ID: 917506820

View in Genome Browser
Species Human (GRCh38)
Location 1:175634933-175634955
Sequence CCTTTGCCATTAAGAGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917506820_917506825 6 Left 917506820 1:175634933-175634955 CCTCATTCTCTTAATGGCAAAGG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 917506825 1:175634962-175634984 AACCAATATCCTAAAGCCACGGG 0: 1
1: 0
2: 1
3: 12
4: 130
917506820_917506824 5 Left 917506820 1:175634933-175634955 CCTCATTCTCTTAATGGCAAAGG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 917506824 1:175634961-175634983 AAACCAATATCCTAAAGCCACGG 0: 1
1: 0
2: 2
3: 12
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917506820 Original CRISPR CCTTTGCCATTAAGAGAATG AGG (reversed) Intronic
903056244 1:20638098-20638120 CCTTGGCCATCAAGATGATGTGG + Exonic
903844902 1:26273361-26273383 CCTTTGCCATTATGTGGATTGGG + Intronic
905377654 1:37534685-37534707 CCTTTGTCAATATTAGAATGAGG + Exonic
911261344 1:95690020-95690042 CCTTTGACACTGAGAGAATGTGG - Intergenic
911778478 1:101844503-101844525 CCTCTGCCATTAACCAAATGGGG + Intronic
913057516 1:115176006-115176028 CCTTTGGGAATAGGAGAATGGGG + Intergenic
917433696 1:174998308-174998330 CCTGAGCAATTAAGAGAACGAGG + Intergenic
917506820 1:175634933-175634955 CCTTTGCCATTAAGAGAATGAGG - Intronic
918825261 1:189315787-189315809 GCTGTGCTTTTAAGAGAATGAGG - Intergenic
919749966 1:201031431-201031453 CCTTTGCCTTAAGGAGAATTTGG + Intergenic
919958663 1:202443654-202443676 CCTTAGCCATTAAGACAAATAGG - Intronic
920577398 1:207071630-207071652 GCTTTGACATCAAGAGACTGGGG + Intronic
921410716 1:214833675-214833697 CCTTTGCTAATAAAATAATGTGG - Intergenic
921821642 1:219623418-219623440 ATCTTGCCATTAAGAAAATGGGG + Intergenic
922343916 1:224680289-224680311 CCTTTTCCAGTCACAGAATGAGG - Intronic
1063354091 10:5381864-5381886 CCCTTTTCATTAAGAAAATGGGG + Intergenic
1067896175 10:50182135-50182157 CCTTGGCCATTTAGGGGATGTGG + Intergenic
1067952803 10:50759866-50759888 CCTTGGCCATTTAGGGGATGTGG - Intronic
1068127608 10:52860622-52860644 GCTTTTCCAATAAGAGTATGAGG + Intergenic
1069250112 10:66256830-66256852 CCTATGCTACTAACAGAATGGGG + Intronic
1070735527 10:78861398-78861420 CCTTTTCCCTGCAGAGAATGAGG + Intergenic
1071158556 10:82719996-82720018 ACTGTGCCATTAAGTGACTGTGG + Intronic
1071458820 10:85872365-85872387 CCTCAGCCATCAAGAGAATATGG - Intronic
1071821494 10:89285565-89285587 GCCTTGCCACTAAGGGAATGTGG - Intronic
1073767892 10:106703512-106703534 CCATTGCCATTAAGAGCATGTGG - Intronic
1075008201 10:118845594-118845616 CCTTTCCCATTCAGATACTGTGG + Intergenic
1075640194 10:124059145-124059167 ACTTTGAGATGAAGAGAATGAGG - Intronic
1076349420 10:129805608-129805630 CCTTGGTCAATAACAGAATGTGG - Intergenic
1080425066 11:32147450-32147472 CCTTTCCCAAAAGGAGAATGGGG - Intergenic
1080957820 11:37121243-37121265 CCTTTGTCCTTAAGAAAATGAGG + Intergenic
1086389891 11:86352659-86352681 CCTTTTCCATTTAGAGCCTGTGG + Intergenic
1087188887 11:95231468-95231490 CCTCTGCCAATAAGAGGACGAGG + Intronic
1087674816 11:101148592-101148614 CCTTTGTAATTAAAACAATGCGG - Intergenic
1087829935 11:102808400-102808422 CACCTTCCATTAAGAGAATGAGG - Intergenic
1090578087 11:128130651-128130673 CCTTTGGCCTTAAGAGAAGATGG - Intergenic
1092045737 12:5430990-5431012 CATTTGCCATCGAGAGAAGGGGG - Intergenic
1093551813 12:20421661-20421683 CCTTTGCTATTAACAGGAAGTGG + Intronic
1093643934 12:21561161-21561183 CTTTTGACATTAATAAAATGAGG - Intronic
1093944788 12:25095627-25095649 GCTTTGGCATTAAGGTAATGTGG + Intronic
1094813614 12:34164128-34164150 CCTATCTCATTAAGAGAATGAGG + Intergenic
1096792146 12:54051985-54052007 CATCTGCAATTAAGGGAATGAGG - Intronic
1097756150 12:63408658-63408680 CCTTAGCTTTGAAGAGAATGGGG - Intergenic
1099535263 12:83835578-83835600 CCTTGTCCAGTAAGAAAATGTGG + Intergenic
1101310502 12:103574523-103574545 TCTTTGCCATCAACAGAATTGGG - Intergenic
1101340657 12:103840130-103840152 CCTTTCCCATCTATAGAATGGGG + Intronic
1104085998 12:125474640-125474662 CTGTTGCCATCAAGAGAATCTGG - Intronic
1104884827 12:132100589-132100611 CAGTTGCCAGTAAGGGAATGAGG - Intronic
1107385063 13:39899207-39899229 CCTTTGACACTGAGTGAATGGGG + Intergenic
1108948286 13:56051780-56051802 CTTTTGATATTAAGAAAATGTGG - Intergenic
1109233871 13:59792087-59792109 CATTTTCAATTAAGAGAACGAGG - Intronic
1109617147 13:64850485-64850507 CCTTTGCCATTATAAGTTTGGGG - Intergenic
1110038145 13:70715294-70715316 CCTTTTCCATTATCAGAATCAGG + Intergenic
1111379268 13:87425174-87425196 CATTTCCCTTTAAGAAAATGGGG + Intergenic
1112153821 13:96795514-96795536 GCTTAGCATTTAAGAGAATGAGG - Intronic
1112686935 13:101840057-101840079 CATTTGCCAAGAAGAGATTGAGG - Intronic
1118663060 14:68036375-68036397 CCTTTGACATTTAGGGTATGTGG + Intronic
1120146157 14:80981383-80981405 TCTTTGCCATTCAGATCATGGGG + Intronic
1121734787 14:96210747-96210769 CCTTTGGCATAAAGAGTTTGGGG + Intronic
1121822294 14:96981285-96981307 CTTTTGCCTGTAAGAGGATGAGG - Intergenic
1124349707 15:28946136-28946158 CGTTTGTCATTCAGAGACTGTGG + Intronic
1125261541 15:37831329-37831351 TCTTTCCCATAAAGAGAAAGTGG + Intergenic
1126305100 15:47246781-47246803 CTTTTGCCATTCTGAGAATCAGG + Intronic
1128440916 15:67707745-67707767 ACTTTGCCACTAGGAGAAAGAGG + Intronic
1130731432 15:86497456-86497478 CCATTGCTTTGAAGAGAATGTGG + Intronic
1135935584 16:26777158-26777180 CCTTTCCCATTCATAGGATGGGG - Intergenic
1140295351 16:73704582-73704604 CATTTACCCTTAAGAGAAAGAGG + Intergenic
1143214861 17:5217214-5217236 TCTTTGCCATTCAGAAAAAGGGG + Intronic
1144585500 17:16485198-16485220 CCTCTCCCATTAAGAGAAACTGG - Intronic
1145909728 17:28535363-28535385 TCTCTGCCATCCAGAGAATGGGG + Intronic
1146932641 17:36788501-36788523 CATTTGCAACCAAGAGAATGTGG - Intergenic
1147429945 17:40364754-40364776 CCTGTTCCTTTAAGAGAAGGGGG - Intergenic
1148818524 17:50346974-50346996 CCTCTGGCTTTAAGGGAATGGGG + Intronic
1151103930 17:71589797-71589819 CTATTGCCATGAAGAGAAGGTGG + Intergenic
1151256130 17:72878193-72878215 CTTGTGCCATTAAGAAAATGTGG - Intronic
1152123235 17:78431663-78431685 CCTGTGCCATGAAGGGAATATGG + Intronic
1153821964 18:8839639-8839661 CCTGTGCCCTGAAGAGAATGGGG - Intergenic
1155946818 18:31862491-31862513 CCAGTACCATTAATAGAATGTGG - Intronic
1159425813 18:68284773-68284795 CATTTACCAGAAAGAGAATGGGG - Intergenic
1160287917 18:77563386-77563408 CCTTTGCCATCATGAGACAGAGG - Intergenic
1160924257 19:1535541-1535563 CCTCTGCCACTAAGAGAAACAGG - Intergenic
1161923180 19:7281815-7281837 CCTTTGCCTTTGTGGGAATGTGG - Intronic
1163332798 19:16651956-16651978 CCTTTGCAAAGACGAGAATGAGG + Intronic
1163332807 19:16652010-16652032 CCTTTGCAAAGACGAGAATGAGG + Intronic
1163332815 19:16652064-16652086 CCTTTGCAAAGACGAGAATGAGG + Intronic
1164953826 19:32363591-32363613 CTTTTGTCGTTAATAGAATGAGG + Intronic
1166823991 19:45598121-45598143 CCTGTGACATTTAGAGAATTAGG + Intronic
927067321 2:19486514-19486536 CTTTTACCACTAAGAAAATGCGG + Intergenic
927151943 2:20201216-20201238 CCTTTGCCATTTAGAAGATGGGG + Exonic
931743706 2:65273136-65273158 CCTTTGCCATTCACAGCAAGTGG + Intergenic
931956427 2:67431085-67431107 ACTCAGCCATTAAGAGAAAGTGG - Intergenic
935508982 2:103947425-103947447 CTTTTGCCATGATGGGAATGTGG - Intergenic
935902986 2:107812373-107812395 ATTTTGCCATGAAGAGAAAGAGG - Intergenic
937100776 2:119266276-119266298 CCTCTGCCTTTAAGAGAACACGG - Intergenic
937234266 2:120421012-120421034 CATTTTCCAATAAGAAAATGAGG + Intergenic
937736488 2:125296948-125296970 CCTTAGGCCTTAAGAGAATATGG - Intergenic
938582930 2:132663608-132663630 CCTTTGCCAAAAATAGAATGTGG + Intronic
939155496 2:138520337-138520359 GCTTTGGCATTAAGAGTATCTGG + Intronic
939631563 2:144532069-144532091 CCTTTGCAAGTGAGCGAATGAGG - Intergenic
941147379 2:161866423-161866445 CATTAGCCCTGAAGAGAATGCGG - Intronic
942062481 2:172240538-172240560 CCTCTTCCATCAGGAGAATGGGG + Intergenic
942369313 2:175265182-175265204 CCTTTGCCATTTGGAGACTTGGG + Intergenic
942555782 2:177171107-177171129 CCTTTGCCATCAATACAAAGTGG - Intergenic
944028950 2:195209052-195209074 CCATAGTAATTAAGAGAATGCGG - Intergenic
945011909 2:205473220-205473242 CCTTTCCCATTAATAAAAAGGGG + Intronic
945644354 2:212470517-212470539 ACTTTGCCATTCAAAGAATAAGG - Intronic
1170501470 20:16979039-16979061 TCTTTGCCATTAACTGAATATGG + Intergenic
1170550316 20:17470782-17470804 CCTTTTGCAATAAGGGAATGAGG - Intronic
1170565276 20:17598022-17598044 TCTTGGCCATTAAAAAAATGAGG - Intronic
1170874901 20:20241222-20241244 CCTATGTCATAAAGAAAATGGGG - Intronic
1177665109 21:24146599-24146621 GATTTGCTATTAAGAGAATAAGG + Intergenic
1177665595 21:24153670-24153692 CCTTTGCTGTTTAGAGAATAAGG + Intergenic
1179367168 21:40769304-40769326 CATTTTCCATTTAGGGAATGTGG + Intronic
1179469326 21:41600102-41600124 CCTATGGCATCAAGAGGATGGGG + Intergenic
1182309982 22:29397687-29397709 CCTATCCCAATAGGAGAATGGGG - Intronic
950193994 3:10996160-10996182 CCAGTGCCCTTCAGAGAATGGGG - Intronic
956657919 3:71570049-71570071 CTTTGTCCATGAAGAGAATGGGG - Intronic
957166109 3:76675972-76675994 CCCTTGCCATTAAGTGGATACGG + Intronic
958434844 3:94083665-94083687 CATTTGCCATGCAGAAAATGTGG + Intronic
962103490 3:132366865-132366887 ACATTATCATTAAGAGAATGAGG - Intronic
962132073 3:132691040-132691062 CTTTTGACATTAACAGAATAGGG + Intronic
962942400 3:140137538-140137560 TCTTTGCCATCAAGAGCTTGGGG - Intronic
966793308 3:183692533-183692555 CCTTTGCCCTGAAGGTAATGGGG + Intergenic
971452737 4:26815167-26815189 CATTTGCCAATAAGAAATTGTGG + Intergenic
976468827 4:85403370-85403392 CCTTTGTAATTAAGCAAATGTGG + Intergenic
977612030 4:99045912-99045934 ACATAGCCATTAAAAGAATGAGG - Intronic
979444675 4:120797590-120797612 CTTTTGTCATTAAGACAAAGAGG + Intronic
980900242 4:138898067-138898089 CCTTGGCCAATCAGAGAATTAGG - Intergenic
984389926 4:179116453-179116475 CCTTTGTTATTGAGAGAAGGGGG + Intergenic
984814104 4:183821485-183821507 CCATGACCCTTAAGAGAATGCGG + Intergenic
987151331 5:15043771-15043793 CCTTTTCCATTAAGAGACTATGG - Intergenic
990690036 5:58353804-58353826 TCTTTTCAATTAAGGGAATGTGG - Intergenic
991604328 5:68385077-68385099 GCTTTGACAGGAAGAGAATGAGG + Intergenic
991946810 5:71906115-71906137 ACTTTGACATTAATAGAATAAGG - Intergenic
992047739 5:72912784-72912806 CCTTTGCCATGAGGAAAAAGTGG + Exonic
992570817 5:78055158-78055180 CCTTTGCCATGAAGAAAACCAGG - Intronic
993337922 5:86684491-86684513 CCTTTGACATTAAGTGTATTTGG + Intergenic
995122278 5:108549011-108549033 CATTTAACATTAAGAGAAAGGGG + Intergenic
998504155 5:142658539-142658561 CCTTTGTGAATAAGAGAGTGTGG + Intronic
999729143 5:154462665-154462687 CCTTTGCCATTCAGTGTGTGAGG - Intergenic
1001066486 5:168538822-168538844 CCTGTGGCATTAAGAGAAGCTGG - Intergenic
1002795529 6:468237-468259 CCTTTTCCATGAAGAGTATTAGG + Intergenic
1002829909 6:810565-810587 CCCTTGACATAAAGAGGATGGGG - Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1008409213 6:51153790-51153812 CCTTGGCCATTCAAAGAAAGAGG + Intergenic
1009878705 6:69538547-69538569 CCTTTGTCCTCCAGAGAATGTGG - Intergenic
1010067693 6:71704302-71704324 CCTTTACTATTAAAAGAAAGAGG - Intergenic
1015277767 6:131402510-131402532 CCTCTGGGATTAAGAAAATGTGG + Intergenic
1015605392 6:134950160-134950182 CCTTTACCAATCAGTGAATGTGG + Intergenic
1017219359 6:151948562-151948584 AGTTTGCCACTAAAAGAATGAGG - Intronic
1017488785 6:154926067-154926089 CCTTTGCCAGTAAGAGTAACTGG - Intronic
1017732582 6:157330587-157330609 CCTTTAGGATTCAGAGAATGGGG + Intergenic
1018719085 6:166558679-166558701 CCTTTTCCGTTAACAGCATGGGG - Intronic
1019409546 7:900607-900629 CCTTTGCCCCTAGGAGATTGTGG - Exonic
1019698866 7:2462865-2462887 CCTTTGCAATAAATAAAATGTGG + Intergenic
1027829296 7:83156686-83156708 CCTTTGCACTTAATAGAATCTGG + Intronic
1032993914 7:137424624-137424646 CCTTTGCTAGTCAGAGAAAGGGG + Intronic
1035474344 7:159131282-159131304 CCTTTGGCATAAAGAGTTTGGGG - Intronic
1036134030 8:6142432-6142454 CCATCTTCATTAAGAGAATGTGG - Intergenic
1037071768 8:14659548-14659570 CCTTTGCCATTACGTGTATTTGG - Intronic
1041182612 8:55264271-55264293 CCTTTGCCTTTATCAGTATGTGG + Intronic
1044701502 8:94969223-94969245 CCTTTGGAAATAAGAGGATGAGG + Intronic
1044741739 8:95334743-95334765 CATTTGGCACCAAGAGAATGGGG - Intergenic
1045182465 8:99799402-99799424 TCTTTCCCAGTAAGGGAATGTGG - Intronic
1051161658 9:14214939-14214961 CCATGCCCATTAAGAAAATGTGG + Intronic
1056083400 9:83120791-83120813 CCTTTGTTCTTAAAAGAATGAGG - Intergenic
1056945510 9:90992243-90992265 CCTTTGCCATTTAGGGAATAGGG + Intergenic
1057202881 9:93152295-93152317 CCTTTGCTTTTAAGAGAAAAGGG - Intergenic
1059597143 9:115733482-115733504 CCCCTGCGAGTAAGAGAATGAGG - Intergenic
1060003753 9:119981556-119981578 CCTTTGCCTTTAATATAATCTGG - Intergenic
1185876582 X:3706821-3706843 TCTTTCCCATTAAGAAAATAAGG + Intronic
1187307698 X:18111516-18111538 CGTTAGCCATTAAGGAAATGTGG + Intergenic
1189094903 X:38127829-38127851 CCTTTGGCTTAAAGAGGATGAGG - Exonic
1190939108 X:55023888-55023910 CATTGGCCGTGAAGAGAATGGGG + Intronic
1195857049 X:109342922-109342944 CCATTGCCAGTTAGAGTATGAGG + Intergenic
1196613733 X:117743416-117743438 CCTTTTCCATGCAGAGACTGTGG + Intergenic
1197652715 X:129083391-129083413 CATTTGCCTTTGAGAGAAAGTGG - Intergenic
1197924967 X:131636635-131636657 CCTATGGCATTCAGAGCATGGGG + Intergenic
1198791863 X:140354907-140354929 CCTTTACCATTGGGAGAATGGGG - Intergenic
1199267284 X:145843413-145843435 CCTTGGCCTTTCTGAGAATGTGG + Intergenic
1200704959 Y:6434786-6434808 CTTGTGCAATTAAAAGAATGTGG + Intergenic
1200705902 Y:6442232-6442254 CTTGTGCAATTAAGGGAATGCGG + Intergenic
1200706851 Y:6450372-6450394 CTTGTGCAATTAAGGGAATGAGG + Intergenic
1200708597 Y:6464045-6464067 CTTGTGCAATTAAGGGAATGAGG + Intergenic
1200710049 Y:6475135-6475157 CTTGTGCAATTAAGAGGATGTGG + Intergenic
1200912994 Y:8547495-8547517 CTTGTGCAATTAAGATAATGTGG - Intergenic
1200915768 Y:8569902-8569924 CTTGCGCAATTAAGAGAATGTGG - Intergenic
1200919245 Y:8598545-8598567 CTTGTGCAATTAAGAAAATGTGG - Intergenic
1200922011 Y:8621674-8621696 CTTCTGCAATTAAGGGAATGAGG - Intergenic
1200929554 Y:8684746-8684768 CTTGTGCAACTAAGAGAATGTGG + Intergenic
1200930688 Y:8694316-8694338 CTTGTGCAATTAAGGGAATGTGG + Intergenic
1200931965 Y:8705022-8705044 CTTGTGCAATTAAGAGAATGGGG + Intergenic
1200932530 Y:8710004-8710026 CTTTTGCAATTAAGGGAATGTGG + Intergenic
1200934107 Y:8723311-8723333 CTTGTGCAATTAAGGGAATGTGG + Intergenic
1200935111 Y:8731575-8731597 CTTGTGCAATTAAGGGAATGTGG + Intergenic
1200938905 Y:8762281-8762303 CTTGTGCAATTAAGGGAATGTGG + Intergenic
1200960277 Y:8990221-8990243 CTTTTGCAATTAAGGGAATGTGG - Intergenic
1200962385 Y:9007433-9007455 CTTGTGCAATTAAGGGAATGCGG - Intergenic
1200980332 Y:9258224-9258246 CCTGTGCAGTTAGGAGAATGTGG - Intergenic
1200984492 Y:9291187-9291209 CTTGTGCAATTAAGTGAATGTGG + Intergenic
1201024066 Y:9689573-9689595 CTTGTGCAATTAAGAGGATGTGG - Intergenic
1201025515 Y:9700663-9700685 CTTGTGCAATTAAGGGAATGAGG - Intergenic
1201027261 Y:9714336-9714358 CTTGTGCAATTAAGGGAATGAGG - Intergenic
1201028208 Y:9722476-9722498 CTTGTGCAATTAAGGGAATGCGG - Intergenic
1201029152 Y:9729922-9729944 CTTGTGCAATTAAAAGAATGTGG - Intergenic
1201038469 Y:9806079-9806101 CTTTTGCAACTAAGGGAATGTGG - Intergenic
1202128901 Y:21592654-21592676 CTTGTGCAATTAAGGGAATGCGG - Intergenic
1202130432 Y:21604103-21604125 CCTGTGCAGTTAAGAGAATGTGG + Intergenic
1202149109 Y:21828807-21828829 CTTGTGCAATTAAGAAAATGTGG - Intergenic
1202178953 Y:22122973-22122995 CCTGTGTAATTAAGGGAATGTGG + Intergenic
1202179155 Y:22124709-22124731 CTTGTGCAATTAAAAGAATGTGG + Intergenic
1202182586 Y:22152182-22152204 CTTGTGCAATTAAGGGAATGAGG + Intergenic
1202183073 Y:22156125-22156147 CTTTTGCAAATAAGGGAATGCGG + Intergenic
1202208286 Y:22430276-22430298 CTTTTGCAAATAAGGGAATGCGG - Intergenic
1202208774 Y:22434220-22434242 CTTGTGCAATTAAGGGAATGAGG - Intergenic
1202212206 Y:22461685-22461707 CTTGTGCAATTAAAAGAATGTGG - Intergenic
1202212408 Y:22463421-22463443 CCTGTGTAATTAAGGGAATGTGG - Intergenic