ID: 917509110

View in Genome Browser
Species Human (GRCh38)
Location 1:175655680-175655702
Sequence GTTTCTTTGCTAATGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917509110_917509119 24 Left 917509110 1:175655680-175655702 CCCACCACCATTAGCAAAGAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 917509119 1:175655727-175655749 TGTTCTGGTCATTTCCAGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 170
917509110_917509118 9 Left 917509110 1:175655680-175655702 CCCACCACCATTAGCAAAGAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 917509118 1:175655712-175655734 CTTATATAAGTGGGTTGTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 109
917509110_917509114 -1 Left 917509110 1:175655680-175655702 CCCACCACCATTAGCAAAGAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 917509114 1:175655702-175655724 CAGCCATGACCTTATATAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 76
917509110_917509120 25 Left 917509110 1:175655680-175655702 CCCACCACCATTAGCAAAGAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 917509120 1:175655728-175655750 GTTCTGGTCATTTCCAGAGTGGG 0: 1
1: 0
2: 3
3: 10
4: 134
917509110_917509121 26 Left 917509110 1:175655680-175655702 CCCACCACCATTAGCAAAGAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 917509121 1:175655729-175655751 TTCTGGTCATTTCCAGAGTGGGG 0: 1
1: 0
2: 1
3: 17
4: 243
917509110_917509115 0 Left 917509110 1:175655680-175655702 CCCACCACCATTAGCAAAGAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 917509115 1:175655703-175655725 AGCCATGACCTTATATAAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917509110 Original CRISPR GTTTCTTTGCTAATGGTGGT GGG (reversed) Intronic
904946485 1:34202583-34202605 GTCTCTTTGCTAGTTGTGGCTGG + Intronic
906836424 1:49087060-49087082 GTTTTTTTGTTGGTGGTGGTGGG - Intronic
908479896 1:64528687-64528709 GTTGCTTTGCTAAAAGTAGTGGG + Intronic
909858866 1:80577183-80577205 GTTACTTTACAAATGATGGTAGG + Intergenic
910447430 1:87312987-87313009 GTGTCTTTAATAATGTTGGTGGG - Intergenic
910599186 1:89012319-89012341 GTTCCTTTCCTGATGGTGCTTGG - Intronic
910603551 1:89057422-89057444 GTTCCTGTCCTAATGTTGGTTGG - Intronic
913315117 1:117543151-117543173 TTTTTTTTTCTAAGGGTGGTAGG + Intergenic
915840739 1:159210992-159211014 GTTTCTTTTCTAGTGTTGGAGGG - Intergenic
915893960 1:159796800-159796822 GTTACTTTACTAAAGGTGGTTGG - Intergenic
916641497 1:166733200-166733222 TTTTCTTTGTTAATCGAGGTAGG - Intergenic
917509110 1:175655680-175655702 GTTTCTTTGCTAATGGTGGTGGG - Intronic
918794129 1:188871052-188871074 GTTTCCTTGTGAATGGTGCTAGG - Intergenic
919992462 1:202717986-202718008 GTGGCTTTGCTGATGGTGGGTGG + Intergenic
920793206 1:209112440-209112462 GTCTCATAGCTAAGGGTGGTGGG - Intergenic
920808522 1:209258244-209258266 GTGTCTTTGCTATTAATGGTAGG - Intergenic
922374541 1:224948087-224948109 GTTTGTTTGCTAGTTTTGGTAGG + Intronic
1064354016 10:14601833-14601855 TTTTCTTTGGGAATGGTGGAGGG - Intronic
1065078308 10:22102872-22102894 GTTTCTTTGCTACTGGTCTTTGG - Intergenic
1066214308 10:33271183-33271205 GTTCCTTTGTCTATGGTGGTGGG + Intronic
1066245507 10:33579893-33579915 GTTGCTTCGCTAATTCTGGTGGG - Intergenic
1066611749 10:37255926-37255948 ATTTCTTTGTTAATTGTGATAGG - Intronic
1069335951 10:67350599-67350621 TTTTCTTTGTTGTTGGTGGTGGG - Intronic
1070369394 10:75767697-75767719 GTGTCTTTGGTACTGATGGTAGG + Intronic
1070667022 10:78352197-78352219 ATCTCTTAGATAATGGTGGTTGG + Intergenic
1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG + Intronic
1071064552 10:81614912-81614934 GTTTCGGTGGTAATGGTGGTGGG - Intergenic
1072271103 10:93777823-93777845 ATTGCTTTTCTAATTGTGGTTGG - Intronic
1072571779 10:96664439-96664461 ATTTCTTTGATAATGGGGGTAGG + Intronic
1073586333 10:104713684-104713706 GTTGATTTGCTAATATTGGTTGG + Intronic
1075281021 10:121138507-121138529 ATTTCTCTGCTGATGGTGTTTGG - Intergenic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1076359019 10:129873743-129873765 CTTTTTTGGCTAATGGGGGTGGG + Intronic
1076808132 10:132869667-132869689 GCTTCTCTGCTTATTGTGGTGGG - Intronic
1079105065 11:17565810-17565832 GTGTATATGCTAGTGGTGGTGGG + Intronic
1079551977 11:21711038-21711060 GTTTCTCTGCTTATGGAAGTTGG - Intergenic
1080943106 11:36941297-36941319 GTTTCTTTGCTTCTGCTGGGAGG - Intergenic
1081711855 11:45221972-45221994 GTTTCTTTGTAATTGGAGGTAGG + Intronic
1086045944 11:82532037-82532059 GTTTCTTTGCTAATATTCTTAGG - Intergenic
1088000441 11:104873891-104873913 CTTTCTTTGTAAATGGTAGTGGG + Intergenic
1088622099 11:111695861-111695883 GTGCCTTTGCTAATGATGTTTGG + Intronic
1089177946 11:116561754-116561776 CTTTCTTTGCAAAGGCTGGTTGG - Intergenic
1090964680 11:131588142-131588164 TTTTATTTGCTAATTGTGGCTGG - Intronic
1091925881 12:4348335-4348357 GTTTCTTTACTTATCCTGGTTGG - Intronic
1096422440 12:51470879-51470901 GTTTTTTTGCTATTGATAGTGGG + Intronic
1097606004 12:61755182-61755204 ATTTCTTTTCTAAATGTGGTAGG + Intronic
1098109485 12:67107376-67107398 GTTTCAGTGGTAATGGTGGTGGG + Intergenic
1101222050 12:102651780-102651802 TTTTCTCTGCAAATTGTGGTGGG - Intergenic
1105226536 13:18439798-18439820 ATTTCTTTGTTAATTGTGATAGG - Intergenic
1105974652 13:25462817-25462839 GTATCTTTGCTATTCATGGTGGG - Intronic
1106774519 13:32995778-32995800 GTTTCTTTGCCGGTGGTGCTTGG - Intergenic
1111420514 13:88005072-88005094 GTTTCGTTGGTAGTAGTGGTGGG + Intergenic
1111644985 13:91021521-91021543 GTGTCTGTGGTGATGGTGGTGGG - Intergenic
1116548601 14:46205092-46205114 GTTTCTTTAAAAATGGTGTTGGG + Intergenic
1118622576 14:67627084-67627106 GTTTCTTTCCGAAGGGTGATGGG + Intronic
1119964063 14:78893393-78893415 GTATCTTTCATAATGGTGGTGGG + Intronic
1120032043 14:79652881-79652903 GTTGCTTTTATTATGGTGGTTGG + Intronic
1120474405 14:84969409-84969431 GTTTCATTATTATTGGTGGTGGG - Intergenic
1121048796 14:90806462-90806484 GTTTCTTTGCAAAGGGTGCAGGG - Intronic
1122961390 14:105095253-105095275 GTCTATTTTCTAATGGTGTTTGG + Intergenic
1125553601 15:40566201-40566223 GTTACTTGGCTACTGATGGTTGG - Intergenic
1129115798 15:73364696-73364718 GTTTCTTTTCTATTGGGGGGTGG + Intronic
1129591788 15:76921582-76921604 GTTTCTTTCCTAGTGGTAGATGG + Intergenic
1131641945 15:94302350-94302372 CTTTCTTTGCTGATGCTGGTGGG - Intronic
1131962774 15:97807075-97807097 GTTTCTGTGCAGATGGGGGTGGG - Intergenic
1132613569 16:829386-829408 TTTTCTTTCCTAATGATGGGGGG - Intergenic
1133556365 16:6909887-6909909 GTTCCTTTGCTAATTCTGTTCGG + Intronic
1134447502 16:14342111-14342133 GAGTCATTGCTAATGGTGGCAGG - Intergenic
1134656652 16:15952614-15952636 CTTTCTTTTCTCATGGGGGTGGG + Intronic
1136136971 16:28262142-28262164 GTTTCTTTGCTGCTGGAGGAGGG + Intergenic
1140756692 16:78074093-78074115 GATTCTTGGCTAGAGGTGGTAGG + Intergenic
1142416548 16:89946514-89946536 GGCTCTTTGCTTCTGGTGGTTGG + Intergenic
1143718292 17:8791886-8791908 GTGTCTTTTTTACTGGTGGTTGG + Intergenic
1144055800 17:11539523-11539545 GTTTATCTGCTAAGGGAGGTGGG - Intronic
1147413610 17:40272331-40272353 TTTTCATTGGTGATGGTGGTGGG + Intronic
1147485545 17:40809187-40809209 GTTTCTTTGCTGTTTCTGGTGGG - Intergenic
1152855884 17:82664290-82664312 GGTGCTGTGCTGATGGTGGTGGG + Intronic
1154526847 18:15299682-15299704 ATTTCTTTGTTAATTGTGATAGG + Intergenic
1155481001 18:26287414-26287436 GTTTTTTTGCTAAACTTGGTAGG + Intronic
1156346734 18:36263872-36263894 GTTTCTTTTGTATTGGTGTTTGG + Intronic
1159029464 18:63216105-63216127 GTTTGTTTGTTTTTGGTGGTGGG + Intronic
1164069123 19:21750216-21750238 GGTTCTTTGCTATTTGTGATTGG - Intronic
1168527957 19:57103735-57103757 GATTCTTTGCTGTTGGGGGTGGG + Intergenic
1168693624 19:58392799-58392821 GTTTTTTTCCTCATGGTGGATGG + Intronic
926867276 2:17373579-17373601 GTTTCTCTGCTATTGCTGTTGGG + Intergenic
926978548 2:18540011-18540033 TTTTCTATGCTAATGGTTTTTGG + Intergenic
928353009 2:30580160-30580182 GTGTCTTTACTAATGGTTTTGGG + Intronic
929515538 2:42603214-42603236 GTTTTTACCCTAATGGTGGTTGG + Intronic
930389120 2:50737816-50737838 GTTTTTGGGCTACTGGTGGTGGG - Intronic
930932319 2:56901861-56901883 GTTTCTTTGCAAATAGTAGAGGG + Intergenic
932898032 2:75663488-75663510 GTTTTTTTGTCATTGGTGGTAGG - Exonic
934742946 2:96739137-96739159 GTCTCTTTGCTAATGCTTATGGG - Intronic
937359084 2:121216805-121216827 GACTCTTTTCTAAAGGTGGTGGG - Exonic
938525944 2:132131039-132131061 ATTTCTTTGTTAATTGTGATAGG + Intergenic
938564654 2:132507897-132507919 GATTCTTTGTTAATTGTGCTGGG - Intronic
941201334 2:162514342-162514364 GTTACTTTACTAATGGTTTTTGG - Intronic
941438509 2:165503502-165503524 GTTTTTCTGTTAATAGTGGTGGG - Intronic
943295770 2:186136255-186136277 TTTCCTTTGCTAATATTGGTTGG + Intergenic
943700049 2:190979931-190979953 GAGTCTTTGCAAATGATGGTGGG - Intronic
947442153 2:230132783-230132805 GTGTCTTTAGCAATGGTGGTGGG + Intergenic
948788189 2:240363954-240363976 GTTTCTTTTCTAAAAGCGGTGGG - Intergenic
1169366879 20:4999852-4999874 GTTTCTTTGCTTAGAGTGGAGGG - Intronic
1170678056 20:18500460-18500482 GTCCCTTTGTTAATGGTGGAGGG - Intergenic
1171195383 20:23193548-23193570 GTTTGTTTGTTATTTGTGGTGGG + Intergenic
1173089263 20:39954670-39954692 GTTTCTTTCCCAGTTGTGGTAGG - Intergenic
1173507551 20:43599951-43599973 TTTACTTTTTTAATGGTGGTGGG - Intronic
1174094602 20:48078310-48078332 GTTCCTTTGTTAAAGGTGTTTGG + Intergenic
1174770272 20:53293075-53293097 GCCTTTGTGCTAATGGTGGTGGG - Intronic
1176770586 21:13068823-13068845 ATTTCTTTGTTAATTGTGATAGG - Intergenic
1177639748 21:23831566-23831588 ATTTCTTGGCTAATGGAAGTTGG + Intergenic
1178141759 21:29692255-29692277 GTTCCATTGCTAAATGTGGTTGG + Intronic
1179052033 21:37896496-37896518 GTGTCTTTGCTAGTGGTGCCTGG + Intronic
1179243468 21:39611372-39611394 GTTTTTTTAATAAAGGTGGTGGG - Intronic
1180517678 22:16162916-16162938 ATTTCTTTGTTAATTGTGATAGG - Intergenic
1181968136 22:26670965-26670987 TTTTTTTTTCTAATGGTGGGAGG + Intergenic
1182584287 22:31334942-31334964 GTGTCTGTGCTAAAGGAGGTTGG - Intronic
949761055 3:7471433-7471455 GTTTCTCTGCTGACAGTGGTGGG + Intronic
950742801 3:15063568-15063590 GTTTCTTTGTTCCTGGTGGTAGG - Intronic
950918453 3:16668626-16668648 TTTTATTTGCTAATGCAGGTAGG - Intronic
952112595 3:30141291-30141313 GCTTCATTTCTAATGTTGGTTGG + Intergenic
952181989 3:30926609-30926631 ATCTCTTAGCTAATGGTGTTTGG + Intergenic
955772959 3:62404905-62404927 TTTTTTTTGTTAATGGTTGTTGG + Intronic
955919833 3:63943959-63943981 GTTTCCTTGCTAAAAGTTGTAGG + Intronic
956714416 3:72065764-72065786 GTTTATATTCTAGTGGTGGTGGG + Intergenic
957613425 3:82498218-82498240 GGTTCTGTGGCAATGGTGGTGGG - Intergenic
960949827 3:122992170-122992192 TTTTCTTTGCAAACAGTGGTGGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
964367393 3:155964874-155964896 GTTTCTTTGTTGATGGTAGTTGG - Intergenic
966408388 3:179623133-179623155 TTTTCTGTCCTAATGGTGATAGG + Intronic
966672619 3:182544918-182544940 GTTTCTGTGGTCATGGAGGTGGG - Intergenic
971017164 4:22500203-22500225 CTTTCTTTGGTAGTGGTGTTGGG - Intronic
972177863 4:36429460-36429482 CTTTTTTTGTTATTGGTGGTAGG - Intergenic
973742605 4:53933039-53933061 GATTATTTGCTGATGGTGATGGG - Intronic
974200526 4:58633353-58633375 GTTTCTTTTATGATGGTGCTTGG - Intergenic
975648603 4:76569573-76569595 TTTTCTTTCTTACTGGTGGTAGG + Intronic
976569852 4:86594932-86594954 TTTTCTTTGGTTTTGGTGGTGGG + Intronic
976841089 4:89433179-89433201 GTTTTTTCACTAATGGGGGTGGG - Intergenic
977122323 4:93118249-93118271 GTTCCTTTTCTCATGGTTGTTGG + Intronic
982419235 4:155175176-155175198 GTTTTTTTGCAAATGGTACTCGG - Intergenic
986399013 5:7361349-7361371 GTTTCTTTGATGAAGGTAGTCGG - Intergenic
986640786 5:9869764-9869786 TTCTCTTTGCTAATTGTGGTTGG + Intergenic
987162675 5:15160538-15160560 GTTTCTTTGAATCTGGTGGTGGG + Intergenic
987168251 5:15223654-15223676 CTTTCTTTGCAAATTGTGTTAGG + Intergenic
987993697 5:25248054-25248076 GCTTCATTACTAGTGGTGGTTGG + Intergenic
988696552 5:33627296-33627318 GTTGATTTGATGATGGTGGTGGG + Intronic
990144809 5:52747296-52747318 GTTACTTTCTTAATGGTAGTTGG - Intergenic
990861012 5:60327370-60327392 GTTTCTTTTCTCTTGGTAGTAGG + Intronic
992185686 5:74242131-74242153 CTTTCTTAGATCATGGTGGTGGG - Intergenic
993649907 5:90507649-90507671 GATTATTTGTTAATGTTGGTAGG + Intronic
993931505 5:93947385-93947407 GTTTCTTTGCTAAAGGTACCAGG - Intronic
995204947 5:109469069-109469091 CTTTCTTTTTTAATGCTGGTTGG - Intergenic
995256590 5:110053720-110053742 GTTAATTTGCTGATGGTAGTAGG + Intergenic
996141512 5:119914753-119914775 TTTTCCTTGCTAGTGGTGTTTGG + Intergenic
1000681867 5:164194986-164195008 GTTTCTTTGCATAAGATGGTGGG + Intergenic
1001172956 5:169438826-169438848 GTTTCTTTGCAAGGGGTGGTGGG - Intergenic
1002767201 6:252451-252473 TTTTTGTTGCTGATGGTGGTTGG - Intergenic
1004317457 6:14602467-14602489 GTTTCACTGCTAACAGTGGTTGG - Intergenic
1004456637 6:15797597-15797619 GTGTCTTTGCTATTCATGGTGGG + Intergenic
1008546425 6:52587798-52587820 GATTCTTTGCTGATGATGTTGGG + Intergenic
1008958608 6:57243275-57243297 GTTTGTGTGCTACTGATGGTTGG + Intergenic
1009195141 6:60675834-60675856 GTTTCTTTGTTCATGGTGTTAGG + Intergenic
1009510355 6:64543648-64543670 GTTTATTTGCAAATAGTGTTTGG - Intronic
1010157373 6:72810539-72810561 GTTTCCCTGCTAATGCTGGAGGG - Intronic
1011748299 6:90429663-90429685 GTTTATTTGTTTATGGTGGTAGG - Intergenic
1016631339 6:146236471-146236493 GTTTCTCTGTGACTGGTGGTAGG + Intronic
1017340780 6:153319546-153319568 ATTTCTTTGTTAATGGTGAAAGG - Intergenic
1020573443 7:9895791-9895813 GTCTTTTTCATAATGGTGGTGGG + Intergenic
1022134650 7:27435935-27435957 GATCCTTTGGTTATGGTGGTTGG + Intergenic
1026527348 7:71166133-71166155 TTTTCTTTGCAAATGGACGTTGG + Intronic
1030523401 7:110625841-110625863 TTTTCCTAGCTACTGGTGGTGGG - Intergenic
1033302573 7:140199540-140199562 GTTTGTTTGCTATTAGTGCTAGG - Intergenic
1033659228 7:143392298-143392320 TTTACTTTGCTAATGGTTTTTGG - Intronic
1033668321 7:143464882-143464904 GTTACTTTTGTAATGGTGGTGGG + Intergenic
1033818691 7:145107153-145107175 GTTTCTTTGATTATGTGGGTGGG + Intergenic
1034363752 7:150526291-150526313 GTTTCTTCAATAATGGTGTTGGG - Intergenic
1037069479 8:14625976-14625998 TTTTCTTTGCAAATGGAGTTTGG - Intronic
1038132511 8:24748791-24748813 GGTTTTTTGGTGATGGTGGTGGG - Intergenic
1038408384 8:27339781-27339803 TTTCCTTTACTGATGGTGGTTGG + Intronic
1039307931 8:36283805-36283827 GTTTCTTCAATAATGGTGCTGGG - Intergenic
1039531006 8:38262399-38262421 GTTTCTTTCCTAGTGGTGAGGGG + Exonic
1040791480 8:51235341-51235363 GGTTTTTTGCCAGTGGTGGTAGG + Intergenic
1041107404 8:54456857-54456879 GCTTCTTTGCTAATGCTGGAGGG + Intergenic
1041749171 8:61240195-61240217 GCTTTTATTCTAATGGTGGTGGG - Intronic
1046090203 8:109494031-109494053 GTTTTTTTAAAAATGGTGGTGGG - Intronic
1046265239 8:111822644-111822666 GTTCCTTTCCTCATGGTGGAAGG - Intergenic
1047557688 8:125950444-125950466 GATGCTTTGTTAGTGGTGGTGGG - Intergenic
1050700426 9:8332434-8332456 ATTTGTTTGCTAATAGTCGTTGG - Intronic
1050778082 9:9293563-9293585 TGTTCATTGCTACTGGTGGTTGG + Intronic
1056164079 9:83925025-83925047 GTTTCTTTAAAAATGGGGGTGGG + Intergenic
1058620106 9:106873825-106873847 GCTTTTCTGCAAATGGTGGTTGG + Intronic
1059833142 9:118120999-118121021 GTTTCTATGCATATGGTGGGTGG + Intergenic
1060474714 9:123978118-123978140 TTTTCCTTGCTAGTTGTGGTGGG - Intergenic
1060476648 9:123992005-123992027 TTTTCCTTGCTAGTTGTGGTGGG + Intergenic
1187030452 X:15482183-15482205 TCTTATTTGCTAATGGTTGTTGG - Intronic
1187162634 X:16779032-16779054 GGTTATTTTCTACTGGTGGTGGG - Intergenic
1188739742 X:33763852-33763874 GTTTCAGTGTCAATGGTGGTAGG + Intergenic
1189164218 X:38844009-38844031 GCTTCTTTGCTAATAGTTTTAGG + Intergenic
1190476068 X:50828733-50828755 GTTTCTTTGGTCATTGTGGTTGG - Intergenic
1190530245 X:51367844-51367866 GTGTCCTTGCTGGTGGTGGTGGG - Intergenic
1190555544 X:51631180-51631202 CTCTCATTGCTAATGGTGTTGGG + Intergenic
1192002699 X:67172261-67172283 CTTTTTTTGTTGATGGTGGTAGG + Intergenic
1197262506 X:124333604-124333626 ATTTCATTGGGAATGGTGGTGGG - Intronic
1197547573 X:127844224-127844246 GTTTCTTTCCTAAGGATGGAAGG + Intergenic
1197607736 X:128605120-128605142 GTTTCTTTGCTAAGTGTGGCTGG + Intergenic
1198439839 X:136652397-136652419 TTTTCTTAGCTAATGTTAGTAGG + Intronic