ID: 917505994

View in Genome Browser
Species Human (GRCh38)
Location 1:175627685-175627707
Sequence GGGTGGGTAAGGATGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1446
Summary {0: 1, 1: 1, 2: 7, 3: 138, 4: 1299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917505994_917506009 25 Left 917505994 1:175627685-175627707 CCATCCCCCATCCTTACCCACCC 0: 1
1: 1
2: 7
3: 138
4: 1299
Right 917506009 1:175627733-175627755 TCTACTTTCAAGTTAATCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917505994 Original CRISPR GGGTGGGTAAGGATGGGGGA TGG (reversed) Intronic
900001967 1:19413-19435 GGGAGGGGGAGGATGTGGGATGG + Intergenic
900021687 1:189936-189958 GGGAGGGGGAGGATGTGGGATGG + Intergenic
900078227 1:835116-835138 GGGGGTGGAGGGATGGGGGAGGG - Intergenic
900088259 1:908750-908772 GGAGGGGAAGGGATGGGGGAGGG + Intergenic
900141629 1:1141356-1141378 ATGGGGGTAAGGATGGGGGCAGG - Intergenic
900154119 1:1197320-1197342 GTGTGGGGAAGGTTGGGGCAGGG - Intronic
900183458 1:1322543-1322565 GGGAGGGGTAGGGTGGGGGAGGG + Intronic
900244077 1:1629763-1629785 GGGAGGGAAGGGGTGGGGGACGG - Intronic
900318479 1:2070815-2070837 GGGTGGGCCAGGAAGGGGAAGGG + Intronic
900581789 1:3413138-3413160 GGGTGGGGAAGGGTGTGGGTTGG - Intronic
900614736 1:3560461-3560483 GGGTGAGGAAGGAGGGAGGAAGG - Intronic
900829197 1:4952213-4952235 TGGGGGGTAGGGATGGGGGATGG + Intergenic
900864212 1:5255710-5255732 GGGATGGTTAGGGTGGGGGATGG + Intergenic
901139031 1:7016102-7016124 CGGGGGGTTAGGATGGGGCAGGG - Intronic
901381657 1:8878563-8878585 GGCTAGGTAATGATTGGGGAAGG - Exonic
901491389 1:9598105-9598127 AGGTGGGTGAACATGGGGGAAGG - Intronic
901638199 1:10680061-10680083 GGGTGGGGCAGGCTGGGGAAGGG + Intronic
901638483 1:10681276-10681298 AGGTGGGTCGGGATGGTGGAAGG + Intronic
901947509 1:12715543-12715565 GGGGTGGAAAGGGTGGGGGATGG + Intergenic
902036551 1:13462429-13462451 GGGAGGGTAAGGTGGGAGGATGG - Intergenic
902223171 1:14979645-14979667 GGGTGGGTAAGCTCAGGGGAAGG + Intronic
902388570 1:16089674-16089696 GGGAGGGGAAGGGAGGGGGAGGG + Intergenic
902552777 1:17229213-17229235 GGGTGGGTCAGGGTTGGGCAGGG - Intronic
903026062 1:20430627-20430649 GGGAGGGCAAGGAAGGGGAAAGG + Intergenic
903320355 1:22539293-22539315 GGGTGGGAAAGGCTGGCAGAGGG - Intergenic
903383437 1:22912020-22912042 GGGTGGAGAAGGATGGAGAATGG + Intronic
903623980 1:24718140-24718162 GGGATGGGATGGATGGGGGATGG + Intergenic
904120178 1:28193061-28193083 GGGAGGGTAAGAAGTGGGGATGG + Intronic
904288316 1:29468013-29468035 GAGTGGGAAAGGATGGGAGGAGG - Intergenic
904300550 1:29550810-29550832 GGGCGAGTAAGGCTGGGGGAGGG - Intergenic
904408783 1:30312327-30312349 GGGTGGGACAGGATGGGGGCAGG + Intergenic
904457656 1:30657234-30657256 GGGCGAGTAAGGCTGGGGGAGGG + Intergenic
904599109 1:31664147-31664169 GGGAGGGGAAGGAAGGGGAAGGG + Intronic
904618669 1:31763096-31763118 GGGAGGATAGGGATGGGGGATGG + Intronic
904750957 1:32741496-32741518 GGGTGGGGACGGAAAGGGGAAGG - Intergenic
904770276 1:32877397-32877419 GGGTGGGCCAGGTAGGGGGATGG - Intergenic
904789423 1:33007535-33007557 GGGTGAGTTATGTTGGGGGAAGG - Intergenic
904844182 1:33396345-33396367 GGGTGGGGAAGGGTGAGGGGAGG + Intronic
904910915 1:33933625-33933647 GGGTGGGTAAGGATGCTATAAGG + Intronic
904962170 1:34342204-34342226 GTGAGGATAGGGATGGGGGAGGG + Intergenic
905247533 1:36625475-36625497 GTAGGGGTAAGGATGGGGGTAGG - Intergenic
905259970 1:36710146-36710168 GGGTGGGGAAGGAAGGGGACAGG + Intergenic
905269639 1:36778993-36779015 GGGAGGGGAGGGAAGGGGGAAGG + Intergenic
905322765 1:37129588-37129610 GGCCAGGTAAGGAAGGGGGAAGG + Intergenic
905394275 1:37657228-37657250 GTGTGGGGAAGGCTGAGGGAGGG + Intergenic
905474937 1:38219403-38219425 GGGTGGTTTAGGAAGAGGGAAGG + Intergenic
905799123 1:40832216-40832238 GAGTGCACAAGGATGGGGGATGG + Intronic
905898804 1:41567128-41567150 GGGTGAGAAGGGATGGAGGAGGG - Intronic
905936394 1:41827565-41827587 GCTTTGGTTAGGATGGGGGAGGG - Intronic
905947716 1:41917777-41917799 GGTTGGGTCAGGTTGGGGGTTGG + Intronic
906242328 1:44249614-44249636 GCCTGGGAAAGGGTGGGGGAAGG - Intronic
906249725 1:44301705-44301727 GGGTGGGTCAGGGTAGTGGAGGG - Intronic
906505226 1:46373928-46373950 GGATGGGGATGGATGGGGGTGGG + Intergenic
906730583 1:48077594-48077616 GGGTGGGTTAGAGTTGGGGAAGG + Intergenic
907270169 1:53286485-53286507 GGAGGGGTGAGGGTGGGGGAGGG - Intronic
907432274 1:54420006-54420028 GGGAGGCTGAGGCTGGGGGATGG - Intergenic
908106291 1:60846014-60846036 CGGGGGGTGAGGTTGGGGGAGGG + Intergenic
908579848 1:65502977-65502999 GGGAGGGTATGGATGAGGGAGGG + Intronic
908756997 1:67478083-67478105 GGGAGGCTAAGGCAGGGGGATGG + Intergenic
909432244 1:75602436-75602458 GAGTGGTTAAGGATTGTGGAGGG + Intronic
909496590 1:76285915-76285937 GGGCGGGTCCAGATGGGGGAGGG - Intronic
909607623 1:77522594-77522616 GGGTGGGCAGGGAGGTGGGATGG - Intronic
909730766 1:78886383-78886405 GTGTGAGTAGGAATGGGGGATGG + Intergenic
909786341 1:79618631-79618653 GTGGGGGTGAGGATGGGAGATGG + Intergenic
909934815 1:81538901-81538923 GGGAGGTTGAGGTTGGGGGATGG + Intronic
910114486 1:83716965-83716987 GGTAGGGTAAGGATTGGGGTTGG - Intergenic
910934382 1:92475637-92475659 GGGTAGGTCAAGAGGGGGGAGGG + Exonic
910941453 1:92539436-92539458 GGGAGGGTGAGGCTGGAGGATGG + Intronic
911297242 1:96132642-96132664 GGGAGGCTGAGGATGGTGGATGG + Intergenic
912483730 1:110007154-110007176 TGGAGGGTGAGGGTGGGGGAGGG - Intronic
912620621 1:111153119-111153141 GGATGGGTAAGGAGGAGGGGAGG - Intronic
912756615 1:112329623-112329645 CGGTGGCTGAGGATAGGGGAGGG + Intergenic
912831561 1:112957521-112957543 GGGAGGGTAAGTGAGGGGGAGGG - Intergenic
913602281 1:120433476-120433498 GGAGGGGTATGGGTGGGGGAAGG + Intergenic
913960889 1:143337495-143337517 GGATGGGCAAGGATGGGCAAGGG - Intergenic
914044313 1:144077985-144078007 GGGGGGGGAGGGGTGGGGGAGGG - Intergenic
914055243 1:144163067-144163089 GGATGGGCAAGGATGGGCAAGGG - Intergenic
914084769 1:144443161-144443183 GGAGGGGTATGGGTGGGGGAAGG - Intronic
914123903 1:144803294-144803316 GGATGGGCAAGGATGGGCAAGGG + Intergenic
914133796 1:144882700-144882722 GGGGGGGGAGGGGTGGGGGAGGG + Intergenic
914190777 1:145408327-145408349 GGAGGGGTATGGGTGGGGGAAGG - Intergenic
914363453 1:146957082-146957104 GGAGGGGTATGGGTGGGGGAAGG + Intronic
914488224 1:148130052-148130074 GGAGGGGTATGGGTGGGGGAAGG - Intronic
914588586 1:149085172-149085194 GGAGGGGTATGGGTGGGGGAAGG - Intronic
914744126 1:150488802-150488824 AGGCTGGAAAGGATGGGGGAGGG - Intronic
914959587 1:152194651-152194673 GGAGGGGTGAGGAGGGGGGATGG - Intergenic
915118338 1:153613909-153613931 GGGTGGGTGGGGGTGGGGGGCGG - Intergenic
915282595 1:154832825-154832847 GGCTGGGGCAGGATGGGGAAAGG - Intronic
915469371 1:156116330-156116352 GGGTGGGGTAGGGTGGGGCAGGG - Intronic
916091068 1:161308388-161308410 GTGTGGGTAAGTCTTGGGGATGG - Intronic
916681703 1:167110797-167110819 GGCTGGGAAAGGATGTGGTAAGG - Intronic
916686137 1:167148677-167148699 AGGGGGCTAGGGATGGGGGATGG + Intergenic
916793657 1:168146126-168146148 GGGTGGGGAAGGACGGGGAGGGG + Intergenic
917028424 1:170665296-170665318 TGGTCGGTGAGGATGGGGAAGGG - Intronic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
917916897 1:179710982-179711004 GGGTGGGTTGTGATAGGGGAGGG - Intergenic
917933233 1:179838838-179838860 AGTTGGGTATGGATGGGGGTGGG + Intergenic
918217848 1:182408715-182408737 GGGTGGGTAAGGGTGGAGGGTGG - Intergenic
918231397 1:182536435-182536457 AGGTTGGTGAGGATGGGGAACGG - Intronic
918238297 1:182600554-182600576 GGGTGGGCATGGCTGAGGGAGGG + Intronic
918586389 1:186193329-186193351 GGAGGGGAGAGGATGGGGGAGGG + Intergenic
919034503 1:192289280-192289302 GGCTGGGAAGGGAAGGGGGAGGG + Intergenic
919860977 1:201739514-201739536 GGGTGGGTAAGGAGTTGGGGAGG - Intronic
919910171 1:202106376-202106398 GGGGAGTGAAGGATGGGGGAAGG - Intergenic
920303672 1:205005138-205005160 TGGTGGGCCAGGATGGGGCAAGG + Intronic
920345114 1:205301423-205301445 GAGTGGGTCGGGGTGGGGGAGGG + Intergenic
920890837 1:209984259-209984281 GGGGGCTGAAGGATGGGGGATGG + Intronic
920987493 1:210904350-210904372 GGGTGGGGAAGCATGGGGGAAGG - Intronic
921300498 1:213747063-213747085 GGGTGAGTAAGGATGGAGAAGGG + Intergenic
921358195 1:214306209-214306231 TGGAGGGTGGGGATGGGGGAAGG - Intronic
921381133 1:214525831-214525853 ACATGGGTGAGGATGGGGGATGG + Intronic
921394100 1:214650359-214650381 GGGTGGGAAAGGTTTGGGGTGGG + Intronic
921394477 1:214654057-214654079 GGGGGAATGAGGATGGGGGACGG - Intronic
921701358 1:218272308-218272330 GGGTGCACATGGATGGGGGAGGG - Intergenic
921938585 1:220816931-220816953 GGGTGGATCAGGGTGAGGGAAGG + Exonic
921984714 1:221299983-221300005 GGGTGGGTAGGTATGTGGGCAGG - Intergenic
922490748 1:226014561-226014583 GAGTGGGGAAGGTTGGGGAAAGG - Intergenic
922618858 1:226978661-226978683 GGGTGTGTAAGGAGGTGGGCAGG - Intronic
922979321 1:229812254-229812276 GGGAGGGAAGGGAAGGGGGAAGG + Intergenic
923159594 1:231304964-231304986 GGGTGTCTAAGTCTGGGGGATGG - Intergenic
923482447 1:234397458-234397480 GGGAGGGGAAGGAGGGAGGATGG + Intronic
923482479 1:234397517-234397539 GGATGGGGAAGGATGGGGATGGG + Intronic
923747009 1:236710880-236710902 TGGGGGGTAGGGAAGGGGGATGG - Intronic
923927992 1:238657923-238657945 GGGTGAGGAAGGGAGGGGGAAGG + Intergenic
924414855 1:243849431-243849453 TGGCGGGGAAGGGTGGGGGAAGG + Intronic
924424116 1:243934239-243934261 GGGAGGGGAAGGAAGGGGAAGGG - Intergenic
924740965 1:246794057-246794079 GGCAGGGAAAGGAAGGGGGAGGG + Intergenic
924799271 1:247315638-247315660 GAGTGGGTAAGGAAGAGAGAGGG + Intronic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1062875026 10:936246-936268 TGGAGGGTGAGGATGAGGGATGG + Intergenic
1062968293 10:1626910-1626932 GGGTGGGTGCTGATGAGGGAAGG - Intronic
1063428327 10:5966593-5966615 GGGTGGGAAATGAAGGGAGAGGG - Intronic
1063830817 10:9950605-9950627 TGGTGGGTAGGGTTGGGGGAGGG - Intergenic
1063876491 10:10484231-10484253 GGGAGGGAGAGGAGGGGGGAAGG - Intergenic
1064110309 10:12532961-12532983 GGGTGGGTAGGAAGTGGGGATGG + Intronic
1064623696 10:17240920-17240942 GTGTGTGTAGTGATGGGGGAGGG + Intergenic
1064892134 10:20188258-20188280 GGGTAAGAAAGGATGGGGAAAGG - Intronic
1065097912 10:22300868-22300890 GGGAGGCTAAGGTTGGAGGATGG - Intergenic
1065452644 10:25874554-25874576 GGGAGGGGAAGGATAGGGAAGGG + Intergenic
1066075816 10:31875510-31875532 GGGTAGGGAAGGATGGGTAAGGG + Intronic
1066199001 10:33128029-33128051 GGGTGGGTGAGGAGAGGGAAGGG - Intergenic
1066543433 10:36474222-36474244 GGGTGGGGAAAAATGGTGGAAGG + Intergenic
1066641732 10:37560900-37560922 GGATGGGGAAGGGAGGGGGAAGG - Intergenic
1067029327 10:42869896-42869918 GGATGGGCAAGGATGGGCAAGGG - Intergenic
1067058374 10:43065275-43065297 GGGCAGGTAAGGGTGGGGCAGGG - Intergenic
1067175612 10:43943544-43943566 GGGTGGGGAAGCTCGGGGGAAGG + Intergenic
1067258014 10:44662668-44662690 TGGAGGGTGAGGATGGGGGGAGG + Intergenic
1067258099 10:44662918-44662940 TGGAGGGTGAGGATGGGGGGAGG + Intergenic
1067258116 10:44662968-44662990 TGGAGGGTGAGGATGGGGGGAGG + Intergenic
1069581350 10:69569068-69569090 GGGTGGGGTGGGATGGGGGCAGG + Intergenic
1069680875 10:70284176-70284198 GGGTGGGCAAGGATGAGGAGTGG - Intergenic
1069692263 10:70361702-70361724 GGGAGGGTGAGGGTGGGGGAGGG - Intronic
1069705947 10:70459077-70459099 GGGTGGGGTGGGATGGGGGAAGG - Intergenic
1069770149 10:70893482-70893504 GAGTGGGGAAGGATGAGGGAAGG + Intergenic
1069820227 10:71222960-71222982 GGTGGGATAGGGATGGGGGAGGG - Intronic
1069921887 10:71820521-71820543 GGGTGGTAGAGGATTGGGGAAGG - Intronic
1070383459 10:75902385-75902407 GGGTGGGAGGGGATGGAGGAGGG + Intronic
1070535445 10:77373968-77373990 GGGTGGTTATGGCTGTGGGAAGG + Intronic
1070800410 10:79242023-79242045 AGGTGGGTGGGGCTGGGGGAGGG + Intronic
1070955276 10:80459579-80459601 GCATGGGTAAGGTTTGGGGAGGG + Intronic
1071601205 10:86959511-86959533 GGGGGGGTAAGGATGGTGTCTGG - Intronic
1071899892 10:90108751-90108773 GGGTGGGACGGGAAGGGGGAAGG + Intergenic
1072149390 10:92673557-92673579 GGGTGGGAAAGGATGAGAGAAGG + Intergenic
1072398996 10:95077802-95077824 GGAAGGGAAAGGAAGGGGGAGGG - Intergenic
1072641386 10:97213689-97213711 GGGTGGGAAAGTAAGGTGGAAGG - Intronic
1072696726 10:97609440-97609462 GGGTGAGGCAGGATGGGGTAGGG - Intronic
1073003088 10:100299819-100299841 GGATGGGTCCAGATGGGGGATGG - Intronic
1073207365 10:101776155-101776177 GGGTGGGTGGGGAGGTGGGAGGG + Intronic
1073232777 10:101986475-101986497 CTGTAGGTAATGATGGGGGAAGG - Intronic
1073387828 10:103142139-103142161 CAGGGGGCAAGGATGGGGGAAGG + Intronic
1073977728 10:109119503-109119525 GGGAGGGGAGGGAAGGGGGAGGG + Intergenic
1074112392 10:110431779-110431801 GGGTTGGTAGGGATGAGGGGAGG + Intergenic
1074444872 10:113513428-113513450 GGGGGAGGGAGGATGGGGGAAGG - Intergenic
1074467990 10:113701012-113701034 GGCTGGGGAAGCATGGTGGAAGG - Intronic
1074827920 10:117228236-117228258 GGAAGGGGAAGGATGGAGGAAGG - Intergenic
1075263364 10:120981097-120981119 GAGTGGAAAGGGATGGGGGAGGG - Intergenic
1075583849 10:123643331-123643353 GGGGCGGTGAGGATGGGGAAGGG - Intergenic
1075680893 10:124330534-124330556 GGGTGGGGTTGGATGGGGGAGGG - Intergenic
1075683918 10:124350882-124350904 GGGAGGGTAGGGATGGAGAAGGG - Intergenic
1076000410 10:126908325-126908347 GAGTTGGTAAGGATGGTGGAGGG - Intronic
1076108094 10:127840431-127840453 AGGTCGGTAAGGATGGTGGAGGG + Intergenic
1076676531 10:132149909-132149931 GGGTGGGGAAGGACAGGGCAGGG - Intronic
1076855485 10:133113735-133113757 GAGAGGGCAAGGATGGGGGTGGG + Intronic
1076922757 10:133463969-133463991 GGTTGGGAAGGGTTGGGGGAGGG - Intergenic
1077023679 11:430574-430596 GGCAGGGGAGGGATGGGGGAGGG + Intronic
1077368491 11:2170819-2170841 GGGCGGGGGAGGACGGGGGAGGG + Intronic
1077368768 11:2171934-2171956 GGGTGGGTGAGGAAGGAGGGAGG + Intergenic
1077449886 11:2634317-2634339 GGGTGGGGGGGGAGGGGGGAGGG - Intronic
1077487158 11:2844317-2844339 GGGTGGGCCAGGATGTGGGCTGG - Intronic
1077501527 11:2911670-2911692 GGGTGAGTAAGGGCAGGGGAGGG - Intronic
1077552293 11:3206100-3206122 GGATGGGGAAGGAAGTGGGAGGG - Intergenic
1077898666 11:6473367-6473389 GGGTGGGGTAGGGTGGGGGTGGG + Intronic
1078057185 11:8018396-8018418 GGGTGGGGAGGGGTGGGGCAGGG - Intergenic
1078807984 11:14725581-14725603 GGGAGGGGAGGGAAGGGGGAGGG - Intronic
1079363943 11:19792834-19792856 GGGTTGTGAGGGATGGGGGATGG + Intronic
1079443477 11:20538323-20538345 TGTTGGGGGAGGATGGGGGAGGG - Intergenic
1079460817 11:20676347-20676369 CTGTGGGTTAGGTTGGGGGAGGG - Intronic
1079661883 11:23048323-23048345 GTGTGTGTAAGGATGAGGGAAGG - Intergenic
1079713241 11:23712785-23712807 GGAGAGGAAAGGATGGGGGAAGG - Intergenic
1079845680 11:25463482-25463504 GGCTGGGAAGGGTTGGGGGAGGG + Intergenic
1081059462 11:38455501-38455523 GGCTGGGTGGGGGTGGGGGAGGG - Intergenic
1081326026 11:41745463-41745485 GGGTGCCTAAGGCTGGGAGATGG + Intergenic
1081583096 11:44365866-44365888 GTGTGGGCATGGATGGGGTAGGG - Intergenic
1081976145 11:47236170-47236192 GGGAGGCCAAGGTTGGGGGATGG - Intronic
1082853825 11:57788671-57788693 GGGTGGGAAGGGAGGGGGAAGGG + Intronic
1083003118 11:59315610-59315632 GGGGGGGGGGGGATGGGGGAGGG - Intergenic
1083119491 11:60497362-60497384 TGGTGGGTAAGGGTTGGGTATGG - Exonic
1083244967 11:61419827-61419849 GTGTGGGTGAGTTTGGGGGAGGG - Intronic
1083335198 11:61917888-61917910 GGCCGGGTGAGGAGGGGGGAGGG - Intronic
1083571884 11:63765502-63765524 GGGTGGGTGAGGGAAGGGGAGGG - Intronic
1083591201 11:63896073-63896095 GGGAGGGAATGGTTGGGGGACGG - Intronic
1083625260 11:64069059-64069081 GGGTGGGGCAGGATGGGGGCAGG + Intronic
1083646469 11:64174220-64174242 GGCAGGGTAAAAATGGGGGAGGG - Intergenic
1083913042 11:65721012-65721034 GGAGGGGGAAGGAGGGGGGAGGG - Intergenic
1084104887 11:66975003-66975025 GGGAGGGGAAGGAAGGGGGAGGG + Intergenic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084489729 11:69471747-69471769 GGGAGGGTGAGAATGGGGGCAGG + Intergenic
1084923926 11:72496275-72496297 GGCTGGGAAGGGAAGGGGGAAGG + Intergenic
1084946805 11:72642814-72642836 GGGTGGGGAGGGAAGGGGAAGGG + Intronic
1085014999 11:73168271-73168293 GGGTGGGAAAGGGTAGGGAATGG - Intergenic
1085076420 11:73596940-73596962 GGGTGAGCAAAGTTGGGGGATGG - Intronic
1085331611 11:75656653-75656675 GGGTGGGTAGGGAAGAGAGAGGG - Intronic
1085344992 11:75762951-75762973 GGTGGGGTGAGGGTGGGGGAGGG - Intronic
1085446169 11:76602604-76602626 GGGTGGGAAAGGCTGTGGGGAGG + Intergenic
1085535777 11:77216491-77216513 GGGTGATGAAGGCTGGGGGATGG - Intergenic
1085858285 11:80201154-80201176 ATGTGTGTGAGGATGGGGGAGGG - Intergenic
1086518747 11:87646060-87646082 GGGAGGGGAAGGAAGGGGGAAGG - Intergenic
1087129226 11:94654221-94654243 AGGTGGGTCAGGGTGGGGGCTGG - Intergenic
1087773112 11:102232265-102232287 GGGTGGGAAAGTTTGGGGGGGGG + Exonic
1087792363 11:102420133-102420155 GGCTGGATGAGGATGGGGAAGGG - Intronic
1087931869 11:103987275-103987297 GGGTGGGAAAGGAAGGAGGATGG - Intronic
1087942325 11:104113323-104113345 GCATTGGCAAGGATGGGGGAGGG + Intronic
1088791716 11:113232353-113232375 AGGTGAGTCAGGATGGGGGTGGG + Exonic
1089012281 11:115141153-115141175 CGGTGGGGAAGGAAGAGGGAAGG - Intergenic
1089383219 11:118050904-118050926 GGGTGGGGATGGATTGGGGGAGG - Intergenic
1089504350 11:118953614-118953636 GGGTGGGGAAGGTGGGGGGGGGG + Intronic
1089637357 11:119823882-119823904 AGTTGGGTAAGGATGGGGTTAGG + Intergenic
1089740587 11:120579260-120579282 GGGTGCGGAATGATGGGGGCAGG + Intronic
1090018757 11:123108565-123108587 GGGAGGAGAAGGATGGGGAAAGG + Intronic
1090092445 11:123710369-123710391 GAGTGGGTAAGAGTGGGGGATGG + Intergenic
1090662559 11:128892092-128892114 GGGAGGGCCAGGATGGGGGGCGG + Intronic
1091131099 11:133147957-133147979 GGGTGGGGAGGGATGAGAGATGG - Intronic
1091375028 12:19448-19470 GGGAGGGGGAGGATGTGGGATGG + Intergenic
1091778960 12:3201858-3201880 GGGTGGGAAAGGAGGGGTGTGGG + Intronic
1091934171 12:4422349-4422371 GGGTGGAGAAGGATGGAGAAGGG + Intergenic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092045339 12:5428484-5428506 GGGTGGGGATGGAGGGGGTAGGG + Intergenic
1092140322 12:6179214-6179236 GGATGGGGAAGGAAGGAGGAGGG - Intergenic
1092282600 12:7109013-7109035 GGGGGGGTAGGGTGGGGGGAGGG + Intronic
1092696614 12:11178319-11178341 GGGAGGGAAGGGAAGGGGGAGGG + Intergenic
1092700976 12:11230528-11230550 GGCTGGGAAGGGAAGGGGGAAGG - Intergenic
1092817350 12:12323139-12323161 GGGAGGGGAAGGGAGGGGGATGG + Intergenic
1093189226 12:16056069-16056091 GGTTGGGAAAGGTTGGGGGTGGG + Intergenic
1093567661 12:20627562-20627584 GGCTGGGAAAGGGTGGGGGTGGG - Intronic
1093591514 12:20907441-20907463 GGGAGGGGAAGGAAGGGGAAGGG - Intronic
1094485907 12:30926212-30926234 GGGCTGGTGAGGAAGGGGGATGG + Intergenic
1094493756 12:30976926-30976948 GGGTAGGAAAGGAAGGGGCAGGG + Intronic
1095526679 12:43134529-43134551 GGGTGGAAAAGAATGGGTGATGG - Intergenic
1095609033 12:44105699-44105721 GGGTGGGACAGGATGGGTGGAGG + Intronic
1095621487 12:44260745-44260767 GGGTGGGAAGGGGTGGAGGATGG - Intronic
1095648776 12:44582107-44582129 GGGTGGGTAAAGACTGGGAAGGG + Intronic
1095672419 12:44876381-44876403 GGCGGGGTAAGGAGGAGGGAGGG + Intronic
1095964745 12:47859085-47859107 GGGTGGGAGAGGAAGGGGCAGGG + Intronic
1096096917 12:48941547-48941569 GGGTAAGTAAGGTTAGGGGAGGG - Intronic
1096106481 12:48999277-48999299 GGGTGGGGCAGGATGCTGGATGG - Exonic
1096226321 12:49868939-49868961 GGGTGGGGAGGGATGGGGCTGGG + Exonic
1096239202 12:49950597-49950619 GGGTGGGCTGGGATGGGGCATGG + Intergenic
1096459767 12:51815621-51815643 TGGGGGGCAAGGATGGGGGCTGG - Intergenic
1096466383 12:51849174-51849196 CGGCGGGTAGGGGTGGGGGACGG + Intergenic
1096487803 12:51995283-51995305 GGGCGGGCAAGGAGTGGGGAGGG + Intronic
1096601650 12:52734091-52734113 AGGTGAGCAAGGATGGGGGCTGG - Intergenic
1096835795 12:54350412-54350434 GGCAGGGTAAGGATGAGGGCTGG - Intronic
1096836176 12:54352639-54352661 AGATGGGAAAGGATGGGGGAAGG + Intergenic
1096842936 12:54390423-54390445 GAGAGGGTAAGTATGGGGGATGG - Intronic
1096911592 12:54989739-54989761 GGGTAGGGAAGGAGAGGGGAGGG - Intergenic
1096977635 12:55708402-55708424 GGATGGGATAGGATGGGGGAGGG - Intronic
1097108004 12:56636381-56636403 GGGTGGGGAGGGAGGAGGGAAGG + Intronic
1097265133 12:57740025-57740047 GGGTGGGGTAAGATGGGCGAAGG + Intronic
1098002894 12:65963408-65963430 GGGTGGGGTGGGGTGGGGGAGGG + Exonic
1098028503 12:66230680-66230702 GGGTGGGGAAGGAAGGGGTCGGG + Intronic
1098309902 12:69138236-69138258 GGGAGGGTGAGGATGTGGGAAGG - Intergenic
1098550205 12:71754386-71754408 GGGAATGGAAGGATGGGGGAAGG + Intergenic
1098790674 12:74817666-74817688 GGGTGAGCAAGGATGGGGTCTGG - Intergenic
1099034871 12:77573727-77573749 GGGTGGGTAAAGAGGGAGGGAGG + Intergenic
1099329827 12:81269914-81269936 GAGGGGGAAAGGGTGGGGGATGG + Intronic
1099422877 12:82484979-82485001 GGGTGAGAAAGGGTGGGGGCAGG + Intergenic
1099442557 12:82715729-82715751 GGGATGGTAGGGATGGGGTAGGG + Intronic
1099732744 12:86526142-86526164 TGGTTGCTCAGGATGGGGGAGGG + Intronic
1099970065 12:89491112-89491134 GGGTGGGTGGGGATGTAGGAGGG - Intronic
1100125123 12:91415480-91415502 GTGTGTGTAAGAATGGAGGAAGG + Intergenic
1101093648 12:101313743-101313765 GGGAGGGAAGGAATGGGGGAGGG + Intronic
1101321631 12:103678079-103678101 AGGTGGGGATGGATGGGGGAAGG - Intronic
1101640233 12:106581954-106581976 GGGTGGGGAGGGCAGGGGGAGGG + Intronic
1101834617 12:108286621-108286643 GGGTGGGCACGGATGTGGTAAGG - Intergenic
1102012019 12:109624590-109624612 GGGAGGGTACACATGGGGGAGGG + Intergenic
1102027404 12:109721350-109721372 GGGTTGGGAGGGGTGGGGGAAGG - Intronic
1102561043 12:113762526-113762548 GGGTGGGGAGGGAGGGGGGCCGG - Intergenic
1102687138 12:114734057-114734079 GGGTGGGTCAGAAGGAGGGAAGG - Intergenic
1103039568 12:117684166-117684188 GGGTGGGTCAGGATGAGGAAAGG - Intronic
1103175170 12:118857152-118857174 AGGTGGGGAAGGATGGGAGGAGG - Intergenic
1103238903 12:119397787-119397809 GGGTGGGGCAGGGTGGGGAAGGG + Intronic
1103238959 12:119397884-119397906 GGGTGGGGGAGGAAGGGGGCAGG + Intronic
1103238970 12:119397905-119397927 GGGTGGGGAAGGAAGGGGGCGGG + Intronic
1103341095 12:120221563-120221585 GGGAGGAGAAGGATGAGGGAGGG + Intronic
1103425457 12:120830292-120830314 GGAGGGGGAAGGAGGGGGGAGGG + Intronic
1103437348 12:120937127-120937149 GGGTGGGTAATGAGGTTGGAAGG + Intergenic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1103589403 12:121980585-121980607 GGGAGGCTAAGGAGGGTGGATGG - Intronic
1103979441 12:124726937-124726959 GGGTGGGTTCTGGTGGGGGAGGG - Intergenic
1104045581 12:125160308-125160330 GGGTGGGTAGGGATGGGGATGGG + Intergenic
1104372610 12:128237132-128237154 GGGTGGGTGGGGAGTGGGGAGGG - Intergenic
1104678099 12:130729438-130729460 GGGTGGGGGAAGGTGGGGGAGGG - Intergenic
1104715113 12:131011177-131011199 AGGTGGGGAAGGGTGGGGCAGGG - Intronic
1104819737 12:131668780-131668802 GGGTGAGTGGGGATAGGGGAAGG - Intergenic
1104836619 12:131795965-131795987 GGGAGGGGAGGGATAGGGGAGGG + Intronic
1104842650 12:131832162-131832184 GGGGGGGAAGGGAAGGGGGAAGG + Intronic
1105323617 13:19350440-19350462 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1105334802 13:19457515-19457537 GGGAGGGAGGGGATGGGGGAAGG - Intronic
1105577706 13:21669407-21669429 GGGTGGGAAAGGAAGAGGGGAGG + Intergenic
1105835079 13:24203122-24203144 GGGAGGGAGGGGATGGGGGAAGG - Intronic
1105860116 13:24401876-24401898 GGGAGGGAGGGGATGGGGGAAGG + Intergenic
1105870329 13:24499057-24499079 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1106065465 13:26344032-26344054 GGGAGGGTGAGGTTGGGGGAAGG - Intronic
1106220054 13:27739039-27739061 GGCTGGGAACGGTTGGGGGAAGG + Intergenic
1106408092 13:29491232-29491254 GGTGCTGTAAGGATGGGGGAGGG + Intronic
1107489052 13:40862730-40862752 GGGAGGGCAGGGGTGGGGGAAGG - Intergenic
1107767855 13:43756517-43756539 GGGAGGGAAAGGAGAGGGGAGGG + Intronic
1107835485 13:44409597-44409619 AGGTGGGCAAGGCTGAGGGAAGG + Intergenic
1108250308 13:48560307-48560329 CAGGGGTTAAGGATGGGGGAGGG + Intergenic
1108750110 13:53439847-53439869 GGGAAGGTGGGGATGGGGGAGGG - Intergenic
1108952075 13:56106987-56107009 GGGTGGGTAGGGGTTGGGGGTGG - Intergenic
1108972013 13:56388322-56388344 GAGTGGGTAGGGATGGAGAAAGG - Intergenic
1110009354 13:70312353-70312375 GTCTGGGGAGGGATGGGGGAGGG + Intergenic
1110247368 13:73342055-73342077 GGGTGGGAAAGGATGGGGGAGGG - Intergenic
1110347326 13:74463809-74463831 GAGTGGGCAAGAATCGGGGAAGG + Intergenic
1110451558 13:75642363-75642385 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1111040472 13:82740738-82740760 GGATGGGTAAACCTGGGGGACGG + Intergenic
1111165199 13:84448599-84448621 GGGGGGGTGGGGATGGGGGTGGG + Intergenic
1111479099 13:88798800-88798822 GTGTGGGCAAGGTTGGGGGCCGG - Intergenic
1112437275 13:99399459-99399481 TGGTGGGCATGGGTGGGGGACGG - Intergenic
1112477678 13:99747271-99747293 GGGTGGATAAGAAAGTGGGAGGG - Intronic
1112886741 13:104183188-104183210 GGGTGTGTGGGGCTGGGGGAGGG - Intergenic
1113300409 13:109013105-109013127 GGGTGGGGGGGGGTGGGGGAGGG - Intronic
1113329960 13:109317991-109318013 GGGTGGGTCAGGGTGGGGGTAGG - Intergenic
1113453744 13:110432373-110432395 TGGGGGGTGAGGATGAGGGAAGG + Intronic
1113627473 13:111857568-111857590 TGGTGGTTAGGGATGGGGAACGG + Intergenic
1113670124 13:112170687-112170709 AGGTGGTTATGGCTGGGGGAGGG - Intergenic
1113909815 13:113836564-113836586 GGGTGGGGAGGGGTGAGGGAGGG + Intronic
1113909827 13:113836586-113836608 GGGTGGGGAGGGGTGAGGGAGGG + Intronic
1113966359 13:114155694-114155716 GGGTGGGGAGGGGTGGGGGCCGG + Intergenic
1113966494 13:114156012-114156034 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1113966577 13:114156212-114156234 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1113966596 13:114156249-114156271 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1113966621 13:114156308-114156330 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1113966640 13:114156345-114156367 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1113966656 13:114156379-114156401 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1113975642 13:114225556-114225578 GGGAGGGGAGGGAGGGGGGATGG + Intergenic
1114464359 14:22910497-22910519 GGGGGGGAAAGGAAGGGAGAAGG + Intronic
1114710640 14:24774561-24774583 GGGTATGTAATGATGGGGCAGGG + Intergenic
1115106091 14:29763415-29763437 GGGAGGGGAAGGGAGGGGGAGGG + Intronic
1115135045 14:30097740-30097762 GGGTGAGAAAGAATTGGGGATGG + Intronic
1115181776 14:30635421-30635443 GGATGGAAGAGGATGGGGGAGGG - Intronic
1115330167 14:32188526-32188548 GGGTGGCTAAGGTGGGAGGATGG + Intergenic
1115399597 14:32941251-32941273 GGGAGGGGAAGGAGGGAGGAGGG - Intronic
1115611253 14:35050636-35050658 GGGTGGGATAGGGTGGGGCATGG + Intronic
1115667165 14:35563450-35563472 ATGAGGGTAAAGATGGGGGATGG + Intronic
1116713921 14:48404781-48404803 GGCTGGGAAAGGTAGGGGGAGGG - Intergenic
1116829690 14:49706103-49706125 GGGTGGGTAGGGATGGCTAATGG - Intronic
1117105499 14:52393998-52394020 GGGTTGGGAAGGATGGGGCATGG - Intergenic
1117105646 14:52394931-52394953 GGGCGGGGACAGATGGGGGAGGG - Intergenic
1117414169 14:55478458-55478480 GGGAGGGTAAGGCTGGAGAATGG + Intergenic
1117573482 14:57073555-57073577 GTGTTGGGAAGGTTGGGGGAAGG - Intergenic
1117893590 14:60452491-60452513 GGCTGGGAAAGGTTGGGGGCGGG + Intronic
1117955947 14:61123793-61123815 TGGTGGGGAGGGCTGGGGGAGGG - Intergenic
1118073388 14:62271094-62271116 GGGGAGGGAAGGATGGAGGATGG - Intergenic
1118157437 14:63255566-63255588 GGGAGGGTAAGGCTGGGGGGAGG - Intronic
1118171889 14:63396026-63396048 GGGAGGGGGAAGATGGGGGAGGG + Intronic
1118321876 14:64758133-64758155 GGGTGGATAGGGAGGGGTGAAGG - Intronic
1118368244 14:65113887-65113909 GGGAAGGTAAGGCTGGTGGAGGG - Intergenic
1118682979 14:68262380-68262402 GGGTGGGTGAGAAGAGGGGAAGG - Intronic
1118693436 14:68361582-68361604 TGGGGGGTAAGGATGGAGAAAGG + Intronic
1119210245 14:72826006-72826028 GGGCGGGAAAGGAAGGGGGCAGG + Intronic
1119219001 14:72891971-72891993 GTGGGGTTAAGGGTGGGGGAAGG - Intronic
1119635607 14:76270834-76270856 GGGTGGGTAGGCATGGAGGGGGG + Intergenic
1119851394 14:77869023-77869045 GGGTGGGTAAGATTTGAGGAGGG + Intronic
1119900789 14:78257932-78257954 GGGTGGGTAGTGATGGAAGAAGG + Intronic
1120033451 14:79668693-79668715 TGGTGTGTAAGGAAGGGGGCGGG + Intronic
1120844676 14:89115568-89115590 GGGTTGGCAGGGATGGAGGATGG - Intergenic
1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG + Intronic
1121186161 14:91971605-91971627 GGGTGGGAAAAGAAGGGGAAGGG + Intronic
1121230519 14:92354253-92354275 GGGTGGGTAAGGCAGGAGAATGG - Intronic
1121417736 14:93790338-93790360 GGGTGGGATAGGATGGAGGGAGG + Intergenic
1121641434 14:95487061-95487083 GGGTGGGGCAGAGTGGGGGAAGG - Intergenic
1121641662 14:95488676-95488698 GGGTGGGGAGGGAAGGGGAAGGG + Intergenic
1122129938 14:99598993-99599015 GGCTGGGGAAGGAGGGGGAAAGG + Intronic
1122234379 14:100323591-100323613 GGGAGGCTAAGGCTGGGTGAGGG + Intronic
1122415759 14:101548775-101548797 GGGGAGGAAAGGATGGGGGAGGG + Intergenic
1122879025 14:104681768-104681790 GGGCAGGTGAGGATGGGGGCTGG + Intergenic
1122900960 14:104782183-104782205 GGGTGGCCCAGGATGGGGGACGG - Intronic
1123023464 14:105412696-105412718 GGGTGGGTGGGGGTGGGGAAAGG + Exonic
1123119693 14:105910986-105911008 GGGGAGGGAAGGATGGAGGAAGG - Intergenic
1123627880 15:22239855-22239877 GAGAGGGTGAGGAAGGGGGAGGG - Intergenic
1124210620 15:27762169-27762191 GGGTGGGAGAGGGTGAGGGATGG - Intronic
1124239863 15:28020116-28020138 GGGTGGGGATGGGTGGGGGCGGG - Intronic
1124242179 15:28037805-28037827 GGGAGGGAAGGGCTGGGGGATGG - Intronic
1124632301 15:31344791-31344813 GGGTGGGGCAGGATGAGGGTGGG + Intronic
1124794749 15:32766729-32766751 GGGTGTGAGAGGATGGAGGAGGG + Exonic
1124883307 15:33661541-33661563 TGGTGGGTGAGGCTGGGGGAGGG + Intronic
1125440435 15:39696920-39696942 GTGTGTGTTGGGATGGGGGAAGG + Intronic
1125470789 15:40001429-40001451 GGGTGGGTAGGGAGGAGGAAAGG - Intronic
1125539541 15:40462029-40462051 GGGTGTCTGAAGATGGGGGACGG - Exonic
1125591285 15:40856081-40856103 GGGTGGGCATGTATGGGGGAAGG + Intronic
1125906893 15:43401144-43401166 GAGTGGATTAGGATGGGGCAGGG + Intronic
1125978424 15:43977195-43977217 GGCTGGGGAAGGATGTGGTAAGG + Intronic
1126659467 15:51018156-51018178 GGGGAGGGAAGGATGGGGAAAGG - Intergenic
1126687191 15:51258650-51258672 GGGAGGGAATAGATGGGGGAAGG - Intronic
1127077323 15:55339859-55339881 GGGTGGGGAAGGGTGAGAGAGGG + Intronic
1127338912 15:58020625-58020647 GGGTGGGTCAAGCTGGAGGACGG - Intronic
1127362732 15:58259322-58259344 GGGTGGGGAGGGGTAGGGGAGGG + Intronic
1127482790 15:59392476-59392498 GAGTGGGAAGGGATGTGGGAGGG + Intronic
1127574482 15:60277297-60277319 AGGTGGGAAAGGATGGGAGAGGG + Intergenic
1127655431 15:61051154-61051176 GGGTGTGGAAGGATGGCAGAAGG + Intronic
1127847953 15:62887899-62887921 GGGTGGGTTTGGGTCGGGGAGGG - Intergenic
1127918017 15:63471390-63471412 GGGTGGGAAAAGGTGGGGAATGG + Intergenic
1128054429 15:64689236-64689258 GGGTTGGTAGGGGTGGGGGTGGG - Intronic
1128065370 15:64761285-64761307 AGTTGGGGAAGGATGTGGGAGGG - Intronic
1128253543 15:66180414-66180436 GGCTGGCTCAGGATGGGGTATGG - Intronic
1128576748 15:68781373-68781395 GGGGGGGTGGGGATGGGGGAGGG - Intronic
1128609365 15:69061697-69061719 GGGTGGCTAAGGTTGGAGGCTGG - Intronic
1128799410 15:70488117-70488139 GGGACGGTGAGGATGGGGGGTGG - Intergenic
1128834113 15:70795238-70795260 GGGAGGGTGGGGATGGGAGATGG + Intergenic
1130886395 15:88096223-88096245 GGGCTGGTCAGGATTGGGGATGG - Intronic
1131009719 15:89006993-89007015 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131143090 15:89993489-89993511 GGATGGGGAAGGAGGGGGCAGGG - Intergenic
1131203250 15:90418905-90418927 GGGAGGGTAAGGCAGGTGGATGG + Intronic
1131634251 15:94213174-94213196 GGGGGAGTAGGGAGGGGGGAGGG + Intergenic
1131793337 15:95988400-95988422 GGGAGGGGAAGGAAGAGGGAGGG + Intergenic
1131841844 15:96445709-96445731 CGGTGGGGAGGGATGAGGGAAGG + Intergenic
1132010298 15:98268978-98269000 GGGAGGGCAGGGATGGGGGTAGG + Intergenic
1132299490 15:100767313-100767335 GGGGGGACAAGGATGAGGGAAGG - Intergenic
1132451543 15:101971526-101971548 GGGAGGGGGAGGATGTGGGATGG - Intergenic
1132455347 16:19102-19124 GGGAGGGGGAGGATGTGGGATGG + Exonic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132499401 16:278709-278731 GAGTGGGTAAGGATGGGGAGAGG - Intronic
1132550957 16:553668-553690 GGGAGGGGAAGGAGGGGGGCGGG - Exonic
1132647272 16:1004880-1004902 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647318 16:1005015-1005037 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647334 16:1005059-1005081 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132671623 16:1104273-1104295 GGGAGGGGAAGGAAAGGGGAAGG + Intergenic
1132709092 16:1258667-1258689 GAGGGGCTCAGGATGGGGGAGGG - Exonic
1132719261 16:1307922-1307944 GGGTGGGAATGAATGAGGGAGGG + Intergenic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1132841186 16:1979183-1979205 GGGTGGGCACGGTGGGGGGAGGG + Exonic
1132966181 16:2656015-2656037 AGGAGGCTAAGGCTGGGGGATGG + Intergenic
1132989803 16:2786871-2786893 GAGGGGGTGAGGATGGGGGAGGG - Intronic
1132989812 16:2786889-2786911 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989824 16:2786925-2786947 AGGGGGGTGAGGATGGAGGAGGG - Intronic
1132989873 16:2787083-2787105 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989892 16:2787148-2787170 GGAGGGGTGAGGATGAGGGAGGG - Intronic
1132989916 16:2787217-2787239 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989948 16:2787320-2787342 GGGGGGTGAAGGATGGAGGAGGG - Intronic
1132989961 16:2787353-2787375 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989989 16:2787441-2787463 GAGGGGTGAAGGATGGGGGAGGG - Intronic
1133083037 16:3338640-3338662 GGGAGGGTGAGGAAGGGGAATGG - Intergenic
1133323015 16:4925955-4925977 GGTTGGGTAAGGATTAGTGATGG + Intronic
1133589693 16:7230076-7230098 GGGAGGGGAAGGAAAGGGGAGGG + Intronic
1133755236 16:8757662-8757684 GGGTTGGAAAGGAAGGGAGAGGG + Intronic
1134011229 16:10854637-10854659 GGCTGGGTGAGGATGAAGGATGG + Intergenic
1134790488 16:16985145-16985167 GGATGGGGAAGGAGAGGGGAAGG - Intergenic
1134803608 16:17106985-17107007 GGGTGGGAAAAGATGGGAAAAGG + Exonic
1136006146 16:27330695-27330717 GGGTGGGTCAGGAAGGGAGTTGG - Intronic
1136007112 16:27338456-27338478 GGGAGGCTAAGGAGGGAGGATGG - Intronic
1136081307 16:27854215-27854237 GGATGGGAAAGGCTGGGGAATGG + Intronic
1136228499 16:28873905-28873927 GGGTCAGGAAGCATGGGGGAGGG - Exonic
1136240045 16:28937985-28938007 TTGGGGGTCAGGATGGGGGATGG - Intronic
1136512660 16:30748669-30748691 GGGTGGGGGGGGGTGGGGGAAGG - Intronic
1137389051 16:48066472-48066494 GCTTGGGGAAGGATTGGGGAGGG - Intergenic
1137751392 16:50863506-50863528 GGGTGGGAGAGGGTGGGAGAGGG + Intergenic
1137824082 16:51474968-51474990 GGGAGGGGAAGGGAGGGGGAAGG - Intergenic
1138066420 16:53946066-53946088 TGGTGGAGGAGGATGGGGGAAGG + Intronic
1138281153 16:55773100-55773122 GGATGGGGAGGGATGGGGCAGGG + Intergenic
1138504833 16:57473074-57473096 TGGTGGGGAAGGATGGGGTGAGG + Exonic
1138531542 16:57637119-57637141 GGTGGCGTAAGGCTGGGGGACGG + Intronic
1138618083 16:58188036-58188058 GGGTGGGGAAGGGGAGGGGAGGG + Intronic
1138710931 16:58969793-58969815 GGGAGGGTAGGGTAGGGGGAAGG + Intergenic
1138736760 16:59259877-59259899 GGGTGGGGTGGGATGGGGGGTGG + Intergenic
1139474249 16:67194655-67194677 GGGTGGTAAGGGATGGGAGATGG - Intronic
1139527614 16:67526439-67526461 GGGTGGGCATGGTAGGGGGAGGG + Intronic
1139701551 16:68710959-68710981 GGGAGGGGAAGGAGGGGGGAGGG + Intronic
1140094024 16:71859973-71859995 GGGTGGGTAGGTAGGTGGGAAGG + Exonic
1140241264 16:73203077-73203099 GGCTGTGTGAGCATGGGGGAGGG - Intergenic
1140328664 16:74030544-74030566 GGGTGGGCCAGGGTGGGGGAGGG + Intergenic
1140452063 16:75079019-75079041 GGGTAGATAAGAATGGGAGAAGG - Intronic
1140564225 16:76022314-76022336 GGATGGGTCAGGGTGAGGGAGGG + Intergenic
1140626925 16:76805033-76805055 AGGTGGGGCAGGATGGGGGAGGG + Intergenic
1140826908 16:78715460-78715482 CGGTGGGTAGGGGTGGGGGTGGG - Intronic
1141051932 16:80774392-80774414 GGGTGGGGGAGGATGGGGGAAGG + Intronic
1141112630 16:81282641-81282663 GGGTGAGCAGGGATGGGGGTTGG - Intronic
1141281206 16:82631353-82631375 GGGTGGTTATGTAAGGGGGAAGG - Intronic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1141585945 16:85033665-85033687 GTGGGGGCAGGGATGGGGGAGGG + Intronic
1141724042 16:85774543-85774565 GGGTGAGCAAGAATGGGGAAGGG + Intronic
1141973045 16:87495738-87495760 GGGTGGGGGAGGGTGGGGGTTGG - Intergenic
1142225505 16:88875337-88875359 GGGTGGGCAGGGCTGGAGGATGG + Exonic
1142234735 16:88916647-88916669 GGCTGGGTGGGGAAGGGGGATGG + Intronic
1142251433 16:88993745-88993767 GGGAGGGAGAGGAGGGGGGAGGG - Intergenic
1142340447 16:89518765-89518787 TAGGGGTTAAGGATGGGGGAAGG + Intronic
1142478632 17:204623-204645 GGGTGAGGATGGTTGGGGGATGG - Intergenic
1142787205 17:2233647-2233669 GGGTGGAGAAGGAGGGGGGTTGG - Intronic
1142802946 17:2356615-2356637 CGGGGTGTAAGGATTGGGGAAGG + Intronic
1142802976 17:2356714-2356736 CGGGGTGTAAGGATTGGGGAAGG + Intronic
1142803006 17:2356813-2356835 CGGGGTGTAAGGATTGGGGAAGG + Intronic
1142803020 17:2356862-2356884 CGGGGTGTAAGGATTGGGGAAGG + Intronic
1142867305 17:2798650-2798672 GGGTGGGATGGGATGGGAGAGGG + Intronic
1143166148 17:4898121-4898143 GGGTGGGGAAGAAAGGGGCAGGG + Exonic
1143473428 17:7190370-7190392 GTGTGGGAGAGGATGGGGGAGGG + Exonic
1143478760 17:7217257-7217279 GGGGGGGCCAGGATGGGGGGAGG + Intronic
1143631639 17:8143457-8143479 GGGCGGGCAAGGATGGAGAAGGG + Exonic
1143687737 17:8532554-8532576 TGGTGGGCAAGGATGGAGGTGGG - Intronic
1143712696 17:8745114-8745136 GTGTGGGTGAGGGTGAGGGAGGG + Intronic
1143858301 17:9869212-9869234 GTGAGGGTAAGGCTGGAGGAGGG - Intronic
1144218573 17:13079646-13079668 GGGTGTGGTAGGATGTGGGAAGG - Intergenic
1144248867 17:13395721-13395743 GGATGGGAAAGGAAGGAGGAAGG - Intergenic
1144250945 17:13416162-13416184 GCTTGGGTTTGGATGGGGGAGGG - Intergenic
1144462010 17:15466049-15466071 GGGAGGGAAAGGGAGGGGGAGGG + Intronic
1144877719 17:18411124-18411146 GGGTCGGGAAGGAGAGGGGAGGG - Intergenic
1145154502 17:20533264-20533286 GGGTCGGGAAGGAGAGGGGAGGG + Intergenic
1146590270 17:34122722-34122744 GGGTGGGTGTGAGTGGGGGAGGG - Intronic
1146631290 17:34471677-34471699 GGGTGGGTGGGGAGGAGGGAGGG - Intergenic
1146663718 17:34682679-34682701 GAGTGGGAAAGGGTGTGGGAAGG - Intergenic
1147119155 17:38325454-38325476 GGGCGGGGAGGGGTGGGGGAGGG + Intergenic
1147212031 17:38877424-38877446 GGGTGGGAGAGGATGAGGGAAGG + Intronic
1147239429 17:39080822-39080844 AGGTTGGTCAGGCTGGGGGAAGG - Intronic
1147316265 17:39621891-39621913 GTGTGTGTAAGGCTGGTGGAGGG + Intergenic
1147423461 17:40334090-40334112 GGATGGGCAAGGATGGGGCCAGG - Intronic
1147428501 17:40357418-40357440 GGGTGGGACAGGTTGGGGGTGGG - Intronic
1147488435 17:40841092-40841114 GGGTGGGGAAAAATGGAGGATGG + Intergenic
1147514332 17:41101694-41101716 GGGTGGGGAAGGGAAGGGGAGGG + Exonic
1147617408 17:41837699-41837721 GGGGTGGTAAGGAGGGGAGAAGG + Intronic
1147662605 17:42125081-42125103 GGGTGGGTAAGGGGGGGAGTGGG - Intronic
1147704024 17:42413719-42413741 GGCTGGGGAAGGATTGGAGATGG - Intronic
1148027727 17:44600140-44600162 GGCTGGGGGAGGAAGGGGGAGGG - Intergenic
1148201618 17:45753365-45753387 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148201625 17:45753396-45753418 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148201633 17:45753427-45753449 GTGTGCGCATGGATGGGGGAGGG + Intergenic
1148201641 17:45753458-45753480 GTGTGCGCATGGATGGGGGAGGG + Intergenic
1148201648 17:45753489-45753511 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148246116 17:46032001-46032023 GGGTTGGCATGGTTGGGGGATGG - Intronic
1148256719 17:46140056-46140078 GGATGGGTTGGGATGGAGGAAGG - Intronic
1148555927 17:48578536-48578558 GGGTGGGTGGGGAGGGGGAAGGG - Exonic
1148592586 17:48827720-48827742 GGGTTGATTAGGATGGGGTAAGG + Intergenic
1148868413 17:50641281-50641303 GTGTGGGTGATGGTGGGGGAGGG + Intronic
1148896549 17:50842369-50842391 GTTTGGGTTATGATGGGGGAGGG + Intergenic
1148960068 17:51385361-51385383 GTGAGGGGAAGGATGGCGGATGG - Intergenic
1149492794 17:57097188-57097210 GGGTGGGTAGGGAGGGGGACAGG - Intronic
1150002045 17:61447061-61447083 TGTAGTGTAAGGATGGGGGAGGG + Intergenic
1150265289 17:63828236-63828258 GGAAGGGTGATGATGGGGGATGG + Intronic
1150273694 17:63882513-63882535 GGGTGGGTGTGGGTGTGGGAGGG + Intergenic
1150842573 17:68622540-68622562 GGATGGGTTAGAATGGAGGAAGG + Intergenic
1150865865 17:68849396-68849418 GTGTGGGGAAGGGTGGGGAAAGG + Intergenic
1151221395 17:72615509-72615531 GGGAGGGGAAGGATGGAGGGAGG + Intergenic
1151475369 17:74342022-74342044 GTGGGGCTAAGGGTGGGGGAGGG - Intronic
1151617822 17:75225843-75225865 GGGTGGGCAAGGGTGGGGGTAGG + Intronic
1151667922 17:75556184-75556206 GGGTGGGTGAGATTTGGGGAGGG + Intronic
1152136893 17:78509686-78509708 GGTTGGGGATGGGTGGGGGATGG - Intronic
1152179002 17:78806210-78806232 GGGTGGGTGAGGTCGGAGGATGG + Exonic
1152430698 17:80246914-80246936 AGGAGGGTAGGGATGGGGGCAGG - Intronic
1152467671 17:80475242-80475264 GAGTGTGTCTGGATGGGGGAGGG + Intronic
1152569752 17:81116466-81116488 GGTTGGGTAAGGAGGAGGGCTGG - Exonic
1152754981 17:82083470-82083492 GGGTGGGCATGGATGGGTGTGGG - Intronic
1152764870 17:82130814-82130836 GGGGGGGTGGGGGTGGGGGACGG + Intronic
1152823294 17:82448217-82448239 TGGTGGGTAGCGATGGAGGACGG + Intronic
1152841418 17:82571085-82571107 GGGTGGGTAAGGCTGGCTGAGGG - Intronic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1153277130 18:3378516-3378538 GGGAGGCCAAGGATGGAGGATGG - Intergenic
1153330379 18:3867470-3867492 GGGTGGGGAAGGAAGGAGGAGGG + Intronic
1153550712 18:6258811-6258833 GGGTGGGAGAGGGTGGAGGAGGG + Intronic
1153806422 18:8712125-8712147 GGGTGGGTGAGGATTGGGGTGGG + Intronic
1154031210 18:10755924-10755946 TGGGGGATAAGGATGAGGGATGG + Intronic
1154475731 18:14755540-14755562 GTGAGGGGAAGGAAGGGGGAGGG - Intronic
1155428981 18:25735869-25735891 CGGAGGGTGAGGATGGGGCAGGG - Intergenic
1155551781 18:26972705-26972727 GGGAGGGTAAAGATGGAGGCAGG + Intronic
1155650427 18:28134350-28134372 GTGGGGGAAAGGCTGGGGGAAGG - Intronic
1155710735 18:28875519-28875541 GTGTGGGTCAGGAAGGGGGAAGG - Intergenic
1156217385 18:35013668-35013690 GGCTGGGAAGGGTTGGGGGAAGG - Intronic
1156401628 18:36745070-36745092 AGGTGGGGAAGGATGTGGGTTGG + Intronic
1156455181 18:37289167-37289189 GGGTGAGAAGGGATGGGGGCTGG + Intronic
1156474582 18:37397552-37397574 GGGTGGGGAGGGATGGAGGCTGG + Intronic
1157196837 18:45626596-45626618 GGGTGGGGAAGGTGGGGGGGTGG - Intronic
1157340546 18:46774007-46774029 GGGAGGGTGAAGAGGGGGGAAGG - Intergenic
1157806980 18:50665507-50665529 GGGTGGGTCATGAAAGGGGAGGG + Intronic
1158013579 18:52757482-52757504 GGGTGGGTAGGTGTGGGGAAGGG - Intronic
1158357647 18:56638626-56638648 GGGCGGGGAGGGATGGGGGAGGG + Exonic
1158437197 18:57441958-57441980 GGGTGGGAAGGGGTGGGGCAGGG - Intronic
1158980106 18:62751742-62751764 GGGAGGGGAAAGATGAGGGAAGG + Intronic
1159516968 18:69470603-69470625 GGGTGGGGAAGAAAGGGGCAGGG - Intronic
1159624700 18:70679068-70679090 GGGAGGGCAAGGAGAGGGGAGGG - Intergenic
1159916041 18:74188778-74188800 AGGTGGGGAAGGCTGGAGGAGGG - Intergenic
1159918260 18:74204691-74204713 GGGTGGGAGAAGAAGGGGGATGG + Intergenic
1159918277 18:74204735-74204757 GGATGGGTGAGGGTGGGAGAAGG + Intergenic
1159918288 18:74204762-74204784 GGATGGGTGAGGGTGGGAGAAGG + Intergenic
1159918303 18:74204799-74204821 GGGTGGGAGAAGAAGGGGGATGG + Intergenic
1159933388 18:74337990-74338012 GGTTGGTTAAGAATGGGGTAAGG + Intronic
1160377366 18:78423162-78423184 GGGTGGGTAGCCCTGGGGGAGGG + Intergenic
1160382664 18:78472405-78472427 GGGCAGGTGATGATGGGGGAAGG - Intergenic
1160461642 18:79043411-79043433 GTGGGGGTTGGGATGGGGGATGG - Intergenic
1160461667 18:79043459-79043481 GTGAGGGTTGGGATGGGGGATGG - Intergenic
1160633719 19:61021-61043 GGGAGGGGGAGGATGTGGGATGG + Intergenic
1160665171 19:324781-324803 GGGTGAGTCAGGGTGGGGAAAGG + Intronic
1160762369 19:791943-791965 GGGTGGGGAAGGATGGGTCTGGG + Intergenic
1160824793 19:1074567-1074589 GGGTGGGGAGGGATGGAGGCAGG - Intronic
1160931089 19:1569756-1569778 GGGTGTGTGAGGCGGGGGGAGGG - Intergenic
1160950233 19:1663347-1663369 GGGAGGCTAAGGATGGAGGATGG - Intergenic
1160965666 19:1746014-1746036 GGAGGGGGAAGGAGGGGGGAAGG + Intergenic
1161139612 19:2639749-2639771 GGGGGAGGAAGGAGGGGGGAAGG + Intronic
1161307884 19:3577614-3577636 GCGTGGGGAGGGATGGGTGACGG - Intronic
1161604821 19:5208816-5208838 GGATGGCAAAGGATGGAGGATGG - Intronic
1161821538 19:6533547-6533569 GGAGGGGGAAGGAAGGGGGAAGG - Intronic
1161846388 19:6713827-6713849 GGGTGGGGAAGGTGGGGGGCTGG - Intronic
1161981219 19:7631434-7631456 GGGTGGGACAGGAAGGGGGGAGG - Intronic
1161988309 19:7669749-7669771 GGCTAGGGGAGGATGGGGGAGGG + Intronic
1161997808 19:7724784-7724806 GGGTGGCTTAGGATGGGTGCTGG + Intergenic
1162152080 19:8653816-8653838 GGGTGGGAAAGGTTGGGAGGCGG + Intergenic
1162450807 19:10753392-10753414 GGGGGGGAAGGGAAGGGGGAGGG - Intronic
1162551269 19:11359753-11359775 GGGCCGGTAAGGGTGGGTGAGGG + Intronic
1162697170 19:12485313-12485335 GGGAGGGAAGGGATGGGTGACGG - Intronic
1162814248 19:13183757-13183779 AGCTGGGCAGGGATGGGGGAGGG - Intergenic
1162830662 19:13282318-13282340 GGGAGGGAAGGGTTGGGGGAGGG + Intronic
1162919093 19:13889884-13889906 GGATGGGTAGGGAAGGGGAAGGG - Exonic
1163122380 19:15225816-15225838 GGGTGGGGATGGGTGGGGGGTGG - Intergenic
1163168013 19:15510877-15510899 GGGAGGCTAAGGCTGGAGGATGG + Intronic
1163363924 19:16865684-16865706 GGGAGGGGAGGGAAGGGGGAAGG - Intronic
1163635828 19:18436930-18436952 GGGTGGGGCGGGATGGGAGATGG - Intronic
1163717204 19:18879480-18879502 AGGTGGGCAAGGATGGGATAAGG - Intronic
1163732119 19:18955252-18955274 GGATGGGGATGGATGGGGGATGG - Intergenic
1163738950 19:18998996-18999018 GGGTAGGGAAGGAAGGGGAAAGG + Intronic
1163845395 19:19635607-19635629 GGGTAGGTCAGGATGGGACAGGG - Intronic
1164392714 19:27839883-27839905 GGGTAGGGGAGGAAGGGGGAGGG - Intergenic
1164508676 19:28880042-28880064 GGCTGGGAAGGGTTGGGGGAGGG - Intergenic
1164624163 19:29715385-29715407 GGGTGGGCCAGGACCGGGGAGGG - Intronic
1164782725 19:30906530-30906552 GGGAGGGTAAGGAAGGGGAGGGG + Intergenic
1164926643 19:32135833-32135855 AGGTGGGGAAGGCTGAGGGAAGG + Intergenic
1165886830 19:39084511-39084533 GGGTGGGTACAGATGGGGGAAGG + Intronic
1165900715 19:39168039-39168061 GGGTGGTCAGGGCTGGGGGACGG - Intronic
1166305099 19:41932881-41932903 GTGAGGGAAAGGATGGGCGAGGG + Intergenic
1166343113 19:42150418-42150440 GGGTGGAGAGGGCTGGGGGAGGG + Intronic
1166392894 19:42419698-42419720 GGGTGGGGGTGGATGGGGGATGG + Intronic
1166630943 19:44407141-44407163 GGGGAGGGAAGGATGGGAGAGGG + Intergenic
1166887975 19:45973196-45973218 GGGGGGGAAAGGATGGAGAAAGG + Intronic
1166890275 19:45987554-45987576 AGGTGGGCAAGGTTGGAGGAGGG - Intergenic
1166893139 19:46006758-46006780 GGGTGGGAGAGGATGTGGGTAGG + Intronic
1166973510 19:46588424-46588446 GGGTGGGAAGGGATAGGGGGAGG - Intronic
1166975322 19:46602031-46602053 GGGTGGGGGAGGGTGGGGGAGGG + Intronic
1167004437 19:46766497-46766519 GGGTGGGTGAGGGTGGGGGCAGG + Intronic
1167022333 19:46887189-46887211 GGGTTGGTGAAGATGGGGGGTGG + Intergenic
1167217159 19:48172126-48172148 GGGTGGGTGTGGGTGGGAGACGG + Intronic
1167245206 19:48369108-48369130 GGGGGGGTAGGGACGGTGGAAGG - Intronic
1167368015 19:49064872-49064894 GGGTGGGGAGGGACGGGGGCGGG - Intronic
1167417910 19:49386776-49386798 GGGAGGGGAAGGGAGGGGGAAGG + Intergenic
1167517603 19:49932503-49932525 GGTTGGGGAAGGTTGGGGGAGGG - Exonic
1167663473 19:50810244-50810266 GGGTGGGTTGGGATGGGGATGGG + Intergenic
1167752172 19:51387792-51387814 TGGTGGGTAAGGAAGGGGCTAGG + Intronic
1168277140 19:55284495-55284517 GGGTGGGTGGGGGTGGGGGTGGG - Exonic
1168416815 19:56174499-56174521 GGATGAGAAAGGATGGGGTAAGG + Intergenic
1202631919 1_KI270706v1_random:7986-8008 TGGTGTGGAAGGAGGGGGGAGGG - Intergenic
1202683837 1_KI270712v1_random:31284-31306 GGGGGGGGAGGGGTGGGGGAGGG - Intergenic
1202694725 1_KI270712v1_random:115744-115766 GGATGGGCAAGGATGGGCAAGGG - Intergenic
925200978 2:1967709-1967731 GGGTGGAAGAGGATGGGGGGAGG + Intronic
925348848 2:3187799-3187821 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
925348883 2:3187887-3187909 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
925452295 2:3980019-3980041 GGGAAGGGAAGGATGAGGGAGGG - Intergenic
925508895 2:4602699-4602721 GGGTGGGGTAGGGTGGGGGGAGG - Intergenic
925996302 2:9296325-9296347 CCGTGGGTAGGAATGGGGGAGGG - Intronic
926066463 2:9843907-9843929 GGGTGGGTGAGGGAGGGGCAGGG + Intronic
926145881 2:10396951-10396973 GGGTGGGTGAGGACTGAGGATGG + Intronic
927079573 2:19614040-19614062 GGGTGGGGAGGGATGAGGCAAGG - Intergenic
927381228 2:22481394-22481416 AGGTGGGTAAAGATGTGGGAAGG + Intergenic
927566623 2:24119178-24119200 AGGTGGGGCAGGATAGGGGAGGG - Intronic
927887329 2:26726774-26726796 GGGTGGGCCAGGGTGGGGGCGGG + Intronic
929248376 2:39726806-39726828 GGGTGGGTAAGGAAGGGCCCTGG + Intergenic
929610260 2:43265789-43265811 GAGTGGGTCAGGGTGGGGAATGG - Intronic
929868489 2:45737894-45737916 GGGGTGCTAAGGTTGGGGGAGGG - Intronic
930084032 2:47480146-47480168 GGAAGGGAAGGGATGGGGGATGG - Intronic
930164121 2:48187118-48187140 TGGTGGGTTGGGATGGGGAAGGG - Intergenic
930234737 2:48877700-48877722 GGGTGGGTAAGCAGAGAGGAAGG - Intergenic
930380463 2:50621659-50621681 GGGTGGGCCAGGGTGGAGGAGGG - Intronic
930752226 2:54945135-54945157 GGGTAGGGAGGGATGAGGGAGGG - Intronic
931145568 2:59513006-59513028 GGGTGGAAAGGGATGGAGGATGG + Intergenic
931489176 2:62725666-62725688 GGTTGGTGGAGGATGGGGGATGG + Intronic
931726535 2:65117053-65117075 TGGTGGGTGGGGGTGGGGGAAGG - Intronic
932092713 2:68820720-68820742 GGGTGGGTGGGGATACGGGAGGG - Intronic
932297467 2:70638926-70638948 GGGTGGGGAAGGATGGGACAGGG + Intronic
932408767 2:71532494-71532516 GGGTGGAACAGGATGGGGGAAGG + Intronic
932411247 2:71549297-71549319 GGGTGGGCATGGCTGGGAGAAGG - Intronic
932542704 2:72672796-72672818 GGCTGGGATAGGTTGGGGGATGG + Intronic
932621053 2:73265185-73265207 GGGTGGGCAAGTCTGGGGAAAGG + Intronic
932689065 2:73897066-73897088 GGGTGGGGAAGGCAGGGGGAAGG - Exonic
932760388 2:74435922-74435944 GGGTGGATGGTGATGGGGGAAGG - Intronic
932809561 2:74812850-74812872 GGGTGGCTAAGGTAGGAGGACGG + Intergenic
933044805 2:77521942-77521964 GGGGGGATAGGGATGGGGGAGGG + Intronic
933244945 2:79964751-79964773 GGGTGGGGAAGAATGAGGGTTGG - Intronic
933980220 2:87543159-87543181 GGGTGGGTAGGGTGAGGGGAGGG + Intergenic
934275896 2:91572792-91572814 GGATGGGCAAGGATGGGCAAGGG - Intergenic
934732025 2:96665462-96665484 AGCTTGGCAAGGATGGGGGATGG - Intergenic
934759142 2:96843949-96843971 CAGTTGGTAAGGATGTGGGACGG - Exonic
934943180 2:98517088-98517110 GGGTGGGTACTGACTGGGGAGGG - Intronic
935303919 2:101718583-101718605 GGGAGTGGAAGGGTGGGGGATGG + Intronic
935308461 2:101759765-101759787 GAGGGGGAGAGGATGGGGGAAGG - Intronic
935592485 2:104855380-104855402 GGGCGGGGAAGGAGGGGGGGAGG + Intergenic
936313606 2:111407632-111407654 GGGTGGGTAGGGTGAGGGGAGGG - Intergenic
936404319 2:112188530-112188552 GGGTGTGGTAGGATGGGGTATGG + Intergenic
936484363 2:112913893-112913915 GCGAGGGTGGGGATGGGGGATGG + Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936567755 2:113593992-113594014 GGGAGGGGGAGGATGTGGGATGG - Intergenic
936680064 2:114759803-114759825 GGGTGGGCAGTGATGGGGGTGGG + Intronic
936912166 2:117604426-117604448 GGGTGGGGTAGGAAGGGGGTGGG - Intergenic
936971868 2:118184088-118184110 GGGTGGGGATGGGTGGGGGAAGG + Intergenic
937925869 2:127166855-127166877 GGTGGGGCAAGGATGGGGCAGGG - Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
937983571 2:127628561-127628583 GGGTGGGGTGGGGTGGGGGAGGG + Intronic
938203093 2:129392945-129392967 GGCTGGGGAAGGGTTGGGGAAGG + Intergenic
938292469 2:130157399-130157421 GGGTGGAGAAGGAGGGGTGAGGG + Intronic
938307593 2:130265869-130265891 GGGTGGGGAAGGGTGGGGGCTGG - Intergenic
938447739 2:131390973-131390995 GGGTGGGGAAGGGTGGGGGCTGG + Intergenic
938464085 2:131515577-131515599 GGGTGGAGAAGGAGGGGTGAGGG - Intergenic
939068797 2:137515596-137515618 GGGTGTGGAATGATGGTGGAAGG + Intronic
939178657 2:138780399-138780421 GGGCGGGCAGGGAAGGGGGAGGG + Intergenic
939476843 2:142697655-142697677 GGCTGGGTAAGGATGTGGTAAGG - Intergenic
939712614 2:145541765-145541787 GGGTGGTTGGGGATGGGGGATGG + Intergenic
939766151 2:146252202-146252224 GGGAGGGGAAGGAAAGGGGAAGG + Intergenic
939799998 2:146696910-146696932 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
940287998 2:152051195-152051217 CGCTGGGTAGGGATGGGGGGCGG - Intronic
940651324 2:156443804-156443826 AGGTGGGTAAGTAGGGGGAAGGG - Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941089643 2:161160246-161160268 GGCTGGGCAGGGCTGGGGGAGGG + Intronic
941644666 2:168027097-168027119 GGGTGGGTAAGGTAGGGGAAAGG + Intronic
942461040 2:176169248-176169270 GGGTGGGTAGGGCTGGTGGGGGG - Exonic
942461103 2:176169489-176169511 TGGTGGGTGAAGATGGGGGCAGG - Exonic
943189970 2:184663438-184663460 AGGGTGGTAGGGATGGGGGAGGG + Intronic
943342262 2:186694651-186694673 GGGTCGGGAAGGCTGGGGGTGGG + Intronic
943728714 2:191279428-191279450 GGGTGGGTTGGGATAGGGCATGG + Intronic
943743442 2:191436227-191436249 GGGTGGGTGGGGATGGGGAGGGG + Intergenic
943745435 2:191457014-191457036 TGGTGGGTGGGGGTGGGGGAGGG - Intergenic
944382466 2:199127310-199127332 GAGGGGGTAAGGGTGGGGGTGGG + Intergenic
944496455 2:200311915-200311937 GGGAATATAAGGATGGGGGAAGG + Intronic
945493114 2:210478925-210478947 GGGAGGGAAGGGAGGGGGGAAGG - Intronic
946213014 2:218162574-218162596 GTGTGGGGAAGGATCAGGGAAGG - Intergenic
946226254 2:218265558-218265580 GTGTGAGTGAGGATGGGGAAAGG - Exonic
946401653 2:219471733-219471755 GAGTGGGCAAGGATGGGGCAAGG - Intronic
947502842 2:230683808-230683830 GAGTGGGTAAGAAAGGAGGAGGG + Intergenic
947796437 2:232896674-232896696 GTGGGGGTAGGGATGGGGGTGGG + Intronic
947796599 2:232897109-232897131 GTGAGGGTAGGGATGGGGTAGGG + Intronic
949064210 2:241979994-241980016 GGGAGGGGATGGGTGGGGGATGG - Intergenic
949064222 2:241980016-241980038 GGGAGGGGAGGGGTGGGGGATGG - Intergenic
949064260 2:241980087-241980109 GGGAGGGGATGGGTGGGGGATGG - Intergenic
949065910 2:241990257-241990279 GGATGGGGATGGATGGTGGATGG - Intergenic
1168813082 20:719105-719127 AGGTGGGGCAGGATGAGGGATGG + Intergenic
1168894444 20:1313566-1313588 GTGGGGGTAGGGATGGGGAAAGG + Intronic
1168984925 20:2039741-2039763 GGGAGGTTAAGGAAGGGTGAAGG + Intergenic
1169025668 20:2369158-2369180 GGGTGGGCAGGGTGGGGGGAGGG - Intergenic
1169155628 20:3327364-3327386 GAGTGGGGAAAGATGGGGGAGGG + Intronic
1169378479 20:5086432-5086454 GGGAGGCTAAGGCTGGAGGATGG + Intronic
1169456674 20:5758330-5758352 GGGAGGGGAAGGGAGGGGGAGGG + Intronic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1170528094 20:17261116-17261138 GAGTGTGTAGGTATGGGGGATGG - Intronic
1170578067 20:17679902-17679924 AGGAGGCTAAGGTTGGGGGAGGG - Intronic
1170587784 20:17748355-17748377 GGCTGGGTTGGGCTGGGGGAGGG - Intergenic
1170794390 20:19533646-19533668 GGTTGGGTCAAGATGGGAGATGG + Intronic
1171357990 20:24565428-24565450 TGCTGGGACAGGATGGGGGACGG + Intronic
1171990731 20:31694334-31694356 GGGTGGGGAAGGAAGTGGGTGGG + Intronic
1172423934 20:34842276-34842298 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1172454895 20:35062660-35062682 GGTTGCCTAAGGATGTGGGAGGG + Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172792050 20:37512470-37512492 GGGTGGGAAAGGTAGAGGGAGGG + Intronic
1173147272 20:40535599-40535621 GGATGGGTAAAGGTGGGGGTGGG - Intergenic
1173424228 20:42928731-42928753 AGGTGGGTAGGGATGGGTGGAGG - Intronic
1173476714 20:43364880-43364902 GGGAGGGAAAGGGTGGTGGATGG - Intergenic
1173483514 20:43422597-43422619 AGATTGGGAAGGATGGGGGAAGG + Intergenic
1173852649 20:46228557-46228579 GTGGGGGTAAGGGTGGGGGAGGG + Intronic
1174394380 20:50237610-50237632 GGATGGGTATGGATGGTGGCTGG + Intergenic
1174570955 20:51500830-51500852 GGGAGGGTGAGGGTGGGGGTGGG - Intronic
1174980694 20:55391371-55391393 TGGTGGGTGGGGTTGGGGGAGGG - Intergenic
1175230658 20:57471410-57471432 GGGTGGGTGAGGTTGGGGGATGG + Intergenic
1175248629 20:57596091-57596113 GGGTGGCTCAGGATGGGGCGTGG + Intergenic
1175278552 20:57787946-57787968 GGGTGGGTGAAGGAGGGGGATGG + Intergenic
1175314618 20:58038729-58038751 GGGTGGTCAAGGATGGTGGTCGG - Intergenic
1175823485 20:61924290-61924312 GGGGAGGTAAGGCTGGGGGTGGG - Intronic
1175871937 20:62213134-62213156 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1175872029 20:62213354-62213376 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1175872039 20:62213378-62213400 GAGTGGGGATGGGTGGGGGAAGG + Intergenic
1175931951 20:62497647-62497669 GGGTGGGTCCGTATTGGGGATGG + Intergenic
1175932419 20:62498917-62498939 GGGTGGGTAAGTGTTGGGGATGG + Intergenic
1175932435 20:62498971-62498993 GGGTGGGTGAGTTTTGGGGATGG + Intergenic
1175971300 20:62687955-62687977 GGGTGGGTAAGGCCCGGGGGTGG - Intergenic
1176000790 20:62830412-62830434 AGGTGGGTGAGGTTGGGGCAAGG + Exonic
1176004558 20:62853351-62853373 GGGTGGGTGGGGGTGGGGCAGGG + Intronic
1176056172 20:63150452-63150474 GGGCGGGGAAGGGTGGGGAAGGG + Intergenic
1176092541 20:63325524-63325546 GGGTTGGTGGGGGTGGGGGAAGG + Intronic
1176274477 20:64255941-64255963 GGGTGGGGAAGGAGGAGGGAAGG - Intronic
1176350860 21:5795388-5795410 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1176357674 21:5915972-5915994 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1176545181 21:8193458-8193480 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1176564132 21:8376503-8376525 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1177175030 21:17693923-17693945 ATGTGGGGAAGGATGGGAGAAGG + Intergenic
1177853451 21:26376197-26376219 GGGTTGGTAATGATGGGAGATGG + Intergenic
1177907916 21:26994396-26994418 GGGTGGAAAAGGATGGGAAATGG + Intergenic
1178628216 21:34236363-34236385 GGGTGGGGAAGGTGGAGGGAGGG - Intergenic
1179073972 21:38100646-38100668 GGGTGGGTGTGGATGGGGTTGGG - Intronic
1179207154 21:39292119-39292141 GGGTGGGTGGGGGTGGGGGGGGG + Intronic
1179281208 21:39935903-39935925 GGGTGAGTAGGTATGTGGGAAGG - Intergenic
1179426438 21:41283020-41283042 GTGTGGTTCAGGATGGCGGATGG - Intergenic
1179445308 21:41426546-41426568 GGTTGGGAAGGGGTGGGGGACGG + Intronic
1179498406 21:41790579-41790601 GGGAGGGTAGGGAATGGGGAGGG + Intergenic
1179667219 21:42921214-42921236 GGGAGGGTGAGGATGGGGACTGG + Intergenic
1179879160 21:44286312-44286334 GTGTGGGGACGGCTGGGGGAAGG - Intronic
1179896125 21:44364678-44364700 GGGAGGGAAAAGCTGGGGGAAGG + Intronic
1179913154 21:44460776-44460798 GATTGGGTTAGGGTGGGGGATGG - Exonic
1180002640 21:45002168-45002190 GGTTGGGGAAGGGTGGGGCAAGG + Intergenic
1180042375 21:45287293-45287315 GGGTGGGATGGGATGGGGGCAGG - Intronic
1180133833 21:45847385-45847407 GTGAGGGTAAGGATGGAGGTGGG - Intronic
1180947413 22:19704127-19704149 GGGTGGGGCAGGAAGGAGGAAGG + Intergenic
1180988803 22:19921308-19921330 GGGAGGCTAAGGTGGGGGGATGG + Intronic
1181087100 22:20445866-20445888 GGGAGGCTGAGGTTGGGGGATGG - Intronic
1181176905 22:21043137-21043159 GGGTGGCCAAGGATGTTGGAAGG + Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181387834 22:22558178-22558200 TGGGGGGTCGGGATGGGGGAAGG + Intronic
1181387874 22:22558288-22558310 GGAGGGGTGAGGATGGCGGAAGG + Intronic
1181387890 22:22558324-22558346 GGAGGGGTGGGGATGGGGGAAGG + Intronic
1181387908 22:22558361-22558383 GGAGGGGTGGGGATGGGGGAAGG + Intronic
1181528259 22:23502239-23502261 TGGGGGATAGGGATGGGGGATGG - Intergenic
1182250489 22:28996176-28996198 GGGAGGCTAAGGAAGGAGGATGG - Intronic
1182415237 22:30217078-30217100 GGGGAGGTAGGGGTGGGGGAAGG + Intergenic
1182690541 22:32158693-32158715 GGATGGGTAAGGATAGAGAATGG + Intronic
1182778601 22:32849699-32849721 GGATGGGTAGGGAGGGGGCATGG + Intronic
1183011879 22:34953282-34953304 AGGTGGGTAGTGGTGGGGGAGGG - Intergenic
1183382237 22:37496002-37496024 GGCTGGGCATGGATGGGGCAGGG + Exonic
1183525397 22:38319592-38319614 GGCTGGGTTAGGAAGGGGCAGGG - Intronic
1183718721 22:39549783-39549805 TGGGGAGTAAGGATGGGGTAGGG - Intergenic
1183741863 22:39673169-39673191 GGGTGGGGAGGGGTGGGGGCAGG + Intronic
1183868838 22:40725266-40725288 GGCAAGTTAAGGATGGGGGAAGG - Intergenic
1184031848 22:41899871-41899893 GGGAGGCTAGGGATGGGGGAGGG - Intronic
1184066720 22:42125621-42125643 GGGTGGGGAAGGGTGGGGAAGGG + Intergenic
1184066725 22:42125631-42125653 GGGTGGGGAAGGGTGGGGAAGGG + Intergenic
1184069188 22:42137773-42137795 GGGTGGGGAAGGGTGGGGAAGGG + Intergenic
1184069193 22:42137783-42137805 GGGTGGGGAAGGGTGGGGAAGGG + Intergenic
1184104575 22:42360040-42360062 GTGTGGGGATGGATTGGGGAAGG - Intergenic
1184361332 22:44020673-44020695 GGTAGGGCAAGGATGGAGGAGGG + Intronic
1184410400 22:44322961-44322983 GGGTGGGTGAGGTTGGTGGGTGG - Intergenic
1184410424 22:44323053-44323075 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1184410547 22:44323571-44323593 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1184422761 22:44391457-44391479 GGGTGGGTAGGGGTGGGTGCTGG + Intergenic
1184468038 22:44680399-44680421 GGATGGGGAAGGATGGGGGATGG + Intronic
1184512259 22:44940592-44940614 GGGTGGGGAAGGATGGGGAGAGG + Intronic
1184660087 22:45961627-45961649 GGGTGGGCAAGGACGGGGCTGGG + Intronic
1184817164 22:46881126-46881148 GGGTGGGTAGGGATGGCAGTAGG - Intronic
1185072273 22:48662858-48662880 GGGAGGGCAAGGATTGGGGGAGG - Intronic
1185079812 22:48703494-48703516 GTGGGGCTGAGGATGGGGGAGGG - Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185242747 22:49755312-49755334 GGGTGGGGCAGGTTGGGTGAAGG - Intergenic
1185276237 22:49951226-49951248 GGAGGGCTGAGGATGGGGGAAGG + Intergenic
1185359221 22:50395347-50395369 GGGTGAGCAAGGATGGGGCTGGG + Intronic
1203250051 22_KI270733v1_random:109696-109718 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
949493393 3:4610135-4610157 GGGTGGGACAGGAAGAGGGATGG - Intronic
949810898 3:8004867-8004889 GGGTGGGAAAGGATGTTTGAGGG + Intergenic
949854470 3:8448514-8448536 GGGTGGGGGGAGATGGGGGAGGG + Intergenic
949863991 3:8532392-8532414 GAGTGGGTGAGGGTGGGGGATGG + Intronic
950644116 3:14367075-14367097 GGGTGAGTAAGGATGGGACAGGG + Intergenic
950670131 3:14521019-14521041 TGGTGGCTAAGGAGGGGAGAAGG - Intronic
950745559 3:15085298-15085320 GGGTAGGCAAGGATGGGTAAGGG + Intronic
950900585 3:16493691-16493713 GGGTGGGAATGGATGGGGGCAGG - Intronic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951480479 3:23156275-23156297 AGGTTGGAAAGGATGGGGGAAGG + Intergenic
952277305 3:31889648-31889670 GGCTGGGAAGGGTTGGGGGAAGG + Intronic
952334213 3:32391353-32391375 GGCTGGATAAGGATGGGGCCAGG + Intergenic
952471201 3:33653707-33653729 GGCTGGGAAAAGATGGGGTAGGG + Intronic
953176608 3:40559252-40559274 TGGTAGGTAAGGATTGGGGATGG - Intronic
953273927 3:41476065-41476087 GGGAGGGAAAGGAGGAGGGAGGG + Intronic
953549172 3:43887377-43887399 GGGTGGGGAAGGTATGGGGAGGG - Intergenic
953781888 3:45878492-45878514 GGCAGGGTGAGGCTGGGGGATGG + Intronic
953917122 3:46927212-46927234 AGGTGTTCAAGGATGGGGGACGG - Intronic
954405861 3:50344795-50344817 GGGTGGGGAGGGGTTGGGGAGGG - Intronic
954411880 3:50374384-50374406 GGGTGGGGAGGGGAGGGGGAAGG + Intronic
954432994 3:50481200-50481222 GGGCGAGAAAGGATGGGGGAGGG + Intronic
954796160 3:53162133-53162155 GGGTGGGGTGGGAAGGGGGATGG - Intronic
954991975 3:54849380-54849402 TGGTGGTTAAGGAAGGAGGAGGG - Intronic
955345847 3:58161321-58161343 GGGTGGGTGAGGATTGGTCAGGG + Intronic
955583867 3:60455112-60455134 GGGTGGGTGAGGTAGGGTGAGGG + Intronic
956084957 3:65598371-65598393 GGGTGGGTGAGGGCGAGGGAAGG + Intronic
956746020 3:72311484-72311506 GGGTGGGGAAGGAAGAGAGATGG - Intergenic
956946801 3:74232504-74232526 GAGTGAGTAAGGAGGAGGGAAGG + Intergenic
957036667 3:75299816-75299838 GGGTTGGTGGGGCTGGGGGAGGG - Intergenic
957637085 3:82800396-82800418 GGGGGGGTAAGGGTAGAGGAGGG - Intergenic
957723140 3:84031064-84031086 AAGTGGGTCAGGATGGGGGAGGG + Intergenic
958632846 3:96703613-96703635 GAGTGGGGAATGATAGGGGAGGG + Intergenic
958826299 3:99035205-99035227 GGGGCGGTGAGGCTGGGGGAGGG + Intergenic
958906579 3:99948529-99948551 GGGAGGGGAAGGGAGGGGGAGGG + Intronic
959621143 3:108399612-108399634 TGGTGGCTAAGGATGAAGGAAGG + Intronic
959673770 3:109010670-109010692 GGTTGGTTAGGGATGGGGCAGGG - Intronic
959732403 3:109619108-109619130 GGGAGGGTAAGGGGAGGGGAGGG - Intergenic
959806119 3:110555913-110555935 GGGTGGTGAAGGTTGGGGAATGG - Intergenic
959941307 3:112084807-112084829 CCCTGGGTAAGGATGGGGGTGGG + Intergenic
960023629 3:112984177-112984199 GGATGGGTAAGGAGGTTGGAGGG + Intergenic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
960662632 3:120077665-120077687 GGGTGGGTAACTATGTGAGATGG + Intronic
960679569 3:120233314-120233336 TGTTGGGGAAGGTTGGGGGAGGG - Intronic
960810666 3:121624474-121624496 GGGTGGAGAAGGATGGAGAATGG - Intronic
961358736 3:126354777-126354799 GGGTGGGAAAGGGTTGGGGGAGG - Intronic
961368343 3:126415247-126415269 GGGTGGGTGAGGTTGGGGTTCGG - Intronic
961369271 3:126419605-126419627 GGCGGGGTGAGGATGTGGGAAGG - Intronic
961563170 3:127745537-127745559 AGGCGTGGAAGGATGGGGGATGG + Intronic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961639570 3:128356748-128356770 GGCTGTGTATGGATGGGGGCAGG - Intronic
961756136 3:129128362-129128384 GTGTAGGTGAGGATGGGGAAGGG - Intronic
962072204 3:132044676-132044698 GGGAGGGGAGGGAGGGGGGAGGG + Intronic
962076620 3:132088750-132088772 GGGAGGGAAGGGAAGGGGGAGGG + Intronic
962117667 3:132529116-132529138 GGGTGCCAAAGGTTGGGGGAAGG - Intronic
962370899 3:134820045-134820067 GGGTGGGTGAGGGGAGGGGAAGG - Intronic
962514053 3:136132014-136132036 GGGTGGGGGGGGCTGGGGGAGGG + Intronic
962556184 3:136554239-136554261 GGGAGGGTAAGGAAGGGGAAAGG + Intronic
962613463 3:137101300-137101322 GGGTGGGGAATGCTGGGGAAAGG - Intergenic
962812877 3:138974136-138974158 GGGGGGCTAAGGCTGGAGGATGG - Intergenic
964245240 3:154644105-154644127 GGTCGGGAAAGGATGGGAGAGGG - Intergenic
964405109 3:156340551-156340573 GGGTTAGGAAGGATGGGTGATGG - Intronic
965736957 3:171830703-171830725 AGGCTGGGAAGGATGGGGGATGG + Intergenic
966198937 3:177341466-177341488 AGGTGGGACAGGGTGGGGGAGGG - Intergenic
966311026 3:178594039-178594061 GGGTAGGTAAGGAGGGAGGGAGG - Intronic
966431075 3:179832323-179832345 GGGTGGGTAAGTAAGCAGGAAGG - Intronic
966851495 3:184167742-184167764 GGGTGGGGAGTGATGGGGCAGGG + Intronic
966875681 3:184320367-184320389 GGTGGGGTAGGGATGAGGGAGGG + Intronic
966902030 3:184493495-184493517 GGGTAGGAAAGGAAGGAGGAAGG + Intronic
967272640 3:187743818-187743840 GAGGGAGTAAGAATGGGGGAAGG - Intronic
967307673 3:188074837-188074859 GGGTGGGGTCTGATGGGGGATGG + Intergenic
967344743 3:188442264-188442286 GGGTGTGTGGGGCTGGGGGAGGG - Intronic
967627491 3:191703184-191703206 GGGTGGGTTAGGATGGGGGTGGG - Intergenic
967864812 3:194181344-194181366 GGATGGGTATGGGTCGGGGATGG + Intergenic
967873440 3:194250690-194250712 GGGTGGGAAGGGATGGGTGGGGG + Intergenic
967898744 3:194425006-194425028 GGGTGAGTTAGGATCGGGGGCGG - Intronic
967954709 3:194869284-194869306 GGGAGGGGAAGGAAAGGGGAGGG + Intergenic
968088820 3:195886944-195886966 AGGTGGGTGAGGAGGTGGGAGGG - Intronic
968588666 4:1446796-1446818 GGGAGGCTCAGGGTGGGGGATGG - Intergenic
968693480 4:2008641-2008663 GGGATGGGAAGGTTGGGGGAGGG + Intronic
968731387 4:2270920-2270942 GGGTGGGTAGGTGTGTGGGAGGG - Intronic
968880271 4:3294971-3294993 GGGAGGGTCAGGAGGTGGGAGGG + Intronic
969312499 4:6362093-6362115 GGGTGGCTGAGCATGAGGGAGGG + Intronic
969724843 4:8912886-8912908 GGGGGGGCCAGGGTGGGGGAGGG - Intergenic
970058510 4:12002347-12002369 GGGTGGGGGTGGATGGGGAAAGG + Intergenic
971029550 4:22621547-22621569 GGGAGGGTAAAGATGGAGGCAGG + Intergenic
971357042 4:25904479-25904501 GTGTGGGTATAGATGGGGAATGG + Intronic
972359479 4:38314176-38314198 GGGTGGGGTAGGATGGGACAGGG + Intergenic
972466879 4:39366133-39366155 GGGTGGGGGAGGATGGCGGTGGG - Intronic
972592098 4:40497512-40497534 GGGAGGCTGAGGATGGAGGATGG + Intronic
972928062 4:44037178-44037200 GGGAGGGCAAGGATGGAGTATGG - Intergenic
973545514 4:51977586-51977608 GGGAGGCTAAGGCTGGAGGATGG + Intergenic
973652324 4:53008335-53008357 GGGTGGGGAGGGAGAGGGGAAGG - Intronic
973824725 4:54693619-54693641 GGATGGGTGAGGATAGGGGATGG - Intronic
974047240 4:56908236-56908258 GGCTCGGTCAGGGTGGGGGAGGG + Intronic
974758354 4:66242823-66242845 GGGTGGGCGGGGAGGGGGGAGGG - Intergenic
974833370 4:67216388-67216410 GGGAGGGGAAGGGAGGGGGAGGG + Intergenic
975291763 4:72685570-72685592 GGGGGTGGAAGGATGGGGGAAGG + Intergenic
975457865 4:74614085-74614107 AGGTGGGTGAGGGTGTGGGATGG - Intergenic
975530437 4:75394567-75394589 TGGTGGGTAGGGATGGAGAACGG + Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
975707953 4:77129313-77129335 GGGTGGATAGGGAGTGGGGATGG - Intergenic
975841590 4:78480216-78480238 GGGTGGGAAATGGTGGTGGAGGG - Intronic
976493724 4:85701426-85701448 GGGTGGGAAATGTTGGGAGATGG - Intronic
976616789 4:87086413-87086435 GGGTGGGAAGGGAAGGAGGACGG - Intronic
977090824 4:92673825-92673847 GGGTGGGGAGGAAGGGGGGAGGG + Intronic
977188089 4:93965896-93965918 GGGTGGGGAAGACAGGGGGAAGG - Intergenic
977294870 4:95199092-95199114 GCGTGAGTCAGGATGGGGGCAGG + Intronic
977600718 4:98931319-98931341 GGGTGGGGAAGGGTGGGGAAGGG - Intergenic
977828522 4:101562404-101562426 GGGTGGGTAAAGAGTGGAGAGGG - Intronic
977918380 4:102618153-102618175 GGGTGGGGGGGGAGGGGGGAGGG + Intergenic
977961732 4:103093152-103093174 GGCAGGGGAAGGATAGGGGAAGG - Intronic
978376730 4:108081816-108081838 TGGAGGGTAAGGAAGGGGAACGG - Intronic
978733926 4:112063661-112063683 GGGTGGGGAAGAAGTGGGGATGG + Intergenic
978739211 4:112118928-112118950 GGAAGGGAAGGGATGGGGGAAGG + Intergenic
978759732 4:112343730-112343752 GGGGGGGAAAGGGTGGGGGTTGG - Intronic
978874295 4:113620110-113620132 GGTTGGGTAAGGATGGAGGTAGG + Intronic
978935778 4:114373384-114373406 GACTGGGTAAGGACGGGGTAAGG + Intergenic
979521654 4:121674272-121674294 GGGAGGGGAAGGAAAGGGGAGGG + Intronic
979521659 4:121674288-121674310 GGGAGGGTAAGGAAATGGGAGGG + Intronic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980996492 4:139784454-139784476 GGGTGGGTAAAGAAGGGGCCTGG - Intronic
981000361 4:139823344-139823366 GGGTGGGCAAGGATGGTTGTAGG - Intronic
981761885 4:148203638-148203660 GCGGGGGGAGGGATGGGGGAAGG - Intronic
982329860 4:154169550-154169572 GGGCGGGGAAGGGTGGGGGAGGG - Intergenic
982438355 4:155403066-155403088 GGATGGGGAAGGATGTGAGAAGG - Intergenic
983481937 4:168285738-168285760 GGGTGGATATGCATGGGGGATGG + Intronic
983503136 4:168523245-168523267 GGGAGGGTAAGGAAGGAGGAAGG + Intronic
983575341 4:169255518-169255540 GGGTGGGCAAGGTTGGGGAAGGG + Intronic
983757834 4:171363752-171363774 GGGTAGTTAGGGATGGGGGGCGG - Intergenic
983822874 4:172218051-172218073 TGATGGGAAGGGATGGGGGAGGG + Intronic
983905223 4:173174609-173174631 GGGAGGATGGGGATGGGGGAGGG - Intronic
984494301 4:180475268-180475290 GTGTGGGTGAGGGTGGGTGAAGG + Intergenic
984501852 4:180566900-180566922 GGGTGGGTGAGTGTGGGTGAGGG + Intergenic
984784392 4:183554256-183554278 GGGTAAGTGTGGATGGGGGAGGG + Intergenic
985016224 4:185638657-185638679 GGATGGGGAAGGGTGCGGGAGGG + Intronic
985250891 4:188023367-188023389 AGCTGGGTGAGGAGGGGGGATGG + Intergenic
985344833 4:188993155-188993177 GAGTGGGTGAGGATGGGGAGAGG - Intergenic
985400650 4:189590118-189590140 GGGAGGGTGAGGATGGAGGCTGG + Intergenic
985462016 4:190116615-190116637 GGGTGGGGGGGGAGGGGGGAGGG - Intergenic
985511880 5:318033-318055 GGGAGGGAAAGGATGGGGGGAGG - Intronic
985511965 5:318248-318270 GGGAGGTAAAGGATGGGGGGAGG - Intronic
985549528 5:525907-525929 GGGTGGGTGCAGATGGAGGATGG + Intergenic
985824619 5:2183195-2183217 GGGTGGGTGAGGAGGGGCCAGGG + Intergenic
986297270 5:6449572-6449594 GGGAGGCTAAGGAAGAGGGATGG - Intronic
986301493 5:6481673-6481695 ATGTGGGCAAGGCTGGGGGAAGG - Intronic
987207880 5:15646002-15646024 GGGTGGGTAGAGTTGGAGGAGGG + Intronic
989824069 5:45832984-45833006 GTGGGGGGGAGGATGGGGGAGGG - Intergenic
990022327 5:51142888-51142910 TGGGGTGGAAGGATGGGGGAGGG + Intergenic
990161908 5:52950336-52950358 GGGTGGGTGTGGATGGGGACTGG + Intronic
990192831 5:53279831-53279853 TGGGGGGTGGGGATGGGGGAGGG - Intergenic
990581885 5:57173781-57173803 GCGTGGCTAAGGCTGGGGGCGGG - Intergenic
991620286 5:68538643-68538665 GGATGGGCAGGGATGGGGTAAGG - Intergenic
991726529 5:69541197-69541219 GGGTGGGTATTGATGGAGAAAGG - Intronic
991868428 5:71086677-71086699 GGGTGGGTATTGATGGAGAAAGG + Intergenic
991971247 5:72143789-72143811 GGGAGGCTAAGGAGGGAGGATGG - Intronic
992526358 5:77614648-77614670 GGGTGGGGGGGGAGGGGGGAGGG + Intronic
992886676 5:81166647-81166669 TGAAGGGGAAGGATGGGGGAGGG + Intronic
994134584 5:96270706-96270728 GAGGGGGTGAGGTTGGGGGAAGG + Intergenic
995157261 5:108930442-108930464 GGGAGGGTAAGAAAAGGGGAAGG - Intronic
995346436 5:111125084-111125106 GGCTGGGTAAGAATAAGGGATGG + Intronic
995895212 5:117003461-117003483 GGAGGGGAAAGGATGGGGCAGGG - Intergenic
996404748 5:123094215-123094237 GGGTGGGAAGGGATTAGGGAAGG - Intronic
996465570 5:123798684-123798706 GGGTGGGTATGGATTCAGGACGG + Intergenic
996731186 5:126718768-126718790 GGGCAGGAAAGGATGGAGGAGGG + Intergenic
997374073 5:133384476-133384498 GACTGGCTAAGGATGGAGGAAGG + Intronic
997698642 5:135880932-135880954 GTGTGGGTGGGGGTGGGGGATGG - Intronic
997747862 5:136315406-136315428 AGGTGGGAAGGGATGGTGGAGGG + Intronic
997857234 5:137383319-137383341 GGGTAGGTCAGGATGTGGGGAGG - Intronic
998032402 5:138882349-138882371 GGGTGGGTCAGCATGGAAGATGG + Intronic
998358344 5:141560923-141560945 GGGTGGGGAAAGATGAGGGGGGG + Intronic
998402692 5:141856157-141856179 GGGTGGGTGAGGCTGGGTGCTGG + Intronic
998536914 5:142941450-142941472 GGGTGGGTGAGCATGGGAGACGG - Intronic
998545851 5:143026796-143026818 GGGTGGGTGGGGGTGGGGGGTGG + Intronic
998940828 5:147280416-147280438 GGGGGGTTGGGGATGGGGGAGGG + Intronic
999062409 5:148650670-148650692 GGGAGAGGAAGGATGGAGGAAGG - Intronic
999323798 5:150630717-150630739 GGCTGGGCAGGGATGGAGGAGGG - Intronic
999693159 5:154166249-154166271 GCGTGGGGAAGGAATGGGGAGGG + Intronic
1000043088 5:157499677-157499699 GGGTGGGTGTGAGTGGGGGAGGG + Intronic
1000203288 5:159032993-159033015 GGGTGGGGGCGGATGTGGGAGGG - Intronic
1000658807 5:163914983-163915005 GGGTGTGGAGGGATGGGGGAAGG - Intergenic
1000767596 5:165310926-165310948 GGGTGGGCAAGGCTGAGGCAAGG - Intergenic
1001132886 5:169079477-169079499 GGGTGGGGGAGGAGGGGGGGAGG + Intronic
1001363181 5:171108515-171108537 GGGAGGGTAAGGTAGGAGGACGG - Intronic
1001382702 5:171314790-171314812 GGCTGGGCAAGGCTGGGTGAGGG - Intergenic
1001509801 5:172312174-172312196 GGAGATGTAAGGATGGGGGAAGG + Intergenic
1001548632 5:172586516-172586538 GGGCGAGTAAGGGTGGGGGCTGG + Intergenic
1001629982 5:173167907-173167929 GGGTGGGTATGGGCGGGAGATGG - Intergenic
1001701371 5:173708945-173708967 GAGTGGGTGAGGATGGAGGCCGG - Intergenic
1001731581 5:173964438-173964460 GGGTGGGGTAGGGTGGGTGAGGG + Intergenic
1001731587 5:173964448-173964470 GGGTGGGTGAGGGTGGGGTGGGG + Intergenic
1001748896 5:174112825-174112847 GGGTGGGTGGGGTTGGGGGAGGG - Intronic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1002304972 5:178277907-178277929 GGGTGAGGGAGGATGGAGGATGG + Intronic
1002490032 5:179569234-179569256 GGGTGGGGAAGGAGTGGGGATGG + Intronic
1002692753 5:181061802-181061824 GGATGGGAACGGATGGGGCAGGG + Intergenic
1002700746 5:181122753-181122775 GGGAGGCTAAGGAGGGAGGACGG - Intergenic
1002968792 6:1993139-1993161 GGCTGGGCAAGGCTGGGGCAAGG - Intronic
1003020519 6:2505189-2505211 GGGGGAGGAAGGATGGGGGAGGG - Intergenic
1003870147 6:10396092-10396114 GGGGTGGGGAGGATGGGGGAGGG - Intronic
1003980421 6:11384675-11384697 TGGAGGATGAGGATGGGGGAAGG + Intergenic
1004210637 6:13638840-13638862 GGTTGGGAAAGGTTGGGGGTGGG + Intronic
1004339775 6:14798186-14798208 GGGAGGGAAGGGTTGGGGGAGGG + Intergenic
1004924363 6:20403406-20403428 GGGCGGGGAAGGAAGGGGCAAGG - Intronic
1005057093 6:21739671-21739693 GGATGGGTTAGGATTGGGGTGGG + Intergenic
1005511235 6:26513203-26513225 GGGAGGCTGAGGTTGGGGGATGG + Intergenic
1005685283 6:28247972-28247994 GGGTGGGGTAGGACTGGGGAGGG + Intronic
1005724431 6:28635054-28635076 GAATGGGTAAGGATGGGTAAGGG + Intergenic
1005750941 6:28881944-28881966 GGGTGGGTGGGGGCGGGGGAAGG + Intergenic
1005845120 6:29771099-29771121 GGGTGGGGAAAGATGCAGGATGG + Intergenic
1006380618 6:33695147-33695169 GGGTGGGTCAGGAAGGATGAAGG - Intronic
1006790468 6:36697955-36697977 GGAAGGATGAGGATGGGGGAGGG + Intronic
1006807669 6:36799114-36799136 GGGTGGGAGATGCTGGGGGAAGG - Intronic
1006808174 6:36802350-36802372 AGGAGGCTAAGGTTGGGGGATGG + Intronic
1006981823 6:38153664-38153686 AGGTGGGGAAGGGTGGGGGTGGG + Exonic
1007120562 6:39377351-39377373 GGTTGGGGGGGGATGGGGGACGG - Intronic
1007319556 6:41017746-41017768 GGGTGGGTGAGGTTTGGGGTGGG - Intergenic
1007360429 6:41351612-41351634 GGGTGAGTAGAGATGGGGCAGGG - Intergenic
1007460492 6:42014681-42014703 GGGAGGCTGAGGTTGGGGGATGG + Intronic
1007631740 6:43276690-43276712 AGCTGGGAAAGGAAGGGGGAGGG - Intronic
1007658782 6:43469429-43469451 GGTAGGGGTAGGATGGGGGAAGG - Intergenic
1007674612 6:43582704-43582726 GGGTGGGTAGAGATGGGGATTGG + Intronic
1007742505 6:44021548-44021570 GGTGGGGTGAGGATGGGTGATGG - Intergenic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1008058095 6:46966311-46966333 GGGTGTGAAGGGCTGGGGGATGG - Intergenic
1008940110 6:57037699-57037721 TGGTGGAGAAGGTTGGGGGAAGG + Intergenic
1008960167 6:57258571-57258593 GGGTGGGTTGGGGTGGGGGCTGG - Intergenic
1009385517 6:63081210-63081232 GGGTGGTTAATGATGGAAGAGGG - Intergenic
1009441776 6:63688313-63688335 GGGAGGGGAAGGGAGGGGGAAGG - Intronic
1009630414 6:66191816-66191838 AGGTGGTTCAGGATGGGAGAGGG - Intergenic
1010013305 6:71074858-71074880 GGGAGGGAAGGGTTGGGGGAAGG + Intergenic
1010056288 6:71569295-71569317 GGAGGTGTAAGGATGGGGGCTGG - Intergenic
1010121467 6:72380247-72380269 TGGGGTGGAAGGATGGGGGAGGG + Intronic
1010423262 6:75698572-75698594 GGGAGGCTGAGGTTGGGGGATGG - Intronic
1010490161 6:76466330-76466352 GGGTGGGGAACTATGGAGGAAGG - Intergenic
1010921199 6:81682926-81682948 GGGAGGGGAAGGGAGGGGGAAGG + Intronic
1011548898 6:88511050-88511072 GGGTGGGGAGGGATTGGGGAAGG - Intergenic
1011603351 6:89080382-89080404 GGGTGGGGAAGGGAGGGGGCAGG - Intergenic
1012111600 6:95242093-95242115 GGGAGGGGAAGGGAGGGGGAGGG + Intergenic
1012963522 6:105647790-105647812 GCCTGGGTAAGGGTGGGGGGAGG - Intergenic
1013341693 6:109221546-109221568 GGGAGGGGAAGGGAGGGGGAGGG - Intergenic
1013428411 6:110035090-110035112 GGGTGGGGTAGGATGGGGTGGGG - Intergenic
1013430794 6:110053311-110053333 GGTTGGGTAAGGATGCAGAAAGG - Intergenic
1013601756 6:111711720-111711742 AGGCGGGAGAGGATGGGGGAGGG + Intronic
1014509415 6:122302670-122302692 TGGTGGGTAAGAAGGAGGGAGGG - Intergenic
1014547726 6:122752507-122752529 AGGAGGGTAAGGTTGGGGGTGGG - Intergenic
1015411077 6:132894464-132894486 GGGTGGGGGAAGTTGGGGGAGGG + Intergenic
1015789822 6:136955253-136955275 GGATGGGCAAGGATGGGAGTAGG + Intergenic
1016009662 6:139126323-139126345 GGCTGGGAAGGGATGTGGGAGGG - Intergenic
1016386579 6:143536364-143536386 GTGTGGGTGCGGATGGGGAAGGG + Intergenic
1016503534 6:144750153-144750175 GGGTGGGTTAGGGTGGGCAAAGG - Intronic
1016558479 6:145367695-145367717 GGGTGGGGTGGGATGGGGAAGGG + Intergenic
1016687636 6:146899643-146899665 GGGTGGGATGGGGTGGGGGAGGG - Intergenic
1016752843 6:147650335-147650357 GGGTGGCAAAGGAGGGGGCAAGG + Intronic
1016851878 6:148628392-148628414 AGGGGGATAAGGATGGGGGAGGG - Intergenic
1017055811 6:150434717-150434739 AGGTGGGGAGGGAAGGGGGATGG - Intergenic
1017105139 6:150880256-150880278 GGCTGGAGAGGGATGGGGGAGGG - Intronic
1017752048 6:157497024-157497046 GGGTGGGTTAGGGAAGGGGAAGG + Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1017931917 6:158963413-158963435 GGGAGGGAAGGGAAGGGGGAAGG - Intergenic
1018005654 6:159619638-159619660 GGGTGGGCAAGGCTGGGGGCCGG - Intergenic
1018753877 6:166831298-166831320 GGGAGGGTAAGGATCTGAGAAGG - Intronic
1019040511 6:169100188-169100210 GGGTGTGGAATGATGGGAGAAGG + Intergenic
1019057828 6:169235891-169235913 GGGAGAGTGTGGATGGGGGAGGG - Intronic
1019134974 6:169902324-169902346 TGGTGGGTGATGATGGGGAATGG + Intergenic
1019197527 6:170291105-170291127 GGGCGGGGAAGGGTGGGGGCGGG - Intergenic
1019335489 7:480692-480714 GGGTGGGGCAGCATGGGGGCTGG + Intergenic
1019422826 7:958950-958972 GGGGAGGAAAGGATGGGGGATGG - Intronic
1019455467 7:1124563-1124585 GGGTGGGGGGGGAGGGGGGAGGG + Intronic
1019479512 7:1260078-1260100 CGGGGGGTAAGGATGGGCGTGGG + Intergenic
1019531814 7:1507027-1507049 GGGTTGAAAGGGATGGGGGATGG - Intergenic
1019580247 7:1758415-1758437 GGGTGGCCAAGGATGGAGGCTGG + Intergenic
1019713515 7:2528068-2528090 GGGAGGGTGGGGGTGGGGGAGGG + Exonic
1019758557 7:2791403-2791425 GGGTGGGCCGGGGTGGGGGATGG - Intronic
1019830296 7:3321737-3321759 GGGAGGGGAAGGAGGGGGGAGGG - Intronic
1020036924 7:4969376-4969398 GGGAAGGGAAGGGTGGGGGAGGG + Intergenic
1020041096 7:5002281-5002303 GGATTGGTGAGGGTGGGGGAAGG - Intronic
1020179854 7:5913798-5913820 GTCTGTGCAAGGATGGGGGAAGG - Intronic
1020221720 7:6243408-6243430 GGATGGGGCAGGATGGGGGTGGG + Intronic
1020278061 7:6636836-6636858 GGGTGGGGAGGGAGGAGGGACGG - Intergenic
1020303082 7:6811086-6811108 GTCTGTGCAAGGATGGGGGAAGG + Intronic
1020662169 7:10995646-10995668 GGGTGGGTAAGGCTCAGGCATGG + Intronic
1020877252 7:13713488-13713510 GGGAAGGGAAGGAAGGGGGAAGG + Intergenic
1020877259 7:13713504-13713526 GGGAAGGGAAGGAAGGGGGAAGG + Intergenic
1022747541 7:33188121-33188143 GGGTGGGGTAGGGTGGGGGGAGG + Intronic
1022993886 7:35733974-35733996 GGATGGGTAAGAAGGGGGGAAGG + Intergenic
1023003727 7:35840152-35840174 GGAGGAGGAAGGATGGGGGAAGG - Intronic
1023022809 7:36026003-36026025 AGGTGGGTGTGGATGGGGAAGGG - Intergenic
1023158194 7:37272851-37272873 GGTTGCCTAAGGCTGGGGGAGGG + Intronic
1023524099 7:41080854-41080876 AGGTGGGAATGGGTGGGGGAAGG - Intergenic
1023582732 7:41699943-41699965 GGGTGGGGAGGGGTGGGGGGTGG - Intronic
1023728296 7:43166485-43166507 GGGTGGAGATGGATGAGGGAAGG + Intronic
1023822915 7:43990074-43990096 GGGTGAGTAAGGGTGGGGATTGG - Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1023916983 7:44597031-44597053 GGAGGGGAAAGGAGGGGGGAGGG + Intergenic
1024328205 7:48130179-48130201 GGGTGGGAGATGATGGGGGCAGG - Intergenic
1025116533 7:56263177-56263199 GGGAGGGTGAGGCTGGAGGATGG + Intergenic
1025943370 7:66089174-66089196 GGGTGAGCAAGGCAGGGGGAGGG + Exonic
1026011880 7:66642809-66642831 GAGTGGGGAAGGATGGGGGTTGG + Exonic
1026762566 7:73137768-73137790 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1026762608 7:73137878-73137900 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1026846277 7:73700651-73700673 GGATGGGGAGGGATGTGGGATGG + Intronic
1026871307 7:73853841-73853863 GAGTGGATGAGGATGGGGCAGGG + Intergenic
1026891769 7:73986448-73986470 GGGTGGGGCAGGCTGGGGGCTGG + Intergenic
1026989000 7:74572660-74572682 GGGTGGGGAAGGCTGAGAGAGGG - Intronic
1027039029 7:74947544-74947566 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027039071 7:74947654-74947676 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027039081 7:74947676-74947698 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027054472 7:75040554-75040576 TGGCAGGTGAGGATGGGGGATGG - Intronic
1027084570 7:75254712-75254734 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084580 7:75254734-75254756 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084606 7:75254800-75254822 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084648 7:75254910-75254932 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084658 7:75254932-75254954 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1027987911 7:85318551-85318573 CAGTGGGTAGGGCTGGGGGAGGG - Intergenic
1028052754 7:86206729-86206751 GGGAGGGGAAGGGTGGGGAAGGG + Intergenic
1028052759 7:86206739-86206761 GGGTGGGGAAGGGTGGGGAAGGG + Intergenic
1028052764 7:86206749-86206771 GGGTGGGGAAGGGTGGGGAAGGG + Intergenic
1028052795 7:86206817-86206839 GGGAGGGGAAGGAAGGGGAAGGG + Intergenic
1028095507 7:86755465-86755487 TGGGGGTTAAGGATGGGAGAGGG + Intronic
1028224194 7:88231006-88231028 GGGTGGGTATGTATGGGTGAAGG - Intergenic
1028579042 7:92385731-92385753 TGGTGTGGGAGGATGGGGGAAGG + Intronic
1028749159 7:94362828-94362850 GGGTGGTGCAGGATGGGGGTGGG + Intergenic
1029159837 7:98543799-98543821 GGCTGGGAAAGGATGGCTGAGGG - Intergenic
1029206140 7:98870257-98870279 GGGTGGGGAGGGATGCGGGGAGG - Intronic
1029328272 7:99828761-99828783 AGGAGGGAAAGAATGGGGGATGG - Intronic
1029392179 7:100282588-100282610 GGGGGGGAAGGGAAGGGGGAGGG - Intergenic
1029492866 7:100881830-100881852 GGGTTGGTAGGCCTGGGGGATGG + Intronic
1029522615 7:101073236-101073258 GGGAGGCTAAGGAAGGAGGATGG + Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029751179 7:102543504-102543526 GGGTGAGTAAGGGTGGGGATTGG - Intronic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029769131 7:102642609-102642631 GGGTGAGTAAGGGTGGGGATTGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1029891711 7:103936650-103936672 GGGAGGGAAAAGTTGGGGGAGGG - Intronic
1030133024 7:106219212-106219234 TGTTGGGGTAGGATGGGGGAAGG + Intergenic
1030330925 7:108269520-108269542 GGGAGGGAAAGGATGGGTGACGG + Intronic
1030768991 7:113450054-113450076 GATTGGGAAAAGATGGGGGATGG + Intergenic
1031089535 7:117337692-117337714 GGGTGGGGTAGGATGGAGAAAGG + Intergenic
1031562948 7:123260385-123260407 GGGAGGGGAAGGAAGGGGAAGGG + Intergenic
1031965742 7:128027151-128027173 GGGGTGGTATGGGTGGGGGAGGG - Exonic
1032123272 7:129172041-129172063 GGGTGTGTAGGGGTGGGGGTGGG + Intergenic
1032167989 7:129560725-129560747 GGGTAGGCAAGGAGTGGGGAAGG - Intergenic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032463110 7:132126311-132126333 GGGTGGGGTAGGATGGGGCTGGG + Exonic
1032651850 7:133887385-133887407 GGGAAGGGAAGGATGGGAGATGG + Intronic
1033414034 7:141146791-141146813 GGGTGGGAAAGGATGGTAGAAGG - Intronic
1033422283 7:141214404-141214426 GGGTGGAGGAGGGTGGGGGATGG + Intronic
1033643403 7:143283910-143283932 GGGTGGGGAAGCATAGGAGAGGG - Intronic
1033715858 7:144001529-144001551 GGATGGGTTAGGATGGGACAAGG - Intergenic
1033808852 7:144986071-144986093 GGGTGTGGGTGGATGGGGGATGG + Intergenic
1034014386 7:147566340-147566362 GGAGGGGAAAGGAAGGGGGAGGG + Intronic
1034128628 7:148696769-148696791 TGGGGGGTAAAGATGGAGGAAGG + Intergenic
1034199320 7:149272891-149272913 GGCTGGGAAGGGTTGGGGGAAGG - Intronic
1034297323 7:149985922-149985944 AGTTAGGAAAGGATGGGGGATGG - Intergenic
1034308629 7:150067793-150067815 TGGTGGGGGGGGATGGGGGATGG + Intergenic
1034467945 7:151240710-151240732 GGGTGGGTCAGTGTGGGGCAGGG + Intronic
1034503718 7:151468668-151468690 GGGTGGGTCAGCTTGGTGGATGG - Intronic
1034570280 7:151950269-151950291 GGGTGTGCAAGGAGTGGGGATGG - Intergenic
1034798222 7:154032850-154032872 GGGTAGGGGGGGATGGGGGATGG - Intronic
1034808701 7:154110932-154110954 AGTTAGGAAAGGATGGGGGATGG + Intronic
1035024110 7:155815292-155815314 AGGTGGGGGAGGGTGGGGGAGGG - Intergenic
1035230625 7:157463741-157463763 GGGTGGGGACGGATGGGGTGAGG - Intergenic
1035265827 7:157689986-157690008 GTGTGGGAAAGGAGGAGGGAAGG - Intronic
1035300959 7:157896926-157896948 GGAGGGGCAAGGGTGGGGGACGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414063 7:158668175-158668197 GGGTCGGTAAGGAAGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035527411 8:324627-324649 GGGGGTGGAGGGATGGGGGAGGG + Intergenic
1035602171 8:903005-903027 GGGTGGGCAGGGGTGGGGGGTGG + Intergenic
1035712478 8:1729302-1729324 GAGTGGGGAAGGTTGGGCGAAGG - Intergenic
1035776385 8:2191475-2191497 GGGGGGGGAAGGGAGGGGGAAGG - Intergenic
1035776454 8:2191611-2191633 GGGGGGGGAAGGGAGGGGGAAGG - Intergenic
1035776505 8:2191706-2191728 GGGGGGGGAAGGGAGGGGGAAGG - Intergenic
1036989939 8:13580894-13580916 GAGGGGGTGAGGATGGGTGAGGG + Intergenic
1037438587 8:18890807-18890829 CTGGGGGTAAGGGTGGGGGAGGG + Intronic
1038151993 8:24950313-24950335 GGCTGGGCAAGGCTGAGGGAAGG + Intergenic
1038155468 8:24985231-24985253 GGCTGGATTGGGATGGGGGAGGG + Intergenic
1038252420 8:25917743-25917765 GGGAGGGGAAGGATGGGGAAGGG - Intronic
1038611260 8:29061832-29061854 GGGTGGGGAGGGATGGGGACAGG - Intronic
1038800538 8:30744779-30744801 GGCAGGGAAGGGATGGGGGAGGG + Intronic
1038807986 8:30812468-30812490 GGGCGGGTGGGGAGGGGGGAGGG - Exonic
1038903801 8:31874737-31874759 GGGAGGGTTGGGGTGGGGGAAGG - Intronic
1039790390 8:40871364-40871386 GAGTGGGTAGGGATGGAGTAGGG - Intronic
1039839344 8:41282274-41282296 GGGAGGCCAAGGTTGGGGGATGG + Intronic
1040102338 8:43516717-43516739 TGGTGGGTGAGGGTGGAGGATGG + Intergenic
1040611319 8:48984984-48985006 GAGTGGGGAAGGATGTGGGTTGG + Intergenic
1040841173 8:51786520-51786542 GTGGGGGTGAGGATGGGGGTCGG - Intronic
1041908913 8:63066968-63066990 GGGTGGCTGAGGTGGGGGGAGGG + Intronic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042543988 8:69934533-69934555 ATGTGGGGAAGGATGGGGGCAGG - Intergenic
1043132117 8:76474399-76474421 CGGTGAATAAGGGTGGGGGATGG + Intergenic
1043334608 8:79159373-79159395 GTGTGGGGAAAAATGGGGGAAGG + Intergenic
1043525486 8:81092111-81092133 GGGAGGCTAAGGAAGGTGGATGG + Intronic
1043667436 8:82833709-82833731 GGGAGGCTAAGGAGGGAGGATGG + Intergenic
1043708521 8:83382481-83382503 GGGAGGGAAAGGAGAGGGGAGGG + Intergenic
1044205141 8:89485140-89485162 GGGTGAGCAAGGAAGGGGAAAGG + Intergenic
1044249695 8:89991186-89991208 GGGTGGGTGGGGTGGGGGGACGG + Intronic
1044370343 8:91402899-91402921 GAGGGGGAATGGATGGGGGAGGG + Intergenic
1044430893 8:92104496-92104518 GGGTTTAAAAGGATGGGGGAAGG - Intergenic
1044643898 8:94417227-94417249 TGGAGGGTAAGGATGGGGTTAGG + Intronic
1045412078 8:101929528-101929550 GGGAGGGAAAGGAAAGGGGAGGG + Intronic
1045990651 8:108303015-108303037 GGGAGGGTAGGAGTGGGGGAAGG - Intronic
1046942858 8:119947910-119947932 GGCAGGGAGAGGATGGGGGAGGG - Intronic
1047718259 8:127615676-127615698 GGGTGGGTTAGGGGAGGGGAAGG - Intergenic
1047763063 8:127968373-127968395 GGGTGGGGTGGGATGGGGGGTGG + Intergenic
1047811832 8:128418782-128418804 GGGTGAGTCGGGATGGGAGATGG + Intergenic
1048705564 8:137149309-137149331 AGGTGGGTCAGAAAGGGGGATGG - Intergenic
1048836689 8:138525465-138525487 GGGTTATTAAGGATGGAGGAGGG - Intergenic
1049033985 8:140060531-140060553 GGATGGGTAGGGATGGGGAATGG - Intronic
1049067815 8:140332306-140332328 GGCTGGGAAGGGTTGGGGGAAGG + Intronic
1049247746 8:141571769-141571791 GTGTGGGAAAGGATAGTGGAAGG - Intergenic
1049419006 8:142508648-142508670 GGCTGGGTAAGTGTGGAGGATGG + Intronic
1049582369 8:143418455-143418477 GGGTGGGTGAGTAGGGGGTATGG - Intergenic
1049641451 8:143717811-143717833 GCGTGGGAGAGGATGGGGGCAGG + Intronic
1049644398 8:143729571-143729593 GGGTGGGCCAGGTTGGGGCACGG + Intronic
1049710857 8:144062746-144062768 GGGTGGCTGGGGATGGTGGAGGG - Intronic
1049884775 9:19526-19548 GGGAGGGGGAGGATGTGGGATGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050228062 9:3484419-3484441 GGGTGGGTAGGGATGAGGAGTGG + Intronic
1051340074 9:16102901-16102923 GGGTGGGTATGGACTGGGGAGGG - Intergenic
1051528903 9:18078002-18078024 GGGTGGGAAGGGATGGAGGAAGG + Intergenic
1051560166 9:18431750-18431772 AGGTGGGTAAGGATTGGTCATGG - Intergenic
1051610674 9:18958691-18958713 CGCTGGGTTAGGATGGGGGTGGG + Intronic
1052305656 9:27006498-27006520 GGGTGGCTGAGGTGGGGGGATGG + Intronic
1052701871 9:31947803-31947825 GGGTGGGGGGAGATGGGGGAGGG - Intergenic
1052825740 9:33172925-33172947 GGAGGGGTAAGGGTGGGGGTGGG + Intergenic
1052974259 9:34400187-34400209 GCGTGGGTGAGGGTGGGGGCAGG + Exonic
1053019811 9:34687044-34687066 GGGTTGGTATGGTTGGGGGGTGG + Intergenic
1053031469 9:34782816-34782838 GGATGGGGTAGGATGAGGGATGG + Intergenic
1053080205 9:35169526-35169548 GGGGGTGGCAGGATGGGGGAAGG - Intronic
1053329263 9:37188705-37188727 GGGTGAGGAAGGGAGGGGGAGGG - Intronic
1053602590 9:39625422-39625444 GGGAGGGAAAGCATGGGGGAAGG - Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053860239 9:42379170-42379192 GGGAGGGAAAGCGTGGGGGAAGG - Intergenic
1054250947 9:62717013-62717035 GGGAGGGAAAGCGTGGGGGAAGG + Intergenic
1054542289 9:66278137-66278159 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1054565053 9:66751526-66751548 GGGAGGGAAAGCGTGGGGGAAGG + Intergenic
1055114328 9:72590883-72590905 GGGTAGGTAAGAGTGGGGTAGGG - Intronic
1055505817 9:76948047-76948069 GGCTGGGGAAGGAGGGTGGATGG - Intergenic
1055521359 9:77084315-77084337 GGTAGGATGAGGATGGGGGAAGG - Intergenic
1055709951 9:79049878-79049900 GGGTGCCTAGGGATGGGAGAAGG + Intergenic
1055778346 9:79790938-79790960 GGGTGGGGCAGGATGAGGGTGGG + Intergenic
1055786950 9:79881520-79881542 GGGAGGGAAAGGATGGGGAGGGG - Intergenic
1056092474 9:83218342-83218364 GGGTTAGTGAGGATGAGGGAGGG - Intergenic
1056766483 9:89447500-89447522 GGGTGGGTCATGGTGGGGGTCGG - Intronic
1057258375 9:93568807-93568829 CAGTGGGGAAGGGTGGGGGAAGG + Intergenic
1057258381 9:93568818-93568840 GGTGGGGGAAGGGTGGGGGAAGG + Intergenic
1057294382 9:93826903-93826925 GGAGGGAAAAGGATGGGGGAGGG - Intergenic
1057499093 9:95582599-95582621 GGGTGAGGGGGGATGGGGGAAGG + Intergenic
1057587728 9:96344715-96344737 GGTGGGGGAGGGATGGGGGAGGG + Intronic
1057694337 9:97312675-97312697 GGGTGGGTTGGGGTGGGGGCTGG - Intronic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058087170 9:100760905-100760927 GGGTGGGTTGGGATGGCTGATGG + Intergenic
1058128779 9:101226265-101226287 GGATGAGTGAGGAGGGGGGAGGG - Intronic
1058226398 9:102369840-102369862 GGCTGGGGAAGAATGGTGGATGG + Intergenic
1058227454 9:102383094-102383116 GGGTGGGGGAGGAGGGGGGAGGG - Intergenic
1058504342 9:105653350-105653372 GGGTGGGAAAAGAATGGGGACGG + Intergenic
1058730095 9:107841485-107841507 GAGTAGGTAAGAATGGGGGTTGG - Intergenic
1059166310 9:112079504-112079526 GGGTGGTTAAGGAAAGGGTAGGG - Intronic
1059404800 9:114093036-114093058 GGCAGGGTGAGGAGGGGGGAGGG + Intronic
1059508376 9:114820409-114820431 GGCTGAGTAAGTATGGCGGACGG - Intergenic
1060300060 9:122369834-122369856 GCTTGGGTGAGAATGGGGGAGGG + Intergenic
1060470494 9:123944022-123944044 GGGAGGCTAAGGTAGGGGGATGG + Intergenic
1060504443 9:124187556-124187578 TGGAGGGTGTGGATGGGGGAAGG - Intergenic
1060879909 9:127110897-127110919 GGATGGGCAAGGCTGGGGCAGGG - Intronic
1060907011 9:127315534-127315556 GGGAGGGTAAGGCAGGAGGATGG + Intronic
1061165517 9:128919942-128919964 GGGTGGGTGGGGGAGGGGGAGGG - Intergenic
1061255826 9:129453834-129453856 GGGTATGGAAGGATGGGGGATGG + Intergenic
1061264190 9:129496197-129496219 GCAGGGGTAAGGTTGGGGGAGGG - Intergenic
1061374487 9:130215932-130215954 GGGAGGAGGAGGATGGGGGAGGG - Intronic
1061690152 9:132321102-132321124 GGCTGGGTAGGAGTGGGGGACGG - Intronic
1061789641 9:133052290-133052312 GGATGGGCCAGGATGGGGGTGGG - Intronic
1061805947 9:133137887-133137909 TGGCTGGTGAGGATGGGGGATGG + Intronic
1061839191 9:133347881-133347903 GGGTGGGGATGGAGGGGGGGTGG - Intronic
1061860262 9:133464329-133464351 TGGTGGATAGGGAAGGGGGATGG + Intronic
1061900075 9:133668429-133668451 GGGAGGGTAAGGGAGAGGGAGGG - Intronic
1061900264 9:133668920-133668942 GGGAGGGTAAGGGAGAGGGAAGG - Intronic
1061900303 9:133669033-133669055 GGGAGGGTAAGGGAGAGGGAAGG - Intronic
1061900336 9:133669130-133669152 GGGAGGGTAAGGGAGAGGGAAGG - Intronic
1061900362 9:133669210-133669232 GGGAGGGTAAGGGAGAGGGAGGG - Intronic
1061916844 9:133759848-133759870 GGGAGGGCAAGGACGGAGGAAGG + Intergenic
1061932071 9:133838445-133838467 GGGTGGGTAAGTAGGTGGGTGGG + Intronic
1061942504 9:133891289-133891311 TGGAGGGAAGGGATGGGGGATGG + Intronic
1061947129 9:133914696-133914718 GGGAGGGGAAGGAGAGGGGAGGG + Intronic
1062087194 9:134654941-134654963 GGGTGTGTAGAGCTGGGGGAGGG + Intronic
1062384723 9:136304666-136304688 GGGTGGGGAAGGAGCTGGGAGGG - Intronic
1062549598 9:137079889-137079911 GGGTGGGACAGGATGGCAGAAGG - Intronic
1062580667 9:137227944-137227966 GGGAGGGGGAGGGTGGGGGAGGG + Intronic
1062591319 9:137276095-137276117 GGTTGGGTAGGGAGGCGGGAGGG + Intergenic
1062619152 9:137411693-137411715 GGGTGGGGGAGGTTGGGGGGAGG + Intronic
1062695490 9:137873704-137873726 GGTTGGAGAGGGATGGGGGAGGG + Intergenic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1203466451 Un_GL000220v1:92963-92985 GGGTGGGTGAGGAAGTAGGAGGG - Intergenic
1185511479 X:667906-667928 GGGAGGGATGGGATGGGGGAGGG - Intergenic
1185511569 X:668097-668119 GAGTGGGAAAGGAGAGGGGAGGG - Intergenic
1185581379 X:1213258-1213280 GGGAGGGGAGGGAAGGGGGAGGG - Intergenic
1185581388 X:1213274-1213296 GGGAGGGGAGGGAAGGGGGAGGG - Intergenic
1185681395 X:1891500-1891522 GGGGGGGGGGGGATGGGGGAGGG - Intergenic
1185915031 X:4025771-4025793 GGGAGGGGATGGATGGGGAAGGG - Intergenic
1186470728 X:9820293-9820315 GGGTGGGAAAGGATGGAGGGAGG - Intronic
1186548696 X:10479456-10479478 GGGTGGGTAGGGATGGTTAATGG - Intronic
1186635668 X:11401594-11401616 GGGGGAGTAGGGGTGGGGGAGGG + Intronic
1187677086 X:21727017-21727039 AGTTGGGTAAGGATGTGAGAGGG - Intronic
1187862392 X:23694775-23694797 GGGCGGGTGGGGATGGGGGTGGG + Intergenic
1188489659 X:30723816-30723838 GGGAGGGTGAGGAGGGAGGATGG - Intronic
1188571385 X:31589257-31589279 GGGTTGGTCAGGTAGGGGGAAGG - Intronic
1188757045 X:33975056-33975078 GGTTGGGTAAGGCTGGAGTAGGG + Intergenic
1188851761 X:35140826-35140848 GGGTGGGGGGGGAGGGGGGAGGG + Intergenic
1188857290 X:35211878-35211900 GGGATGGAGAGGATGGGGGAGGG - Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1189609698 X:42719078-42719100 GGTGGGGTGGGGATGGGGGATGG - Intergenic
1189928446 X:45982418-45982440 GGGAGGGAAAAGATGGGGAAAGG - Intergenic
1190472519 X:50797033-50797055 GAGGGGGAAAGGATGGGGGGAGG + Intronic
1190712169 X:53078978-53079000 GTGTAGGTAAGGGTGGGGGAAGG - Exonic
1191589914 X:62870924-62870946 GGGTCAGCAAGGCTGGGGGATGG - Intergenic
1191868240 X:65723362-65723384 GGGTGTGGTAGGATGGGGTAGGG - Intronic
1192177108 X:68893029-68893051 GAGTGGAGAAGCATGGGGGAGGG + Intergenic
1192191491 X:68994073-68994095 GGGTGGAATAGGATGGGGAAAGG - Intergenic
1192224579 X:69219409-69219431 GGGAGGGGAAGTGTGGGGGAGGG + Intergenic
1192274534 X:69616103-69616125 GGGTGGGAAAGGGAGGAGGAGGG - Exonic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1192596588 X:72414705-72414727 AGGTGGGGAGGAATGGGGGAGGG + Intronic
1192628019 X:72750295-72750317 GGGGGTGGAGGGATGGGGGAGGG - Intergenic
1192653690 X:72970513-72970535 GGGGGTGGAGGGATGGGGGAGGG + Intergenic
1192806104 X:74510810-74510832 GGGAGGCTAAGGAGGGAGGACGG + Intronic
1193018817 X:76767701-76767723 GGGAGGGTAAGGTGGGGAGATGG - Intergenic
1194263420 X:91727089-91727111 GGCTGGGAAGGGATGTGGGAGGG - Intergenic
1195096574 X:101506847-101506869 GGGTGGGGAAGGATGAAGGAAGG - Intronic
1195108463 X:101623036-101623058 GGGAGGGAAAGGAGGGGGGCGGG + Exonic
1195223996 X:102773553-102773575 GGTTGGGGAGAGATGGGGGATGG - Intergenic
1195839223 X:109154503-109154525 GGTTGGGAGAGGCTGGGGGAAGG - Intergenic
1195861477 X:109388038-109388060 GGGGTGAAAAGGATGGGGGAAGG + Intronic
1196031309 X:111097288-111097310 GGGTGGGGTGGGGTGGGGGATGG + Intronic
1196745221 X:119065831-119065853 GGGTGGGGAGAGATGCGGGAGGG - Intergenic
1196745366 X:119066977-119066999 GGGTGGGTTAGGAGAGGTGAGGG + Intergenic
1196973182 X:121131791-121131813 TGGGGGGTAGGGTTGGGGGAGGG - Intergenic
1197013836 X:121599945-121599967 GTGTGCTTGAGGATGGGGGATGG - Intergenic
1197785729 X:130194838-130194860 GGGAGGGCAAGGCAGGGGGATGG + Intergenic
1198033287 X:132776574-132776596 GAGTGAGGATGGATGGGGGAAGG - Intronic
1198231719 X:134696334-134696356 GGGTGGGTAATGAGGGGGAGTGG + Intronic
1198321281 X:135521189-135521211 GCGTAGGAAAGGAGGGGGGAGGG - Intronic
1198394626 X:136208962-136208984 GGGTGGGGGAGGGTGGGGAAGGG + Intronic
1198525077 X:137492650-137492672 GGCTGTGGAAGGAAGGGGGAAGG + Intergenic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1199074174 X:143510859-143510881 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199093168 X:143714120-143714142 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199215167 X:145254040-145254062 AGGTGGAGAAGGAAGGGGGATGG + Intronic
1199607231 X:149586560-149586582 GGGGGGGTGAGGATGGAGGTGGG + Intronic
1199631892 X:149782807-149782829 GGGGGGGTGAGGATGGAGGTGGG - Intronic
1199857353 X:151771057-151771079 GGGTGGGGAGGGGTGGGGGGAGG + Intergenic
1200072882 X:153537709-153537731 GGCTGGGCAAGGAGGAGGGAAGG - Intronic
1200089124 X:153626201-153626223 GGGTGGGCAAGGCTGGGACATGG - Intergenic
1200267900 X:154655613-154655635 CGATGGGTAAGGGTGGGTGAAGG + Intergenic
1200320173 X:155180227-155180249 GGGTGGGGAGGGATGGGGAAAGG - Intergenic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1200401033 X:156020626-156020648 GGGAGGGGGAGGATGTGGGATGG - Intergenic
1200685428 Y:6254495-6254517 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200687814 Y:6273104-6273126 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200909275 Y:8516254-8516276 GGGTGGCTGAGTCTGGGGGAGGG - Intergenic
1200990957 Y:9345736-9345758 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200993616 Y:9366029-9366051 GGGTGAATGAGGATGGCGGAGGG + Intronic
1200996278 Y:9386347-9386369 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200998793 Y:9454902-9454924 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201001448 Y:9475211-9475233 GGGTGAATGAGGATGGCGGAGGG + Intronic
1201004113 Y:9495513-9495535 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201006769 Y:9515825-9515847 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201009421 Y:9536131-9536153 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201047455 Y:9901598-9901620 GGGTGAATGAGGATGGCGGAGGG - Intergenic