ID: 917509114

View in Genome Browser
Species Human (GRCh38)
Location 1:175655702-175655724
Sequence CAGCCATGACCTTATATAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917509113_917509114 -8 Left 917509113 1:175655687-175655709 CCATTAGCAAAGAAACAGCCATG 0: 1
1: 0
2: 2
3: 13
4: 204
Right 917509114 1:175655702-175655724 CAGCCATGACCTTATATAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 76
917509110_917509114 -1 Left 917509110 1:175655680-175655702 CCCACCACCATTAGCAAAGAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 917509114 1:175655702-175655724 CAGCCATGACCTTATATAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 76
917509111_917509114 -2 Left 917509111 1:175655681-175655703 CCACCACCATTAGCAAAGAAACA 0: 1
1: 0
2: 2
3: 26
4: 332
Right 917509114 1:175655702-175655724 CAGCCATGACCTTATATAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 76
917509112_917509114 -5 Left 917509112 1:175655684-175655706 CCACCATTAGCAAAGAAACAGCC 0: 1
1: 0
2: 2
3: 7
4: 136
Right 917509114 1:175655702-175655724 CAGCCATGACCTTATATAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917509114 Original CRISPR CAGCCATGACCTTATATAAG TGG Intronic
904509666 1:30993414-30993436 CTACCATCACCTTATATAAAAGG + Intronic
906965510 1:50452570-50452592 CAGCCAGGACCTTGTATAAAAGG + Intronic
909290444 1:73876590-73876612 CATCCATGTCATTATATAGGAGG + Intergenic
917509114 1:175655702-175655724 CAGCCATGACCTTATATAAGTGG + Intronic
922382478 1:225045760-225045782 CAGACATGACTTTAACTAAGTGG - Intronic
924320318 1:242842176-242842198 CAACCATGCCCTTATAAAAAAGG - Intergenic
1078258881 11:9685559-9685581 GATCAATGACCTTATAAAAGAGG - Intronic
1081223353 11:40490326-40490348 AAGCCATCACCTTATATTAGTGG + Intronic
1094392632 12:29968630-29968652 CAACCATGACCTTATAGGAATGG + Intergenic
1098094590 12:66941417-66941439 CAACAGTGACCTTATAAAAGGGG - Intergenic
1099134529 12:78879198-78879220 CAGCAATGGCTTTATATAGGAGG + Intronic
1100245695 12:92754354-92754376 GAGCCATGACCTCAAATCAGTGG - Intronic
1110116775 13:71827319-71827341 CAGCCAATACGTTATATAACAGG - Intronic
1113086003 13:106570166-106570188 TAGCAATGCCCTTATAAAAGGGG + Intergenic
1117671927 14:58116842-58116864 CAGCCATGAGCCCATATAATTGG + Intronic
1121792184 14:96706872-96706894 CAGCCATGTCATTTTATAAATGG - Intergenic
1121952405 14:98183079-98183101 CCGCCATGACATTCAATAAGAGG + Intergenic
1127304126 15:57685381-57685403 CATCCATGACCATGTAGAAGGGG + Intronic
1130094326 15:80844732-80844754 CAGCCATGCCCAGATATCAGAGG + Intronic
1130519159 15:84649151-84649173 CTTGTATGACCTTATATAAGTGG - Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1140775750 16:78247626-78247648 GAACCATGAGCTTTTATAAGGGG - Intronic
1142116603 16:88359603-88359625 CAGAGATGATCTTAGATAAGTGG - Intergenic
1148892687 17:50819582-50819604 CAGCATTGACCTTAAATAGGAGG + Intergenic
1149632434 17:58137586-58137608 TAGCGATGCCCTTATAAAAGAGG - Intergenic
1154120588 18:11648631-11648653 CATCCAGAACCTTATATAAATGG - Intergenic
1160226343 18:77014340-77014362 CCCCCATGACCCTATAAAAGGGG - Exonic
1166777706 19:45322890-45322912 CAGCCGTGGCCTTATATAGGGGG + Exonic
932841717 2:75089185-75089207 CTGTCATGACCTTATATAGTAGG + Intronic
935439516 2:103075939-103075961 CAGTTATGACCTTGTGTAAGTGG - Intergenic
936991498 2:118371833-118371855 CAGACATGACCCCACATAAGTGG + Intergenic
940041984 2:149370445-149370467 GATTAATGACCTTATATAAGAGG + Intronic
944052197 2:195482963-195482985 TAGCAATGACTTTATATAAAAGG + Intergenic
947403896 2:229755100-229755122 CAGCCATGACCTTGGATGATGGG + Intergenic
948869389 2:240790685-240790707 CTGCCATGTCCTTATAAAAGAGG + Intronic
1169722312 20:8692202-8692224 CAGCCAAGAACTTATACATGAGG - Intronic
1171543668 20:25985054-25985076 CAGCCACGGCCTTATTTAAAGGG + Intergenic
1174244559 20:49167675-49167697 CAGCTATGACCTTATTTCATTGG + Intronic
1177185100 21:17784867-17784889 CAACCATGACCGTTTAGAAGAGG - Intergenic
949501841 3:4687535-4687557 CAGCCATCACCTCATTTCAGAGG - Intronic
951211902 3:19984352-19984374 CACCCCTGACCTTGTATATGTGG - Exonic
955215689 3:56983391-56983413 CAGGCAGGACCTTACATGAGTGG - Intronic
957802998 3:85109495-85109517 CAGCCATGAACTCATTTAAATGG + Intronic
962053835 3:131847758-131847780 CAGACATGACCATAGAAAAGTGG - Intronic
965111993 3:164437324-164437346 CAGCCAGGACCTTGTATAACAGG - Intergenic
965845672 3:172958524-172958546 CAGCCATGACCTTAGAACTGAGG - Intronic
968857071 4:3133776-3133798 CAGGCATGACATTTTAAAAGGGG - Intronic
970056196 4:11975436-11975458 CTGCATTGACCTTATATTAGTGG - Intergenic
970364663 4:15346410-15346432 TAGCCATGACTTTATATCATTGG - Intronic
973007634 4:45032341-45032363 CAACCATGCCCTTATAAAACGGG - Intergenic
976906688 4:90245405-90245427 CTACCATGACCTTAGAGAAGGGG - Intronic
977851123 4:101831007-101831029 CAGCTATGATCTTAGAGAAGAGG - Intronic
981260378 4:142711739-142711761 AATTGATGACCTTATATAAGAGG + Intronic
984444668 4:179820638-179820660 CATCCATGAACTAAAATAAGAGG + Intergenic
988043868 5:25923043-25923065 CACCATTGACCTTATAAAAGAGG + Intergenic
990448481 5:55914719-55914741 CAGACATGCCCTTATTTAGGAGG + Intronic
993723024 5:91340385-91340407 CACCCTTGACCTTGTATTAGTGG - Intergenic
995760513 5:115556861-115556883 AAGCCATGACCTATTCTAAGGGG + Intergenic
995881423 5:116848404-116848426 CAAATATGACCTTATAAAAGAGG + Intergenic
995992550 5:118260079-118260101 AAAACATAACCTTATATAAGAGG - Intergenic
996400021 5:123052341-123052363 GATCAATGACCTTATAAAAGAGG - Intergenic
996826729 5:127691055-127691077 CAGCCATGTGGTCATATAAGTGG + Intergenic
1000609997 5:163363806-163363828 GAGGCATGACCCTATAAAAGTGG - Intergenic
1000986972 5:167871498-167871520 TAACCATGACCTTAAATATGGGG - Intronic
1001101484 5:168818089-168818111 CAGACAACACCTTATTTAAGTGG - Intronic
1003122229 6:3327895-3327917 CACACATGACCTTATATGATGGG - Intronic
1007509944 6:42367167-42367189 CAGGCCTGGCCTTACATAAGGGG + Intronic
1008067852 6:47069530-47069552 CAGGCAGAACCTTAAATAAGGGG - Intergenic
1015480337 6:133701542-133701564 CAGGCATGGCCTTTTATGAGAGG - Intergenic
1019232757 6:170582549-170582571 CAGCACTTACCTTATATAAAGGG - Intronic
1028938697 7:96494594-96494616 CACCCATGTCCTAATCTAAGAGG - Intronic
1033717904 7:144021781-144021803 CAGCCATGGCCTTCAATCAGCGG + Intergenic
1037023073 8:13998190-13998212 CAGCCATGACTCTTTATAAAGGG + Intergenic
1045379365 8:101607820-101607842 CATCCATTACCTTATAAAACTGG - Intronic
1048427924 8:134339782-134339804 CAGCAATGACCATATATAAGTGG - Intergenic
1050437729 9:5628348-5628370 CAGCCATAACTTTAGATGAGAGG - Intergenic
1053263867 9:36696098-36696120 CTGCCATGTCCTTAACTAAGAGG + Intergenic
1056893276 9:90516190-90516212 GAGCCTTTACCTTAAATAAGGGG + Intergenic
1188572328 X:31602931-31602953 CAGCCATGGCCTCACATAGGTGG + Intronic
1188708766 X:33367914-33367936 CAGCCATTAGTTTGTATAAGAGG + Intergenic
1192036581 X:67569108-67569130 CAGCCATGACATTATCTATTAGG + Intronic
1192043136 X:67644185-67644207 GAGACATTACCGTATATAAGAGG - Intronic
1199298281 X:146183844-146183866 CAGCCAGGACCTAAAATCAGGGG + Intergenic
1200136593 X:153878180-153878202 CAGCCAGGACCTTATCAAAGCGG + Intronic