TCTGTCCCCTCCAAGCCTCGGGG - Intronic
1076112973 10:127874695-127874717 TCTGTGCCCTTGACGGCTCAGGG - Intergenic
1079542533 11:21593479-21593501 TCTGAGACCTCCAAGTCTCTAGG - Intergenic
1081137015 11:39451030-39451052 TCTGAGCCCTCCAAGCCTCTAGG + Intergenic
1083692180 11:64416210-64416232 CCTGTGGCCACGAACCCTCATGG - Intergenic
1083770345 11:64863672-64863694 TCTGTGAGCCCAAAGCCACAGGG + Intronic
1084075853 11:66775586-66775608 TCTGAGACATCCTAGCCTCATGG - Intronic
1085085729 11:73665386-73665408 TCTGTGACCCTACAGCCTCAGGG - Intergenic
1085153682 11:74273197-74273219 TCTGTGTCCTTGAGGTCTCATGG - Intronic
1085526231 11:77165908-77165930 TCTGTCCCCTCCAGGCCTCAGGG + Intronic
1086384525 11:86293528-86293550 TCTGTGACTCAGAAGCCCCAGGG - Intergenic
1086543934 11:87946276-87946298 GCTGTCACCTCTAAGCCACATGG + Intergenic
1090641602 11:128734048-128734070 TCTGTGGCCTCGGAGCCCCTGGG - Intronic
1096101068 12:48970732-48970754 TTTAAGACCTCCAAGCCTCAGGG - Intronic
1096262686 12:50103020-50103042 TCTGAGACCACAAAGCCCCACGG + Intergenic
1096422109 12:51467564-51467586 TCTGTCACCTAGAAGCCTGGAGG - Intronic
1097758063 12:63428323-63428345 TCTGTGTCCTCCAAGTCTCTAGG + Intergenic
1098097887 12:66979495-66979517 TCTGAGGGCTCCAAGCCTCAGGG + Intergenic
1103947685 12:124535585-124535607 GCTGTGTCCTCAAAGACTCAGGG + Intronic
1111421531 13:88018205-88018227 TCTGAGACCTCTAAGTCTCTAGG - Intergenic
1116126662 14:40797155-40797177 TCTGTGTCCTCCAAGTCTCTAGG + Intergenic
1118870873 14:69740226-69740248 TCTGTGACCTGGAAACCTGGGGG - Intronic
1121443923 14:93966789-93966811 TCAATGAACTCAAAGCCTCAGGG + Intronic
1131743601 15:95421102-95421124 GCTGTGCCCTCAAAGCCACAGGG - Intergenic
1132354783 15:101163216-101163238 TGTGTGAACTCCAAGCCCCAAGG + Intergenic
1133200871 16:4203830-4203852 TCTTTGCCTTCTAAGCCTCAGGG - Intronic
1137374744 16:47942955-47942977 TCTGTGCTCTTGAAGCCTCCCGG + Intergenic
1138141785 16:54574883-54574905 TCTGTGACTTTGGAGCCTAAGGG - Intergenic
1140037509 16:71382556-71382578 TCTGTGACCTTGAAGGGTCTGGG + Intronic
1142609739 17:1102266-1102288 TCTGTGGCCACGATGCCTCAGGG - Intronic
1144739056 17:17571028-17571050 TCTGTGGCCTGGACTCCTCAGGG - Intronic
1144956876 17:19023134-19023156 ACTGTGAGCTCCCAGCCTCAGGG - Intronic
1145227541 17:21142708-21142730 CCTGTGACCTGGAAGCCCCCAGG - Intronic
1147377483 17:40031454-40031476 TCTGTGCCAGAGAAGCCTCAGGG - Intronic
1147545484 17:41398086-41398108 TCTGTGCCTTGGAAGCCTTAAGG + Intergenic
1149604354 17:57914405-57914427 ACTGTGACCTCTAAGGCACAGGG - Intronic
1149895025 17:60422501-60422523 TCTGTGACCTAGCCGTCTCAGGG - Exonic
1151908154 17:77062957-77062979 TCTGGAAGCTCGAAGCCACAAGG - Intergenic
1156561637 18:38132245-38132267 TCTGTGAACTCTAAGACTGAGGG + Intergenic
1157781677 18:50445246-50445268 TCTGAGACCTCCAAGTCTCTGGG + Intergenic
1157807306 18:50667776-50667798 TCTGTGACCTCAAAACCTTGGGG + Intronic
1160203776 18:76816426-76816448 ACTGTGACCTTGAAGTCACATGG + Intronic
1160451845 18:78971747-78971769 TCTGTGGTCTCAGAGCCTCACGG + Intergenic
1160608312 18:80068653-80068675 TCTGTGATCGAGAAGCATCAGGG - Intronic
925437023 2:3847226-3847248 TATGTGACGTGGAAGCCCCATGG - Exonic
925624352 2:5827169-5827191 ACTGTGTCCTGGAAACCTCAGGG - Intergenic
926612005 2:14956318-14956340 TCTGAGCCCTCCAAGTCTCAAGG + Intergenic
929902594 2:46018355-46018377 CTTGTGAACTTGAAGCCTCATGG + Intronic
930274128 2:49292033-49292055 TCTCTGACCTGCAAGCCCCATGG + Intergenic
932489226 2:72109334-72109356 TCTGTGACCTCCTAGCATCAAGG - Intergenic
939037305 2:137148505-137148527 TCTGAGCCCTCCAAGCCTCTAGG - Intronic
939326397 2:140695348-140695370 TCTGTGGCCTCTAAGCTTCTAGG + Intronic
940128982 2:150360027-150360049 TCTGTCACCTTGAAGCCTGAGGG + Intergenic
1171879177 20:30604022-30604044 TCTGTGACCAGGAAGCCTAAGGG + Intergenic
1172095140 20:32456828-32456850 TCTGAGAGCTCGAAGCTGCAAGG - Intronic
1176099672 20:63359201-63359223 GCTGTGACCTCGGAGCAACAGGG - Intronic
1177707888 21:24733165-24733187 TCTGGGACCTCCAAGACTAAGGG + Intergenic
1178443524 21:32618080-32618102 TCTGTGGCCTGGGGGCCTCAAGG - Intergenic
1179032641 21:37734101-37734123 TCTGGTACCTCAAAGCCTCAGGG - Intronic
1182797705 22:33003345-33003367 TCTGAGCCCTCCAAGCCTCTAGG - Intronic
1184745607 22:46453978-46454000 TGTGTGACCTCAAGGCCTAAGGG + Intronic
950023893 3:9807930-9807952 TCCTGGACCTCCAAGCCTCAAGG - Intronic
951521100 3:23611517-23611539 TCGGTGACCTCCCAGCCTCCAGG + Intergenic
956459834 3:69460777-69460799 TCTGTGGCCTCCAAGCATAAGGG + Intronic
956848144 3:73202815-73202837 CCAGTGACCTTAAAGCCTCATGG + Intergenic
961830258 3:129619602-129619624 TCTCTGGCTTCTAAGCCTCAGGG + Intergenic
962408538 3:135121211-135121233 TATGTGACCTCCATGCCTGATGG + Intronic
962941514 3:140128792-140128814 TCTGTGCCCTGGAGGCCACATGG - Intronic
963275541 3:143326183-143326205 ATGGTGACCTCGATGCCTCAAGG - Intronic
969970086 4:11037963-11037985 TCTTTGACCTGGAAGCCTAAAGG + Intergenic
974485004 4:62493632-62493654 TCTGAGCCCTCCAAGCCTCCAGG - Intergenic
975209974 4:71688659-71688681 GCTGTTACCTCAAAGCCTGAAGG - Intergenic
976740315 4:88349563-88349585 TCTGTGACATGGAAGCCCCCTGG - Intergenic
977097776 4:92768368-92768390 TCTGTGACCTTAATGCCACATGG + Intronic
978831886 4:113096456-113096478 GCTGTGAGGTGGAAGCCTCATGG - Intronic
979530754 4:121766638-121766660 TCTGTGAACTGCAAGTCTCATGG + Intergenic
980385975 4:132088486-132088508 TCTGAGCCCTCCAAGCCTCTAGG - Intergenic
985970788 5:3376903-3376925 GCTGTGGCCTGGAGGCCTCAGGG + Intergenic
996316038 5:122161750-122161772 TCTGTGACCTAGAAGCCAACTGG + Intronic
998874981 5:146590135-146590157 TGTTTTCCCTCGAAGCCTCAAGG + Exonic
1000391401 5:160726919-160726941 CCTGTGACCTGGAAGCCCCCGGG + Intronic
1002439885 5:179258801-179258823 TCTGGGTCCTCCCAGCCTCACGG + Intronic
1005559578 6:27024533-27024555 TCTGTAACCTCAAAGCCTATGGG + Intergenic
1011303322 6:85899409-85899431 CCTGTGACCTGGAAGCCCCCCGG + Intergenic
1014721378 6:124921573-124921595 TCTGAGACCTCCAAGTCTCTAGG + Intergenic
1017037140 6:150276900-150276922 TCTGTAAGCTCCCAGCCTCACGG - Intergenic
1018058293 6:160070945-160070967 TCTGTGACCTGAGAGGCTCATGG + Intronic
1018784146 6:167094779-167094801 TCTGTGACTGTGAAACCTCAAGG - Intergenic
1019913422 7:4115613-4115635 TCTGTGCCCTGGGAGCCCCAAGG - Intronic
1020310209 7:6861464-6861486 TCTGTGGCCTCGGGGGCTCAAGG + Intergenic
1024711624 7:52021520-52021542 TTTGTGACATCAGAGCCTCAAGG - Intergenic
1025039145 7:55624464-55624486 CCTGTGACCTGGAAGCCTCTGGG - Intergenic
1025039705 7:55630464-55630486 CCTGTGACCTGGAAGCCCCCAGG - Intergenic
1028900926 7:96099910-96099932 TGTGTGGCCTGGAAGTCTCAGGG - Intronic
1029509054 7:100981835-100981857 GCTGTGCCCTGGAAGCCACAAGG - Intronic
1031608147 7:123793945-123793967 TCTGTGCCCTCCAAGTCTCTAGG - Intergenic
1032234762 7:130110641-130110663 TGTTGGACCTAGAAGCCTCAAGG - Intronic
1034486894 7:151371413-151371435 TCTGTGTCCCAGAATCCTCAGGG + Intronic
1036176157 8:6540497-6540519 TCTGTGAGCGTGCAGCCTCATGG + Intronic
1036240817 8:7079703-7079725 TCTGTGGCCTCGGGGGCTCAAGG - Intergenic
1036902336 8:12679648-12679670 TCTGTGGCCTGGGAGGCTCAAGG + Intergenic
1036904937 8:12700085-12700107 TCTGTGGCCTGGGAGGCTCAAGG + Intergenic
1038163148 8:25059748-25059770 TCTGTGACCTCGAGACTGCACGG + Intergenic
1041099122 8:54379030-54379052 TCTGTGATGTCTAATCCTCATGG + Intergenic
1041650809 8:60300401-60300423 CCTGTGACCTGGAAGCCTCTGGG - Intergenic
1045291335 8:100835292-100835314 TCTGTGCCATCTCAGCCTCAGGG - Intergenic
1050255791 9:3790633-3790655 TCTGAGCCCTCCAAGCCTCTAGG + Intergenic
1051519196 9:17965721-17965743 TCTGTGAGCTGGAGGCCCCAAGG + Intergenic
1055601420 9:77923072-77923094 GCTGTGAACTCCTAGCCTCAAGG + Intronic
1055820139 9:80252623-80252645 TCTGTGGCCTCTCAGACTCAAGG - Intergenic
1056448045 9:86685695-86685717 TCTGTGCTCTCAAACCCTCAAGG - Intergenic
1056639590 9:88358998-88359020 TCTGAGGCCTCGCAGCCACATGG + Intergenic
1057265232 9:93613021-93613043 TCTGTGACCAGGAAGCCTAGGGG - Intronic
1058292319 9:103257618-103257640 TCTGTGTCCTCCAAGTCTCTAGG + Intergenic
1059685648 9:116633271-116633293 TCTGTGACCTTGAATTGTCAAGG + Intronic
1061743416 9:132723395-132723417 TCTGTGAACTGTAAGCCTCTGGG + Intergenic
1062060355 9:134492144-134492166 CCTCTGACCTCCCAGCCTCACGG - Intergenic
1062438053 9:136555632-136555654 TCTGCCACCTTGAATCCTCATGG + Intergenic
1188873227 X:35399238-35399260 TCTGAGCCCTCCAAGCCTCTAGG + Intergenic
1190022167 X:46889079-46889101 GCTGTGACCTCCCAGGCTCAAGG + Intronic
1192170798 X:68853260-68853282 GTTGTGCCCTAGAAGCCTCATGG - Intergenic
1193091183 X:77494924-77494946 TCTGGGACCTCTAACCTTCAGGG - Intergenic
1193648291 X:84095320-84095342 TCTGGGACCTAAAAGCCACATGG + Intronic
1193863197 X:86696588-86696610 TCTGTGACCTCAAACTCTGATGG - Intronic
1195428682 X:104763376-104763398 TCTGAGACCTCCAAGTCTCTAGG + Intronic
1196259684 X:113563448-113563470 CCTGTGACCTGGAAGCCCCAGGG - Intergenic
1199185566 X:144911361-144911383 TCTGAGACCTCCAAGTCTCTAGG + Intergenic
1200183305 X:154164881-154164903 TCTGTGACCTCTCAGCCCCAGGG - Intergenic
1200188959 X:154201995-154202017 TCTGTGACCTCTCAGCCCCAGGG - Intergenic
1200194612 X:154239156-154239178 TCTGTGACCTCTCAGCCCCAGGG - Intergenic
1200200364 X:154276939-154276961 TCTGTGACCTCTCAGCCCCAGGG - Intronic