ID: 917510705

View in Genome Browser
Species Human (GRCh38)
Location 1:175667094-175667116
Sequence GTGGTGAAGAAGGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1149
Summary {0: 1, 1: 0, 2: 7, 3: 107, 4: 1034}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917510705 Original CRISPR GTGGTGAAGAAGGATGAGGA AGG (reversed) Intronic
900663754 1:3799790-3799812 GTGGTGCAGGAGGATGCAGAAGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901670764 1:10855276-10855298 GTGTTGTTGAAGGATGATGAAGG - Intergenic
901680707 1:10911107-10911129 GTGATGAAGAAGGTTGGGCAGGG - Intergenic
901751705 1:11413945-11413967 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
901838536 1:11939345-11939367 GTGGGGATGAAGGATGGGGGAGG + Intronic
901859971 1:12068148-12068170 GATGTGAAGAAGGGTGATGAGGG - Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902436225 1:16399522-16399544 CTGGTGAAGAAGGAGGCAGAAGG + Intronic
902785436 1:18730067-18730089 GAGGTGAAAAAGGAAGGGGAGGG + Intronic
903155944 1:21443022-21443044 ATGGTGCAGAAGGAAAAGGATGG - Intronic
903316766 1:22514114-22514136 GTGATGAGGAAGGATGGAGAAGG + Intronic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904014604 1:27409920-27409942 GTGGTGGAGGAGGAGGTGGAGGG + Exonic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904295199 1:29515757-29515779 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
904686804 1:32266655-32266677 GGGGAGGAGAGGGATGAGGAGGG - Intronic
904927836 1:34062538-34062560 GTGGTGAAGAGGGCAGAGGGAGG + Intronic
904983354 1:34524848-34524870 ATGGGGAAGAAAGGTGAGGATGG - Intergenic
905274148 1:36806244-36806266 CTGGTGAAGAACAACGAGGAGGG - Exonic
905537508 1:38734611-38734633 TTGGTGCACAAGGATGAGGAGGG + Intergenic
905649759 1:39648240-39648262 GGGGAGAAGATGGATGAGCATGG + Intergenic
906077089 1:43059819-43059841 GTGGTGAACAAGGAAGGGAAAGG - Intergenic
906302282 1:44691584-44691606 GTAGAGAAGAGGGACGAGGATGG - Intronic
906637573 1:47419358-47419380 GTGGTGATGGAAGATGAGGGTGG + Intergenic
906747181 1:48230310-48230332 GTGGTGAGGAATGAAGTGGAAGG - Intronic
907184506 1:52599618-52599640 ATGGGGAAGAAGGAGCAGGATGG + Intergenic
907256002 1:53179669-53179691 TTGGTGAGGCAGGATAAGGAAGG - Intergenic
907615487 1:55920659-55920681 GTGGTTATGAAGGATAAAGATGG + Intergenic
908519033 1:64923138-64923160 GTGGTGGAGGAGGAGGAGGTTGG - Intronic
908527126 1:64999383-64999405 GTACTGAGGAAGGATGAGAAAGG - Intergenic
908596099 1:65690290-65690312 GTGCTGTAGAGGGATGACGAAGG + Intergenic
909135359 1:71792421-71792443 TTGGTGAAACAGGATGAGAAGGG - Intronic
909391847 1:75129027-75129049 GAGGTGAAGGAGGATGTGGTAGG + Intronic
909931605 1:81504313-81504335 GGGCTGAAGAAGGCTGAAGAAGG - Intronic
910107880 1:83651246-83651268 GTGATGGAGAGGAATGAGGAAGG + Intergenic
910274803 1:85437429-85437451 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910790195 1:91042804-91042826 GTGTTGAACAAGGATGTGGTGGG - Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911327824 1:96489932-96489954 GTGGTGCATGAGGATGAGGCAGG + Intergenic
911383129 1:97140621-97140643 GTGGAGAAGAAGGATGGGAGAGG + Intronic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912328038 1:108787407-108787429 GTGGAAAAGAGGGATAAGGAAGG - Intronic
912959074 1:114179372-114179394 GAGAGGAAGAGGGATGAGGAAGG - Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913175060 1:116266033-116266055 GCAGATAAGAAGGATGAGGAAGG + Intergenic
913320409 1:117584146-117584168 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
913330171 1:117660737-117660759 GTGGTGTGGCAGGATGAGCATGG + Intergenic
913414169 1:118587026-118587048 GTGGTGAGGAAGGGTAAGTAAGG + Intergenic
913502848 1:119487997-119488019 GTGGAGAAGGAGGAAGAGCAGGG + Intergenic
914355084 1:146877908-146877930 GGGGCAAAGAAGGATGAGAAGGG - Intergenic
914357471 1:146899085-146899107 GTGGTCAGGAAGGCAGAGGACGG + Intergenic
914619214 1:149390407-149390429 CTGCTGGAGAAGGATGCGGACGG + Intergenic
914942578 1:152036296-152036318 GTGGGGTAAAAGGAAGAGGAAGG + Intronic
915127903 1:153678753-153678775 TTCGTGAAGAAGGATGAGAGAGG - Exonic
915359916 1:155279629-155279651 GGGGTGGAGAAGGCTGGGGAGGG + Intronic
915472896 1:156136380-156136402 GTGGAGGAGGTGGATGAGGAGGG + Exonic
915620414 1:157079361-157079383 GTGTTGGAGAAAGATGCGGATGG + Intergenic
915943396 1:160133251-160133273 GGGGTCAAGTAGGATGAGGACGG + Intronic
916275394 1:162988370-162988392 AGGGTGAAGAAGGAAAAGGAGGG + Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916550969 1:165849523-165849545 GAGGTGAAGTGAGATGAGGAAGG + Intronic
916620201 1:166488792-166488814 GTGGGGAAGTTGGAAGAGGATGG - Intergenic
916944851 1:169716220-169716242 CTGGTGAAGTAAGATGAGGATGG - Intronic
916991370 1:170249198-170249220 GGAGTGGAGAAGGAAGAGGAAGG - Intergenic
917034304 1:170730172-170730194 GGGGAGGAGAAGGATGGGGAGGG - Intronic
917345912 1:174027973-174027995 GGGATGAAGAAGGATAAGGAAGG + Intergenic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
918164737 1:181934377-181934399 GTGGGAAAGAAGGATGGAGAAGG + Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918830987 1:189398276-189398298 GTGCTGAAGAAGTCTGTGGAAGG + Intergenic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
918999881 1:191816729-191816751 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
919784016 1:201246712-201246734 TTGCTGAAGAAGGAAAAGGAGGG + Intergenic
919792976 1:201304210-201304232 GTGGCCAGGAAGGAGGAGGAGGG - Intronic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920419902 1:205825956-205825978 GTGGTCTAGATGGATGGGGACGG + Intergenic
920666441 1:207966051-207966073 GTGGTGAAGAGGGAGGATAAAGG - Intergenic
920791201 1:209094701-209094723 GTGGTCTAGATGGATGAGGTGGG - Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
920916751 1:210263869-210263891 GTGGTAAAGCAGGAGTAGGAAGG + Intergenic
921266462 1:213424805-213424827 GTAGGGAAGAAGGATGGGAAGGG - Intergenic
921798933 1:219379931-219379953 GTGGTGAAGAAGAGGCAGGAAGG + Intergenic
921934280 1:220782110-220782132 GGGGTGGAGAAGGCTGAGGTAGG - Intronic
922035620 1:221845279-221845301 GTGTTCAAAAAGGATGTGGAGGG - Intergenic
922171710 1:223161104-223161126 TGGGTAAAGAAGGAAGAGGAAGG + Intergenic
922174739 1:223188735-223188757 GAGATAAAGAAGGAGGAGGAAGG + Intergenic
922571317 1:226636110-226636132 GTGTTGAAGAAGGGTGGGAACGG + Intronic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923253487 1:232198794-232198816 TTGGGGAAGAAGTATGTGGATGG - Intergenic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923474827 1:234322532-234322554 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
924907630 1:248473493-248473515 GTGGATGAGGAGGATGAGGAGGG - Exonic
924916479 1:248574593-248574615 GTGGATGAGGAGGATGAGGAGGG + Exonic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1063873992 10:10452512-10452534 GTGGGGAAGGAGGTTGAAGAGGG - Intergenic
1063905127 10:10773799-10773821 CATGTGAAGAAGGAAGAGGAGGG - Intergenic
1063974235 10:11402438-11402460 GGGGTGGTGGAGGATGAGGAAGG - Intergenic
1064007417 10:11709506-11709528 GTGGGGAAGAGAGAGGAGGATGG + Intergenic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1065486256 10:26238993-26239015 GTGGTCAGGAAGCATGAGGAAGG + Intronic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1065773247 10:29096879-29096901 GTAGACAAGAAGGATGGGGATGG - Intergenic
1065794196 10:29291368-29291390 GAGGTGGAGGAGGAAGAGGAGGG + Intronic
1065948360 10:30627393-30627415 GAGGTGGAGGAGGAAGAGGAGGG - Intronic
1065966984 10:30778724-30778746 GAGAAGAAGAAGGATAAGGAGGG + Intergenic
1066008568 10:31171070-31171092 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067476267 10:46568860-46568882 AAGGTGAAGGAGGATGATGAGGG + Intergenic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067557812 10:47284871-47284893 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067557818 10:47284891-47284913 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067570515 10:47368060-47368082 GTGGTGGAGGATGATGAGGGTGG + Exonic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1067618470 10:47772920-47772942 AAGGTGAAGGAGGATGATGAGGG - Intergenic
1067669177 10:48304230-48304252 GTGGTGAATATGGATGAGTCGGG - Intergenic
1067859224 10:49827496-49827518 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1068497606 10:57805277-57805299 GATGTGAAGCAGGATGAAGAAGG - Intergenic
1068631474 10:59303074-59303096 GTGGTGAACAAGGGTGAGAGTGG - Intronic
1069023961 10:63521085-63521107 GTGGGGCAGGAGGCTGAGGAAGG - Intergenic
1069278905 10:66628660-66628682 CTTGTGAAGAAGCATGAAGAAGG + Intronic
1069536982 10:69261112-69261134 TTGGAGAAGAAGGATAAGGTTGG - Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1070051655 10:72895542-72895564 GGGGTGATGAGGGAGGAGGATGG + Intronic
1071014052 10:80973716-80973738 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1071119700 10:82263196-82263218 GTGGGAAAGAAAGATGTGGATGG + Intronic
1071503935 10:86221885-86221907 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1072807868 10:98435948-98435970 GTGGTTAGGAAGAATGGGGAGGG + Intronic
1072834353 10:98695270-98695292 GAGGAGAAGGAGGACGAGGACGG + Intronic
1073081959 10:100865960-100865982 TGGGTGAAGAAGTGTGAGGAAGG + Intergenic
1073339623 10:102735154-102735176 GAGGGGAGGAGGGATGAGGAGGG - Intronic
1073483370 10:103800990-103801012 GTGGTGAAGAGGCGGGAGGATGG - Intronic
1074126783 10:110534950-110534972 ATGATGAAGAAGGAGGAGGAGGG + Intergenic
1074146464 10:110721151-110721173 GTGCTGAGGAAGACTGAGGAAGG - Intronic
1074244737 10:111677359-111677381 GAGGTCAAGGAGGATGAGGGAGG + Intergenic
1074899707 10:117805492-117805514 TTGGTGCAGACGGATGTGGATGG + Intergenic
1075465145 10:122645364-122645386 GGGGTGAAGAAAGATGGGGTGGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076238531 10:128884285-128884307 GTTGTGATGAGGGAGGAGGAAGG - Intergenic
1076246347 10:128950283-128950305 GTCCTGAAGAAGAAGGAGGACGG + Intergenic
1076550076 10:131272657-131272679 GTGGTGTGGGAGGATCAGGAAGG - Intronic
1076595419 10:131622189-131622211 ATCCTGAAGAAGGATGAGCAAGG + Intergenic
1076927313 10:133498559-133498581 GTGGGGAAGAGGTATGTGGATGG - Intergenic
1077165863 11:1137999-1138021 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1077168536 11:1154373-1154395 GTGCTGATGAAGGCAGAGGAGGG - Intergenic
1077491049 11:2861252-2861274 GGTGTGAAGAAGGAAGAGGCTGG - Intergenic
1077783087 11:5353479-5353501 GTGGGGAGGAAGGGAGAGGATGG + Intronic
1077810673 11:5633228-5633250 GGGGTAAAGAAGGATGAAAAGGG - Intronic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078586013 11:12589762-12589784 GTAGTGATGAAGGAAGAGGCAGG - Intergenic
1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG + Intergenic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078885546 11:15496405-15496427 GTGGTGCAGTAGAGTGAGGAAGG - Intergenic
1079202900 11:18390638-18390660 GTGGGGATGAAGGATGAAGAGGG - Intergenic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080709009 11:34727911-34727933 ATGGTGAAAAAGGATAGGGAAGG - Intergenic
1081093281 11:38899860-38899882 GAGGTGGAGGAGGAGGAGGAAGG + Intergenic
1081700600 11:45150206-45150228 GATGTGAAGATGGAGGAGGAAGG - Intronic
1081733069 11:45384958-45384980 TGAGTGGAGAAGGATGAGGAGGG + Intergenic
1082069905 11:47930913-47930935 GAGTTGAAGAAGGAGGAAGAAGG - Intergenic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1082986655 11:59175061-59175083 TTGGTGGAGAAGGGAGAGGAGGG - Intronic
1083049282 11:59762592-59762614 GTTGGGGAGAAGGCTGAGGATGG + Intronic
1083050085 11:59769274-59769296 GAGGAGGAGGAGGATGAGGATGG + Intronic
1083186111 11:61018862-61018884 GTGGGGAAAATGGATGTGGACGG + Intronic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083637414 11:64128110-64128132 GAGGTGAGGATGGAGGAGGAGGG - Intronic
1084269457 11:68021302-68021324 GTCCTGATGAAGGATGAGCAGGG + Intronic
1084770539 11:71340284-71340306 GTGGTGAAGGAGGATGAGATAGG + Intergenic
1085140923 11:74140809-74140831 GAGATGAAGAGGGGTGAGGAGGG + Intronic
1085266404 11:75240512-75240534 GTGCTGGAGAAGGAGGAGGAAGG + Intergenic
1085570537 11:77554427-77554449 ATGGTGGTGAAGGATGTGGAAGG - Intronic
1086089160 11:82987794-82987816 CAGGTGAAGAAGGATCAGGTTGG + Intronic
1086540274 11:87900719-87900741 GTAGGGAAGAAGGAAGAGGGAGG + Intergenic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087304157 11:96469488-96469510 GTGGAGTAGAAAGAAGAGGAGGG + Intronic
1087528778 11:99352769-99352791 GTGTTGAAAAGGGAAGAGGAAGG + Intronic
1088166970 11:106950579-106950601 CTGGTGAAGAAGGTGGGGGAGGG + Intronic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088359580 11:108976670-108976692 GGGGTGAGGTAGGATGAAGAAGG + Intergenic
1088645450 11:111913216-111913238 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1089042234 11:115462910-115462932 GGGATGAAGCAGGATGAAGAGGG + Intronic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089084512 11:115805746-115805768 CTGGTGAAGATGGGTGGGGAGGG - Intergenic
1089624765 11:119744296-119744318 GTGATGAAGAAGAAAGGGGATGG - Intergenic
1089864751 11:121621857-121621879 GTGGTGAGGAAGGAATGGGATGG - Intronic
1090007730 11:123017639-123017661 ATGGTGGAGAAGGAGGAGGCTGG + Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090959110 11:131540002-131540024 GTAGTGAGCAAGGATGAGGTGGG - Intronic
1090989149 11:131800686-131800708 GCGGGGGAGAAGGAAGAGGATGG - Intronic
1091296452 11:134477179-134477201 GTGCTGAGTATGGATGAGGAAGG + Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091446363 12:546136-546158 GTCGGGAAGAGGGAAGAGGAGGG + Intronic
1091603174 12:1930052-1930074 GAGGGGGAGAAGGAGGAGGAGGG + Intergenic
1091753639 12:3038091-3038113 GTGGTGGAGAAAGTTGAGGTAGG + Exonic
1091840517 12:3617151-3617173 GTGGGGAAGGATTATGAGGAAGG - Intronic
1092014015 12:5141666-5141688 TTGGTGAAGATGGATAAAGATGG - Intergenic
1092161138 12:6316131-6316153 GGGGTGAAGAAGGATGAACTGGG - Intronic
1092333453 12:7606706-7606728 GAGGTGGAGGAGGCTGAGGAAGG + Intergenic
1092744372 12:11659829-11659851 GAGGTGAGGAAGGAAGAGGGAGG + Intronic
1093230864 12:16540211-16540233 AGGGTGGAGAAGGAAGAGGAAGG - Intronic
1093235958 12:16608612-16608634 TTGGGGAAAAAGGAAGAGGATGG - Intronic
1093769726 12:23004368-23004390 GTGTGGGAGAAGGATGTGGAGGG + Intergenic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1095092354 12:38119065-38119087 GTGGTGATGGATGATGATGATGG + Intergenic
1095244935 12:39908592-39908614 GTGGCTGAGGAGGATGAGGAGGG + Intronic
1095584157 12:43832522-43832544 GTGGTGAAGAAGGAAGATCTGGG + Intergenic
1096113200 12:49040892-49040914 GAGGTGAAGAAGGAAGAGCTTGG - Exonic
1096178155 12:49536678-49536700 GAGGTGGAGGAGGAGGAGGAGGG - Intergenic
1096428028 12:51520769-51520791 GTGGTGAAGAAGGAGTGGGTGGG + Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096747598 12:53738787-53738809 GTGGGGGAGAAGGAAGAGGGTGG - Intergenic
1096760406 12:53836890-53836912 GGGGTGGAGAGGGATGAGCAGGG + Intergenic
1097564258 12:61248717-61248739 GTGGAGGAGAAGGAAGAGGAGGG - Intergenic
1097725111 12:63066376-63066398 GTGGTTCAAAAGGATAAGGATGG - Intergenic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098582306 12:72114571-72114593 GTGGAGGAGAAGGAAGAAGAGGG + Intronic
1099051401 12:77785465-77785487 AAGGTGAAGAAGTAGGAGGAGGG + Intergenic
1099114527 12:78608364-78608386 GGGATGAAGAAGGATAAAGAGGG + Intergenic
1099146393 12:79050306-79050328 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099467829 12:83008961-83008983 GTGGTGGTGAAGTATGAGGGAGG + Intronic
1099532270 12:83798930-83798952 GTGGTAAAGATGGAAGAGAAAGG - Intergenic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1100677657 12:96885852-96885874 GGGGAGAAGGAGGAGGAGGAAGG - Intergenic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101084893 12:101225921-101225943 GAGGAGGAGAATGATGAGGAGGG - Intergenic
1101152025 12:101891813-101891835 GTGGTGCAGAATGATGTGGTAGG + Intronic
1101447918 12:104751033-104751055 GTGGAGAAGAAGGAAATGGAGGG + Intronic
1101466983 12:104958555-104958577 GTGGGGAAGAGGGATGCCGAAGG - Intronic
1101559792 12:105845604-105845626 GAGGTGAAGGAGGAGAAGGAGGG - Intergenic
1101704334 12:107207363-107207385 GTAGAGCAGAAAGATGAGGAAGG - Intergenic
1101724270 12:107376145-107376167 GTGGTGAGGGAGGGAGAGGAGGG - Intronic
1101782751 12:107850059-107850081 GTGGAGAAGAAGGAGGAGCAGGG - Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102394404 12:112574696-112574718 GGGGTGATGAAGGTGGAGGAGGG + Intronic
1102394431 12:112574785-112574807 GGGGTGATGAAGGTGGAGGAGGG + Intronic
1102394484 12:112574942-112574964 GTGATGAAGATGGAGGAGGGAGG + Intronic
1102559145 12:113749691-113749713 GTGATGAAGAAGGCTGGGGGTGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102765970 12:115433272-115433294 GGGGAGAAGAAGGGGGAGGAAGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102887670 12:116534065-116534087 GGGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103345266 12:120245071-120245093 GTGCTGGGGAAGGAGGAGGAGGG + Intronic
1103516208 12:121509928-121509950 GAGGAGGAGAAGGACGAGGAGGG - Exonic
1104196907 12:126549072-126549094 GTGGTAAAGAAAGATGAAGGAGG + Intergenic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1104983067 12:132582563-132582585 GGGGCTAGGAAGGATGAGGAGGG + Intronic
1105578822 13:21675233-21675255 GTGGGGAAGCAGGGTGAGGCAGG + Intronic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106122097 13:26868836-26868858 TAGGTCAAGAAGGAAGAGGATGG - Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106557519 13:30822919-30822941 GTGGTGAGGAAGGCTCTGGAAGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106835554 13:33630792-33630814 AAGGTGAAGGAGGATTAGGATGG - Intergenic
1106900718 13:34352261-34352283 GTGAAAAAGAGGGATGAGGAAGG - Intergenic
1107021776 13:35759610-35759632 GTAGAGAAGGAGGCTGAGGAAGG - Intergenic
1107045079 13:35985183-35985205 GTGGAGAAGGATGATGTGGAAGG - Intronic
1107062930 13:36180275-36180297 GTGGTGAAGGGGGAGGAGGCTGG - Intronic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107722201 13:43260567-43260589 GTGGAGGGGAAGGATGAGGAGGG - Intronic
1108732547 13:53249504-53249526 GACATGAAGAAGGATGAGGATGG + Intergenic
1109379891 13:61545382-61545404 GAGGTGATTAAGGATAAGGAGGG - Intergenic
1110041291 13:70762383-70762405 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110666482 13:78123588-78123610 GTGGAGAAGAATGGTGAAGAAGG + Intergenic
1110957907 13:81579380-81579402 GTGGGGCAGAAAGATGAGAAAGG - Intergenic
1111176998 13:84607886-84607908 GAGGTGAAAGAGTATGAGGAAGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111717473 13:91897049-91897071 TTGATGAAAAAGGAGGAGGAGGG - Intronic
1112023204 13:95389998-95390020 GGGTTGAAGAGTGATGAGGATGG - Intergenic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112565250 13:100546850-100546872 GTGGTTTAGAGGCATGAGGATGG - Intronic
1112810255 13:103210027-103210049 GTGGCAAAGAAAGATGAAGATGG + Intergenic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113319613 13:109221040-109221062 TTGGGGAAGAAGTATGTGGATGG - Intergenic
1113639917 13:111949856-111949878 ATGGGGAAGAAGGATGAGCCAGG + Intergenic
1113672225 13:112183052-112183074 GTGGAGAAGGAGGCTGACGATGG - Intergenic
1113754879 13:112804104-112804126 GAGGTGAAGGAGGAAAAGGAGGG - Intronic
1113839651 13:113351532-113351554 GTGCTGAGGAAGGAAGAGGCCGG - Intronic
1114222016 14:20705117-20705139 ATGGTGGTGAAGGATGTGGAAGG - Intergenic
1114262365 14:21046933-21046955 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1115320420 14:32075154-32075176 GTGGGAAAGAAGGATGCGGAAGG - Intergenic
1115956483 14:38786307-38786329 GTGGTGAAGAAAGCAGTGGATGG - Intergenic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117472504 14:56060343-56060365 GTGGGGAAGATGCATGAAGAAGG - Intergenic
1117581048 14:57152086-57152108 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
1117679170 14:58185593-58185615 GTGGGAAAGAAAGATGATGAAGG + Intronic
1118071748 14:62253092-62253114 GGGTTGAAGGTGGATGAGGAAGG + Intergenic
1118489856 14:66248430-66248452 GTGGAGAAAAAGGGAGAGGAAGG + Intergenic
1118749168 14:68794141-68794163 GTGGGGAGGATGGAGGAGGAGGG - Intronic
1118849612 14:69573701-69573723 GGGGTGACTATGGATGAGGAGGG - Intronic
1119137639 14:72235191-72235213 GGATTGAAGAAGGATGAGGCAGG + Intronic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1119818334 14:77591320-77591342 GTGGGGAGGGTGGATGAGGAAGG + Intronic
1120081936 14:80226897-80226919 GTGGGGAAGACGTATGTGGATGG - Intronic
1120726181 14:87944075-87944097 GTGGGGACGAGGGATGGGGAAGG - Intronic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121587238 14:95070694-95070716 GTGGTGGGGAAGAATCAGGAGGG - Intergenic
1121727933 14:96166512-96166534 GTGGGGAAGGAGGAAGAGAAGGG + Intergenic
1121764067 14:96470247-96470269 AAGGCGGAGAAGGATGAGGAGGG + Intronic
1122016785 14:98803276-98803298 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1122082427 14:99274745-99274767 GAGGGGGAGAAGGAGGAGGAGGG - Intergenic
1122782659 14:104150182-104150204 GTGGGGGAGGGGGATGAGGAGGG - Intronic
1122916065 14:104859530-104859552 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916140 14:104859840-104859862 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916182 14:104860046-104860068 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916216 14:104860200-104860222 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916261 14:104860406-104860428 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916288 14:104860523-104860545 GTGGTGATGAAGGGTGGAGATGG - Intergenic
1122916320 14:104860651-104860673 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916345 14:104860742-104860764 GTGGTGAAGGAGGTTGGTGATGG - Intergenic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1123134258 14:106012492-106012514 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123165942 14:106324823-106324845 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123197182 14:106627816-106627838 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123198526 14:106639692-106639714 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123539250 15:21271690-21271712 GTGGGGGAGAGGGAAGAGGAAGG - Intergenic
1123584286 15:21742935-21742957 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123620937 15:22185538-22185560 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1124010912 15:25837861-25837883 GTGGGGAAGACGGGTGGGGAGGG + Intronic
1124701840 15:31920879-31920901 GTGGTGAAGATAGGGGAGGAGGG - Intergenic
1124833044 15:33167871-33167893 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1124956547 15:34364096-34364118 GAGGTGAAGAAGACTGAAGAAGG + Intronic
1125086393 15:35735118-35735140 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125506090 15:40268484-40268506 GTGGTGGAGGAGGAGGAGGAAGG - Intronic
1125700931 15:41682944-41682966 GGGGTGAAGAGAGATGAGGCTGG - Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126056185 15:44731889-44731911 GTGGTGAACAATGATGAGGAGGG + Intronic
1126357486 15:47811878-47811900 GGGAGGAAGAAAGATGAGGAAGG - Intergenic
1126403315 15:48296647-48296669 ATGAGGAACAAGGATGAGGAAGG + Intronic
1126465705 15:48959842-48959864 GTGGTGAAGACAGATAAGAATGG + Intronic
1126469651 15:48994768-48994790 GAAGTGAGGAGGGATGAGGAAGG - Intronic
1127548195 15:60009806-60009828 GTGCTCAAGAAGGATGAGGTGGG + Intronic
1127845373 15:62866082-62866104 GTGGAGAAGGTGGATGAGGTTGG + Intergenic
1128095809 15:64954493-64954515 GAGGAGAAGAAGGAAGAAGAAGG - Intronic
1128304173 15:66587076-66587098 GGGGAGAAGGAGGAAGAGGAAGG - Intronic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1128596544 15:68956909-68956931 GTGTTGGAGAAGGCTGAGTAGGG - Intronic
1128704580 15:69829227-69829249 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1128854859 15:71001498-71001520 GTGATGAAGAAGGATAAAAAAGG - Intronic
1128878584 15:71222613-71222635 GGGGTGAAAGAGGTTGAGGAGGG + Intronic
1128979833 15:72178175-72178197 AGGGTGAAGAAGGCTCAGGAGGG - Intronic
1129043005 15:72706539-72706561 GTGGTTAAGTAGGATGTGAATGG + Intronic
1129197834 15:73981749-73981771 GGTGTGAAGAGGGAGGAGGAGGG - Exonic
1129246861 15:74284455-74284477 GTGGTGATGAGGGATGGAGAAGG - Intronic
1129295266 15:74596610-74596632 GAGCTGAAGAAGGCTGAAGAAGG - Exonic
1129665324 15:77576353-77576375 GGGGAGGAGAAGGAGGAGGAGGG + Intergenic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1130182340 15:81643274-81643296 GTGCTGAGGGAGGAGGAGGATGG - Intergenic
1130425416 15:83793172-83793194 GGGGTTAAGATGGTTGAGGAGGG + Intronic
1131028979 15:89170395-89170417 GTGGTGAAAAAGGATGAATCTGG - Intronic
1131339528 15:91584158-91584180 GAGGAGGAGAAGGAAGAGGAGGG - Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131852141 15:96554731-96554753 GAGGTGATGGAGGAGGAGGAGGG - Intergenic
1133180368 16:4049664-4049686 GTGGACATGAAGGATGCGGAAGG - Intronic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133550918 16:6853839-6853861 GTGGTGACAAATGATGAGTATGG + Intronic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1133601581 16:7345028-7345050 GTGGTGACAAAGGCTGAGGAAGG + Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133717884 16:8466870-8466892 GTGGGAAAGAAAGAAGAGGAAGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134376826 16:13684271-13684293 GTGGTGGGGTAGGATGATGAGGG - Intergenic
1134439409 16:14288892-14288914 ATGGTGGAGATGGATGAGAATGG - Intergenic
1134455573 16:14392926-14392948 GTGGTGCAGGAGGCTGAGGAGGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135032657 16:19050795-19050817 GTCCTAAAGAAGGATGAGGCCGG - Intronic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135673592 16:24395314-24395336 GAGCTGGGGAAGGATGAGGATGG - Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136364384 16:29802719-29802741 GTGGTGATGAGGGAGGAGGTAGG + Intronic
1136559564 16:31031126-31031148 GAGGTTAGGAAGGATGTGGAAGG - Intergenic
1137290916 16:47051350-47051372 ACGATGAAGGAGGATGAGGAAGG + Intergenic
1137550222 16:49432484-49432506 GTGGGGAGGAAGCATCAGGAAGG - Intergenic
1137565792 16:49531782-49531804 GTGGTGATGGAGGATGACCATGG + Intronic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1137617498 16:49856230-49856252 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1138153974 16:54685892-54685914 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG + Intergenic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139144777 16:64310087-64310109 GGGGTGAAGAAAAGTGAGGAGGG + Intergenic
1139642069 16:68298926-68298948 GTGGAGAAGAATGGTCAGGAAGG - Exonic
1139699080 16:68696117-68696139 GTGGTTAAAAATGATTAGGAGGG + Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139976714 16:70818209-70818231 GTGGTCAGGAAGGCAGAGGACGG - Intronic
1139978932 16:70837621-70837643 GGGGCAAAGAAGGATGAGAAGGG + Intronic
1140084016 16:71777713-71777735 GTGGTGGAGGAGGAGGAGAACGG - Intronic
1140265063 16:73413359-73413381 GGAGTGAAGGAGGATGAGGCTGG + Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140637924 16:76938545-76938567 GTGGTCAAGAAGGAAGGGGATGG - Intergenic
1140842256 16:78850619-78850641 ATGGTGAACAAGGATGGTGATGG - Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141221105 16:82070042-82070064 GTGGAGAAGAAGGATTAGGTTGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141635120 16:85310519-85310541 GTGGGGGAGAAGGAGGAGGTGGG - Intergenic
1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG + Intergenic
1141694159 16:85612075-85612097 GTGTTGGAAGAGGATGAGGAGGG + Intronic
1141879612 16:86849110-86849132 GGAGTGATGGAGGATGAGGAAGG - Intergenic
1141919861 16:87128448-87128470 TTGGTGAAGCAGGGTGTGGAAGG - Intronic
1142667404 17:1470815-1470837 GTGGTGAAGAAGAATGAATGTGG + Intronic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1142872400 17:2829321-2829343 GTGGTGACTTAGGATCAGGAAGG + Intronic
1143250988 17:5522837-5522859 GTAGAGAACAAGGAGGAGGAAGG + Intronic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143483413 17:7239500-7239522 GAGGTGGAGGAGGAGGAGGAGGG - Exonic
1143779661 17:9222577-9222599 CTGGTGAGGAAAGAGGAGGAGGG + Intronic
1143953747 17:10653411-10653433 GTGGTGAAGGGGGAAGAGGTGGG - Intronic
1143968003 17:10770671-10770693 GTGAGGAAGATGGATGGGGAGGG + Intergenic
1144041397 17:11414140-11414162 GTACAGAAGAAAGATGAGGAAGG - Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144126806 17:12210497-12210519 GAGAGGAAGAAGGAAGAGGAAGG - Intergenic
1144285754 17:13772344-13772366 GTGGGGAAGTAAGAGGAGGAAGG + Intergenic
1144577112 17:16436171-16436193 GTGGTGCAGAAGTAAGAGGCAGG - Intronic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1144739780 17:17575447-17575469 GAGGTGGTGAAGGGTGAGGAGGG - Intronic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1145094280 17:20010457-20010479 GTGTTGAAGATGGGGGAGGAGGG + Intronic
1145775377 17:27524256-27524278 GAGGTCAAGCAGGATGAGGGTGG + Intronic
1146193802 17:30793941-30793963 GTGGGGTGGAAGGAAGAGGATGG - Intronic
1146412239 17:32596409-32596431 GAGGTGAAGGAGGCAGAGGATGG - Intronic
1146453959 17:32995273-32995295 GGTGTGAAGCAGGATGGGGAAGG + Intronic
1146834448 17:36099047-36099069 GTGGTGGTCAAGGATGTGGAGGG + Intergenic
1147625258 17:41896044-41896066 GAGGTGAAGAAGGAGGTAGACGG - Intronic
1148003167 17:44402535-44402557 GTGATTCAGAAGGCTGAGGAGGG + Intronic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148256125 17:46134025-46134047 GTCATGAGGAAGGATGGGGATGG + Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148541273 17:48482542-48482564 GTGGTGAACAGAGAGGAGGAGGG + Intergenic
1148573060 17:48685968-48685990 GTGGAGGAGGAGGAAGAGGATGG + Intergenic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1149871576 17:60186751-60186773 GTGGTGTAGAATGAAGAAGACGG + Intronic
1150080520 17:62234425-62234447 TAGGTGGAGAAGGAGGAGGATGG - Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151439636 17:74119866-74119888 CTGGTGAACAAGGACAAGGAGGG + Intergenic
1151449488 17:74189418-74189440 GTGGTGAGGATGGCTCAGGAAGG - Intergenic
1152002148 17:77653698-77653720 GTGGTGAAGAAGGTGGAGAGAGG - Intergenic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152410550 17:80120538-80120560 GAGGTGAAGTGGGATGGGGACGG - Intergenic
1153607569 18:6849409-6849431 GTCCTGCAGAAGGATGATGAAGG + Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1156104394 18:33640477-33640499 CTAGTGGAGAAGAATGAGGATGG - Intronic
1156310632 18:35918795-35918817 GTAGTGGAGAAGGCTGAGTAGGG - Intergenic
1156463242 18:37333362-37333384 GAGGGGAAGAAGGGAGAGGAGGG - Intronic
1156491374 18:37498403-37498425 GGGGAGAAGAGGGAAGAGGAGGG - Intronic
1156846482 18:41671541-41671563 GTGGAGAAGGAGGAAGAAGAGGG + Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157673134 18:49547587-49547609 GAGGTAAAGTATGATGAGGAAGG + Intergenic
1157795362 18:50569619-50569641 GCGGAAAACAAGGATGAGGAAGG - Intronic
1157911640 18:51622593-51622615 CTGGTGGAGAAGGGTGAGTAGGG + Intergenic
1158525505 18:58209349-58209371 GAGGTGGAGGAGGAGGAGGAGGG - Intronic
1158720443 18:59919817-59919839 GTGGTGAAGAAGAATAAAGCAGG - Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159563714 18:70024077-70024099 GTGTTTAAGAAGGATTAGGCTGG - Intronic
1159848281 18:73493294-73493316 GAGGAGGAGAAGGAAGAGGACGG - Intergenic
1159949095 18:74466788-74466810 GTGGTCTTGAAGGATGAGCAGGG - Intergenic
1160110482 18:76024900-76024922 GTGGTGAAGAGGGCAGAGGGCGG - Intergenic
1160174003 18:76578712-76578734 GCGGGGAAGGAGGAAGAGGAGGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160274884 18:77421995-77422017 GAATTGAATAAGGATGAGGAAGG - Intergenic
1160841496 19:1148691-1148713 GGGGTGAAGGAGGATGGGAAGGG - Intronic
1160965764 19:1746282-1746304 GTGGGGAGGAAGGGGGAGGATGG + Intergenic
1161030716 19:2056662-2056684 GAGAGGAGGAAGGATGAGGAGGG - Intergenic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161550733 19:4910649-4910671 GTGTTGAAGATTGAGGAGGAAGG - Intronic
1161836296 19:6649356-6649378 GAGGTGAAGAGTGAGGAGGAGGG - Intergenic
1161949452 19:7459756-7459778 GTGGTGCAGGAGGACGAGGAGGG - Intronic
1162053054 19:8046701-8046723 GAGGAGGAGAAGGAGGAGGAAGG - Intronic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162232795 19:9281627-9281649 AGGGTAAAGAAGGATGGGGAAGG + Intergenic
1162262575 19:9544794-9544816 ATGGTGGTGAAGGATGTGGAAGG - Intergenic
1162273851 19:9637713-9637735 ATGGTGATGTAGGATGTGGAAGG + Intronic
1162844686 19:13383051-13383073 GTGGTGAAGAAAGAGAAGAATGG + Intronic
1162879043 19:13643928-13643950 GTGCTGACCAAGGATGAGGTAGG + Intergenic
1162918138 19:13885166-13885188 GGGGAGGAGAAGGAGGAGGAGGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163263160 19:16203525-16203547 CTGATGGAGAAGGAGGAGGAGGG + Exonic
1163501837 19:17680684-17680706 GGGGTGAGGGAGGAAGAGGAGGG - Intronic
1163701666 19:18789513-18789535 GAGGGGAGGAAGGATGAGGGCGG + Intronic
1164441576 19:28283809-28283831 GTGGAGAAGAAGGTGGAGAAAGG - Intergenic
1164441897 19:28285128-28285150 GAGGGGAAGAAGGAGAAGGAGGG + Intergenic
1164559104 19:29276395-29276417 GGGGTGATGGAGGAAGAGGATGG - Intergenic
1165097342 19:33416830-33416852 GTGGTGAATAACGAGGTGGATGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166228795 19:41413680-41413702 GGGGTGGGGAAAGATGAGGAGGG - Intronic
1166372633 19:42310593-42310615 GGGGTGATGAAGGCTGAGGCAGG - Exonic
1167058850 19:47130931-47130953 ATGGTGGAGAAGGAGGAGGCTGG + Exonic
1167144496 19:47673569-47673591 GTGGCGATGGATGATGAGGATGG + Exonic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167435283 19:49475349-49475371 GTGGTGTAGAAGGCAGAGGGAGG + Intronic
1167469213 19:49666092-49666114 GGGGTGAGGAGGGAAGAGGAGGG + Intronic
1167588308 19:50387646-50387668 GTGCTGAAGCTGGAGGAGGAAGG - Intronic
1167602012 19:50459845-50459867 GAGGTGAGGAGGGATGAGGGTGG + Intronic
1167609891 19:50501933-50501955 GAGGTGATGAAGGAGGAGGGTGG - Intergenic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167719360 19:51168051-51168073 GTGGGGACGCAGGATCAGGAGGG - Intergenic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167775656 19:51553039-51553061 GGGGAGGAGAAGGAGGAGGAGGG + Intergenic
1167819952 19:51918611-51918633 ATGGTGAAAAAGGATTAAGAGGG + Intronic
1168111944 19:54197585-54197607 GAGGTGCAGAAAGAAGAGGAGGG - Intergenic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1168503580 19:56914186-56914208 GCGGAGAAGGAGGAAGAGGAGGG + Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
925400876 2:3571767-3571789 GTGGTGAAAAAGCATGAGGGAGG + Intergenic
925628632 2:5866840-5866862 ACGGTGGAGAAGGATGAAGAAGG + Intergenic
925889854 2:8424938-8424960 GTGGGGAGGAAGGAAGTGGAGGG - Intergenic
925984526 2:9205940-9205962 GGGGTGCAGGAGGAGGAGGAGGG - Intergenic
926165386 2:10519609-10519631 GTAGTGAAGAAGCATTTGGAAGG - Intergenic
926215161 2:10901808-10901830 GTGGGGAAGGGGGATGATGAGGG + Intergenic
926826854 2:16914297-16914319 TTGGGGAAGAAGTATGTGGATGG + Intergenic
926890352 2:17634110-17634132 GTGGGGGAGAAGGTGGAGGAGGG + Intronic
927008798 2:18880353-18880375 TTGGGGAAGAAGTATGTGGATGG + Intergenic
927422904 2:22951867-22951889 GTGGTGCAGAATGTTCAGGAAGG + Intergenic
927756729 2:25714365-25714387 GTGGTGAAGATGGAGGTGGTGGG + Intergenic
927929823 2:27036924-27036946 ATGGTGAGGAAGGAAGAAGAGGG + Intronic
928102962 2:28450104-28450126 GGGGGAAAGAAGGAGGAGGAGGG - Intergenic
928106741 2:28475418-28475440 GTGGTGGAGAAGGAGGAAGGTGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928409367 2:31042656-31042678 GTGGAGAGTAAGGAAGAGGAAGG - Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
929512506 2:42575854-42575876 GAGGTGAGGATGGATGAGGGGGG - Intronic
929999752 2:46853151-46853173 GTGGTGATGAAGGCAGAGGTGGG - Intronic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930411621 2:51032161-51032183 GAGGAGGAGAAGGAGGAGGAGGG + Exonic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930704486 2:54490734-54490756 TTAGTGAAGAAGGATGAGGCTGG + Intronic
930761441 2:55043049-55043071 GGGGTTAAAAAGGATGATGATGG + Intronic
931266119 2:60661792-60661814 GTGTTGAAGAAGGAAGCAGAAGG + Intergenic
931647950 2:64442357-64442379 AGGGTGAAGAAGGGAGAGGAAGG - Intergenic
931924633 2:67057898-67057920 TTTGTGCAGAAGGAAGAGGAGGG - Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932885301 2:75543687-75543709 CTGGTGAGGAATGATTAGGAAGG - Intronic
932995211 2:76843704-76843726 GAGTTGGAGAAGGTTGAGGATGG + Intronic
933462601 2:82607730-82607752 GAGGAGAAGAAGGATTGGGATGG - Intergenic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935230272 2:101090004-101090026 GGGGAGAGGAAGGAAGAGGAGGG + Intronic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
936027545 2:109045187-109045209 GTGTTGAAGAAGGACAAAGAGGG + Intergenic
936034838 2:109102689-109102711 GGGGAGAGGGAGGATGAGGAAGG + Intergenic
936061956 2:109300680-109300702 GTGGTGAAGGAGGAAGAGGAAGG - Intronic
936286714 2:111186911-111186933 GTGGTGTAGAGGGATGAGCATGG + Intergenic
936664270 2:114576345-114576367 GTCTTGAAGAGGGAAGAGGAGGG + Intronic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
937490232 2:122359471-122359493 GAGGAGAAGACGGAGGAGGAGGG - Intergenic
937859080 2:126694218-126694240 TTGGTGAAGGAGGTTGAGGGTGG + Intronic
937990884 2:127661671-127661693 GTGCTGGAGAGGGCTGAGGAAGG - Intronic
938178942 2:129162513-129162535 GAGGGGCAGAAGGAGGAGGAAGG + Intergenic
938395929 2:130947921-130947943 GTGTTGAAGAAAGATGAACAAGG + Intronic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
938399443 2:130976683-130976705 GTGGTGGAGAAGGAAAAGGTGGG + Intronic
938408422 2:131045359-131045381 GTGATGGAGAAGCCTGAGGAAGG - Exonic
939462913 2:142519673-142519695 GAGGTGAAGGAGTAGGAGGAGGG + Intergenic
939474427 2:142668472-142668494 GAGGTGGAGAAAGATGAAGAGGG - Intergenic
939886791 2:147689916-147689938 ATGATGAAGATGCATGAGGAAGG - Intergenic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
940508543 2:154585064-154585086 GTGGTGGTGCAGGATGTGGAAGG + Intergenic
940656692 2:156495634-156495656 GTGGTGAAGGAGGAGGAAAAAGG - Intronic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941396478 2:164980275-164980297 GAGGAGAAGAAGGAGGAGGTGGG - Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942171213 2:173291302-173291324 GTGGTCACAAAGGATGAGGTTGG + Intergenic
942252629 2:174060510-174060532 GTGGGGAAGAAGGAGGAGAAAGG - Intergenic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943365703 2:186965779-186965801 GTAGGGAAGAAGGATGAAGAGGG + Intergenic
943726341 2:191255475-191255497 GTGTTAAAGAATGAGGAGGATGG + Intronic
943789917 2:191920862-191920884 ATGATGGATAAGGATGAGGAAGG + Intergenic
944566643 2:200998183-200998205 CTGGAGAGGAAGGATGAGGGTGG - Intronic
944667494 2:201969622-201969644 ATGGCAGAGAAGGATGAGGAAGG - Intergenic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945468703 2:210202009-210202031 GTGTTGCAGAAGGGTGAGGGAGG - Intronic
945497727 2:210529748-210529770 ATTGTGGAGATGGATGAGGATGG + Intronic
946172991 2:217906300-217906322 GGGGAGAAGAAGGATGGGGCTGG - Intronic
946341958 2:219075638-219075660 GTTATGCAGAAGGATGAGGCGGG + Exonic
946699458 2:222397163-222397185 GAGAGGAAGAATGATGAGGAGGG - Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946797767 2:223373819-223373841 GTAGTGAGGAAGGATTTGGAAGG - Intergenic
946917540 2:224540420-224540442 GGAGGGAAGAAGGAAGAGGAAGG + Intronic
947348863 2:229221805-229221827 GTGGTTAAGAGGAATGGGGAGGG - Intronic
947970601 2:234319924-234319946 GAAGAGAAGAAGGAGGAGGAGGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948294082 2:236847964-236847986 GGGGTGTAGAAGGAAGGGGAGGG + Intergenic
948600559 2:239105570-239105592 GTGGTGAGGAAGGATGAGAGTGG - Intronic
948670470 2:239565209-239565231 GGTGTGAAGGAGGATGAAGAAGG + Intergenic
1168893889 20:1310765-1310787 GGGGTGAGGAGGGGTGAGGAGGG + Intronic
1168958336 20:1850077-1850099 GTGGGGAAGGAGGATGGGGTTGG + Intergenic
1169358474 20:4927600-4927622 GTGGGGAAGATGGAAGATGATGG - Intronic
1169451514 20:5716032-5716054 GAGGTGGAGGAGGAAGAGGAGGG + Intergenic
1169485799 20:6030840-6030862 GAGGTGGAGAAGGATGTGGGAGG - Intronic
1169651321 20:7870892-7870914 GTGGAGAAGAGGGAAGAGAAGGG - Intergenic
1169702114 20:8458393-8458415 ATGATTAAGATGGATGAGGAGGG - Intronic
1170133360 20:13046572-13046594 GTGATGCAGAAGGATGTGGGAGG + Intronic
1170160459 20:13304861-13304883 GTGGGGAAGAGAGATGGGGAAGG - Intergenic
1170957411 20:20993851-20993873 GGAGGGAAGAAGGATGGGGAGGG + Intergenic
1171327266 20:24305569-24305591 GGGTTGAAGGAGGAGGAGGAAGG + Intergenic
1171892821 20:30731846-30731868 GGGGTTTAGAAGGAAGAGGAGGG + Intergenic
1171970428 20:31561601-31561623 GGTGTGAAGAAAGAGGAGGAGGG - Intronic
1172791767 20:37510774-37510796 GAGGGGAAGAAGGAGGTGGAGGG - Intronic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173897525 20:46562284-46562306 GAGTTGGAGAAGGATGAGGTTGG - Intronic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1174287537 20:49483492-49483514 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
1174400901 20:50275272-50275294 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1174704482 20:52641485-52641507 GGAGTGACCAAGGATGAGGAAGG + Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1176877337 21:14145654-14145676 GAGGAGAAGAAGGAGGAGAAAGG + Intronic
1177198175 21:17924519-17924541 GAGGTGAACAAGGAAGAGAAAGG + Intronic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177861705 21:26462247-26462269 GTGGTGGCAAGGGATGAGGAGGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178174994 21:30086370-30086392 GGGGTGAGGATGGATGGGGAGGG - Intergenic
1178219696 21:30642302-30642324 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178982143 21:37273567-37273589 GGGGTGGAGAAGGAGGAGGGGGG + Intergenic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179208580 21:39306446-39306468 GTGGTAAAGACAGAGGAGGAAGG + Intronic
1179272984 21:39865914-39865936 GTGGGAGAGAAGGAGGAGGAGGG - Intergenic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1179480936 21:41678256-41678278 GGGGAGAAGAAGGTTGGGGAGGG + Intergenic
1180211827 21:46299501-46299523 TGGGAGCAGAAGGATGAGGACGG - Intergenic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180647800 22:17353936-17353958 TTGGTGAAAAAGGAAAAGGATGG - Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181187628 22:21118279-21118301 GTGGTCTAGAAGGAAAAGGAAGG - Intergenic
1181211570 22:21292214-21292236 GTGGTCTAGAAGGAAAAGGAAGG + Intergenic
1181397937 22:22634672-22634694 GTGGTCTAGAAGGAAAAGGAAGG - Intergenic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181500686 22:23314043-23314065 GTGGTCCAGAAGGAAAAGGAAGG - Exonic
1181622288 22:24099271-24099293 GTGCTGGAGAAGGATGACAAGGG + Intronic
1181705907 22:24649353-24649375 GTGGTCTAGAAGGAAAAGGAAGG - Intergenic
1181905652 22:26193596-26193618 TTGGTGCAGTGGGATGAGGATGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182003886 22:26943142-26943164 GTGGTGAAAGGGGATGAAGAGGG + Intergenic
1182043666 22:27258021-27258043 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1182043759 22:27258807-27258829 GTGGTGGGGAAGGAGGGGGAAGG + Intergenic
1182151251 22:28028617-28028639 GAAGGGAAGAAGGATGAGGGAGG + Intronic
1182198829 22:28548332-28548354 GTGTTGAGGAAGTATGAGGTAGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1183062132 22:35342675-35342697 CTGGTGTAGAGGGATGAGGCAGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184549275 22:45195936-45195958 GTGGGGGAAAAGGAAGAGGAGGG - Exonic
1184749230 22:46474729-46474751 GAGGTGAGGAAGGAGGAAGAGGG - Intronic
1184797009 22:46738383-46738405 GGGGAGAAGAGGGAGGAGGAAGG + Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1203275247 22_KI270734v1_random:82174-82196 GTGGTCTAGAAGGAAAAGGAAGG + Intergenic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949631019 3:5926628-5926650 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
949815206 3:8050882-8050904 ATGGTGAAGGAGGGTGGGGATGG + Intergenic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950610209 3:14121981-14122003 GTGGAGAAGACGGAAGGGGAGGG + Exonic
950626442 3:14250889-14250911 GCGGAAAAGAGGGATGAGGAAGG + Intergenic
950796171 3:15512162-15512184 GTGGTACAGAAGGATGAGTGAGG + Intronic
951621833 3:24610258-24610280 TGTGTGAAGAAGGAGGAGGATGG + Intergenic
952107585 3:30087736-30087758 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
952552724 3:34497595-34497617 GTGATGAGGAAGGATAAAGAAGG + Intergenic
952798347 3:37263389-37263411 GCGGGAAAGAGGGATGAGGAAGG + Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953545593 3:43861808-43861830 GTAGTGAAGAGCGGTGAGGATGG + Intergenic
953563583 3:44013055-44013077 TTGGTGACGGAGGAGGAGGAAGG + Intergenic
953621672 3:44538118-44538140 GAAATGAAGAAGCATGAGGAGGG + Intergenic
954419892 3:50413182-50413204 GTGGTGGTGGAGCATGAGGAGGG + Intronic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
954995036 3:54873354-54873376 AAAGTGAAGAAGGAAGAGGAAGG - Intronic
955349055 3:58180582-58180604 GGGGTGGTGAAGGATGAGGCTGG - Intergenic
955851009 3:63219844-63219866 GTGGAGGTGAAGGATGTGGAAGG + Intergenic
956741563 3:72279914-72279936 GTGGGGAAGGAAGAGGAGGAGGG + Intergenic
956920754 3:73926730-73926752 TTGGGGTAGAGGGATGAGGAAGG - Intergenic
957166246 3:76677280-76677302 GAGAAGAAAAAGGATGAGGAGGG + Intronic
957235814 3:77588893-77588915 TTGGCGAAGAAAGAAGAGGAAGG + Exonic
957899926 3:86476169-86476191 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
957944377 3:87043931-87043953 GTGGAAAAGAGGGATGAGAAAGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
960048181 3:113217028-113217050 GTGGTGAAGTAGGTGGAGGTTGG + Intronic
960184572 3:114623219-114623241 GTTATTAAGAAGGATGTGGAAGG + Intronic
960237479 3:115300497-115300519 GTGGGGAAGAATGAAAAGGAAGG + Intergenic
960268516 3:115648872-115648894 GTGATTAAGAAGGATGACAATGG + Intronic
960349610 3:116576331-116576353 TTGGGGAAGAAGTATGTGGATGG + Intronic
960965987 3:123105078-123105100 GAGGTGGAGAAGGGGGAGGAGGG + Intronic
961018719 3:123486434-123486456 GTGTTGGAGAAGGATGAAGATGG - Intergenic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
961345539 3:126260957-126260979 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
961428561 3:126864348-126864370 GTGGTGATGAAGGAGGAGGAGGG - Intronic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
962378208 3:134876150-134876172 GGGGTGGAGAAGGATAAGGCTGG - Intronic
962564533 3:136644218-136644240 GTGGTGAAAAACTTTGAGGATGG + Intronic
962780239 3:138707855-138707877 GTGGTGGAAAAGGAAAAGGAAGG - Intronic
963299598 3:143583973-143583995 GTAATGAAGAAGAAGGAGGAGGG + Intronic
964082399 3:152775270-152775292 GTGGAGAAGAATGATGAAGCAGG - Intergenic
964539562 3:157764490-157764512 GAGGTGAAGTAAGATGAGAATGG + Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965545006 3:169906543-169906565 GTAGTGAAGAAGGAAGAACAAGG + Intergenic
965599547 3:170441733-170441755 GTGGTGGAGGTGGGTGAGGAAGG - Intronic
966004197 3:174988315-174988337 GCAGTGAAGAATGAAGAGGAAGG + Intronic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
966775329 3:183538410-183538432 ATGGTGAAGAAATAAGAGGAAGG - Intronic
966908496 3:184544545-184544567 GGGGAGAAGGAGGAGGAGGAGGG - Intronic
966908524 3:184544619-184544641 GAGGGGGAGAAGGAGGAGGAGGG - Intronic
966908546 3:184544673-184544695 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
966924439 3:184635236-184635258 GTCGGGAAGAGGGAGGAGGAGGG + Intronic
967066270 3:185919469-185919491 GAGGTGGAGGAGGAGGAGGATGG - Exonic
967914608 3:194569345-194569367 GTGGTGCAGGAGGCTGAGGTGGG + Intergenic
967977484 3:195043698-195043720 GGGGGGAAGAGGGATGGGGATGG - Intergenic
968091013 3:195898196-195898218 CTGGTGGAGAAGGTGGAGGACGG - Intronic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
969403457 4:6972670-6972692 GCGGAAAAGAGGGATGAGGAAGG + Intronic
969554623 4:7898057-7898079 CTGGTTGGGAAGGATGAGGAAGG - Intronic
969673216 4:8601180-8601202 GTGCTGAAGCAGGTTGGGGAAGG - Exonic
969820728 4:9718199-9718221 GTGGTGAATGAGGCTCAGGAGGG - Intergenic
969832065 4:9805914-9805936 CTGGTGAAGAATGCTGAGGCAGG + Intronic
970027318 4:11637163-11637185 ATGGTGAAAAATGAAGAGGAAGG + Intergenic
970535837 4:17028952-17028974 GTGGTAAATAAGGATGACTAGGG - Intergenic
970737250 4:19187576-19187598 ATGATGAAGATGGATGAGGATGG + Intergenic
971192612 4:24441693-24441715 GGAGGGAAGAAGGAAGAGGAGGG + Intergenic
971311540 4:25529614-25529636 GGGTGGGAGAAGGATGAGGATGG + Intergenic
971357985 4:25912259-25912281 GGGAAGAAGTAGGATGAGGATGG + Intronic
971358140 4:25913377-25913399 GTGGTGCAGAGGGCGGAGGATGG + Intronic
971631706 4:29000678-29000700 ATGGTGAAGAGGGAAGATGATGG + Intergenic
971633812 4:29031262-29031284 GAGGAGAAGGAGGACGAGGAGGG - Intergenic
972201420 4:36718094-36718116 GTGTTGAACAAGGATGTGGTGGG + Intergenic
972436536 4:39040756-39040778 GTGGTGAAGAGAGCTGAGGCTGG + Intergenic
972789489 4:42357308-42357330 GGGGAGAAGAAGGGAGAGGAGGG + Intergenic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973810453 4:54564948-54564970 GTGGTGAGAAAGGCTGAGGGTGG - Intergenic
974229244 4:59088853-59088875 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975443927 4:74441043-74441065 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
975477925 4:74844316-74844338 GTGGGGGTGAAGGGTGAGGACGG - Intergenic
975612027 4:76213250-76213272 GGGTTAAAGAAGGATGAGGAAGG - Intronic
975814039 4:78198725-78198747 GAAGTGAAGAAGGAAGAGGAGGG - Intronic
975979841 4:80144888-80144910 GTGGGGAAGTGAGATGAGGAAGG - Intergenic
976951667 4:90840243-90840265 GTGGAGAAGAATGAGGAGAAAGG + Intronic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
977555740 4:98485883-98485905 TTGCTGAGGAAGGATGGGGATGG - Intronic
977937974 4:102827580-102827602 GCGGTGAAGAGGCAGGAGGAGGG - Intronic
978083952 4:104626826-104626848 CTGCTGAAGAAGGATGTGTATGG + Intergenic
979908889 4:126334605-126334627 GTAGTGAAGAAGGATACAGAGGG - Intergenic
980012101 4:127607942-127607964 GTGGCGAAGGAGGATGTGGGGGG - Intergenic
980714740 4:136614819-136614841 ATGGTGATGTAGGATGTGGAAGG - Intergenic
981491158 4:145340792-145340814 ATGTTAAATAAGGATGAGGATGG + Intergenic
981518598 4:145636646-145636668 ATGTTGAAGAAGGTTGAGGCAGG - Intronic
981845607 4:149164687-149164709 GGGGTGTAGAAGGGTGGGGAGGG - Intergenic
983365382 4:166780490-166780512 GTAGGGAAGATGGATGTGGATGG - Intronic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983582766 4:169325442-169325464 TTGGGGAAGAAGTATGTGGATGG + Intergenic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983983260 4:174025324-174025346 ATGGTGAAAAAGGAAGAGAAAGG + Intergenic
984225330 4:177028053-177028075 GTGTTGAGGATGGATGAGAAAGG - Intergenic
984411066 4:179398687-179398709 GTCGTGGAGAAGGAAGTGGAGGG - Intergenic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
985031391 4:185794257-185794279 GAGATGGAGAAGGAGGAGGAGGG + Intronic
985784994 5:1888753-1888775 GAGGAAAAGAAGGATGAGCAAGG - Intergenic
985949223 5:3210652-3210674 GTGGTGGGGGAGGATGAGGCTGG + Intergenic
986059411 5:4173862-4173884 GTGCTGAACAAGGTTGAGGGTGG + Intergenic
986659583 5:10046949-10046971 GGGGTGAGGAAGGAAGGGGATGG - Intergenic
986811979 5:11369711-11369733 GTGTTGAAGAAAAATGAGGCAGG + Intronic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
987353221 5:17039920-17039942 GAGGAGGAGAAGGAGGAGGATGG - Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
987817185 5:22917744-22917766 GTGGTGGAGTAGGGTGGGGATGG + Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988709073 5:33755393-33755415 TTGATGAGGAAGGATGGGGAAGG + Intronic
988795860 5:34653264-34653286 GTATTGATGAAGGATGAGCAAGG + Intergenic
989274146 5:39567139-39567161 GTACTGAGGAAGGAAGAGGAAGG + Intergenic
989308047 5:39980329-39980351 GTGGTAAATAGAGATGAGGAAGG - Intergenic
989457561 5:41661138-41661160 TTGGGGAAGAAGTATGTGGATGG - Intergenic
990125024 5:52505027-52505049 GGAGTGAAGGAGTATGAGGAAGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990735235 5:58853376-58853398 GCTGTGAAGGAGGATGAGAAGGG - Exonic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
991499230 5:67259637-67259659 GTGGTGAAGCACGCTGAGCAAGG + Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992869709 5:80993916-80993938 GGGGTGAAGAAGGTTGGAGAGGG + Intronic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
994291282 5:98031321-98031343 GTGGGGAAGAGGTATGTGGATGG - Intergenic
994325226 5:98439106-98439128 ATGGTGGTGAAGGATGTGGAAGG - Intergenic
994613204 5:102072013-102072035 GAGGTGAAGAAGGATGCTAAGGG - Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995041994 5:107599276-107599298 GTTGTAAAGAATAATGAGGAAGG + Intronic
995069668 5:107904925-107904947 GGGGTGAAGCAGGAGGAGGAGGG + Intronic
995404319 5:111777010-111777032 GAGGTGGAGGAGGAGGAGGAAGG + Intronic
995570666 5:113477658-113477680 GTGGTGCAGAGGGAAGAGGAAGG + Intronic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
995907168 5:117139242-117139264 TTGGTGAACATGGAAGAGGAAGG + Intergenic
997163348 5:131632801-131632823 GGGGTAAAGAAGTATGAAGAAGG - Intronic
997412735 5:133702567-133702589 GTGGTGTTGAAGGATGATGGAGG - Intergenic
997599571 5:135130136-135130158 GTGGTTAAGAAGGATGAGCTGGG - Intronic
997718161 5:136057452-136057474 GTGGCTAAGAAAAATGAGGAAGG + Intronic
998036866 5:138924788-138924810 GTGGTGAGGAAGGAGGAGTTGGG + Intronic
998698482 5:144668702-144668724 GGGGTGAAGAAGCATGGGGCTGG + Intergenic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999470677 5:151852156-151852178 AGGGTGAAGAAAGATGGGGAAGG - Intronic
1000091068 5:157930100-157930122 GAGGGGAAGAAGGGGGAGGAAGG + Intergenic
1000417055 5:160994530-160994552 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1000444866 5:161307119-161307141 GTGGTGAGGAAGGAGGAAGAAGG - Intronic
1000847551 5:166300367-166300389 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1001079097 5:168653858-168653880 GGGGTGGAGTAGGATGAGGAAGG - Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001661665 5:173397816-173397838 GTGGGGAAGAAGGACCAGGGTGG + Intergenic
1001938521 5:175724594-175724616 GGGGTAAAGAAGGCTGAGCAAGG - Intergenic
1002054766 5:176592431-176592453 GTGGTGATGATGGATGATGACGG + Intronic
1002103740 5:176869798-176869820 GTGGTGAGGAACGATGCGGGAGG - Intronic
1002576866 5:180178970-180178992 GGGCTGAAGCAGGATGAGGGAGG + Intronic
1002633892 5:180597785-180597807 GTGAGGAAGGAGGCTGAGGAAGG + Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003271362 6:4610773-4610795 GAGCTGGAGAAGGATGAGGTCGG - Intergenic
1003313288 6:4987558-4987580 GTGGTGGAGCAGGATGTGGAGGG - Intergenic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1003468782 6:6409224-6409246 GTGGTGAGGAATGATGTGGGGGG - Intergenic
1003695808 6:8405520-8405542 TTGGGGAAGAAGTATGTGGAGGG - Intergenic
1003962048 6:11217945-11217967 GTGGAGAATAAGGATGAGAGTGG - Intronic
1003975991 6:11345108-11345130 GGGGTGAGGCAGGATGAGAAGGG + Intronic
1004366749 6:15019405-15019427 GTGGTGTAGAAGGTTGACAAAGG + Intergenic
1004486864 6:16074170-16074192 GTGCTTTAGAAGGCTGAGGACGG + Intergenic
1004722022 6:18276027-18276049 GAGGTGAAGAGGGAGGAGGGAGG - Intergenic
1004826799 6:19431063-19431085 GTGGTGAAGAATGTTAAGCAAGG + Intergenic
1005417129 6:25611980-25612002 GGGAGGGAGAAGGATGAGGAAGG - Intronic
1005721981 6:28611614-28611636 GTGGGGAAGAAGTATGTAGAGGG - Intronic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006373765 6:33660448-33660470 GGAGGTAAGAAGGATGAGGAGGG - Intronic
1006425098 6:33958806-33958828 GTGGGGCAGAAGGAAGAGCAGGG - Intergenic
1006914007 6:37583118-37583140 GTGGTGGAGAAGGCTGTGGGAGG - Intergenic
1007515327 6:42406281-42406303 GAGATGAAGAGGGAAGAGGAAGG - Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007682528 6:43644533-43644555 CTGGTGAAGATGGAAGAGAATGG + Intergenic
1008400371 6:51056095-51056117 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1008521690 6:52367726-52367748 GTGTAGAGGAAAGATGAGGATGG + Intronic
1008619507 6:53258149-53258171 GTGGTGAGCAAGGAAGAGGATGG + Intergenic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011919367 6:92552287-92552309 TAGCTGAGGAAGGATGAGGACGG + Intergenic
1011968526 6:93191745-93191767 GTGGAGAGGAAGGAAGAGAAGGG + Intergenic
1012320571 6:97839890-97839912 GTGGAGGGGAAGGAGGAGGAAGG - Intergenic
1012325973 6:97917969-97917991 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1013056582 6:106589167-106589189 GCGGTGGAGGAGGAGGAGGAGGG + Intronic
1013259463 6:108426831-108426853 GTGGAGTAGAAGGTGGAGGAGGG - Intronic
1013269577 6:108533654-108533676 GTGGGGAATAAGGAAGAGAAGGG + Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013396644 6:109747482-109747504 GGGGTCAAGTAAGATGAGGATGG + Intronic
1013793167 6:113858305-113858327 GTGGTGGAGAAAGGCGAGGAGGG + Intronic
1014207597 6:118672993-118673015 ATGATGAAGAAAGATGAGGGAGG + Intronic
1014417074 6:121196018-121196040 TTGGGGAAGAAGTATGTGGATGG + Intronic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015070803 6:129090254-129090276 GGGGTGGAGTAGGATGTGGATGG - Intronic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016332170 6:142964883-142964905 GGGGTGAGGATGGATGAGGAAGG - Intergenic
1016582321 6:145642794-145642816 GTGGTGAACAAGGAAGAATATGG + Intronic
1017044880 6:150337955-150337977 GGGCTGAGGAAGGAAGAGGAAGG + Intergenic
1017143914 6:151216711-151216733 GGAGTGAAGAAGGGAGAGGAAGG + Intergenic
1017296277 6:152798534-152798556 GTAGTCAAGTAGGATGAAGACGG - Intergenic
1017570754 6:155741999-155742021 GGGGTGAAGAGGGATGAGAATGG - Intergenic
1017827935 6:158096114-158096136 GTGGTGAAGAAGGTTCCAGAAGG - Exonic
1018111529 6:160541000-160541022 GTGGGGAGGAAGGAAGGGGAGGG + Intronic
1018163375 6:161069780-161069802 CTGGTGAGGAATGATGGGGAGGG + Intronic
1018252251 6:161882677-161882699 GATGTGAAGATGGATGAAGAAGG + Intronic
1018699592 6:166416110-166416132 GGGGTGATGAAGGATGGTGAGGG - Intronic
1018861770 6:167715652-167715674 GTGGAGGAGGAGGAAGAGGAGGG + Intergenic
1018928786 6:168225898-168225920 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1018960991 6:168448429-168448451 GATGGGGAGAAGGATGAGGATGG + Intronic
1019298757 7:292441-292463 CTGGTGAAAAATGATGAGGCTGG - Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019854118 7:3587000-3587022 GAGGTGGAGGAGGAGGAGGAAGG + Intronic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020279353 7:6642563-6642585 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1020581953 7:10012985-10013007 GTGGTGAGGGAAGAGGAGGAGGG - Intergenic
1020787116 7:12587348-12587370 GTGGGGAGTGAGGATGAGGATGG + Intronic
1021116115 7:16748099-16748121 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1021813317 7:24424556-24424578 GTGGTGATCATGGAAGAGGAGGG + Intergenic
1021824552 7:24535913-24535935 GAGATGAAGGAGGAAGAGGAAGG - Intergenic
1022306709 7:29153454-29153476 GAGGAGAAGAAGGAAGAAGAGGG - Intronic
1022508672 7:30922028-30922050 GTGGTGAGGACTGGTGAGGAGGG - Intronic
1022665930 7:32410442-32410464 GTGGAGGAGGAGGAAGAGGAAGG + Intergenic
1022730013 7:33013453-33013475 GTGGTGGGGGAGGATAAGGATGG + Intergenic
1023218418 7:37891699-37891721 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1023224605 7:37956105-37956127 GTGAAGAAGAAGGAGCAGGAAGG + Intronic
1023370974 7:39511989-39512011 CTGGTGAAGAAGGTTGGGGTGGG - Intergenic
1023809687 7:43902159-43902181 ATGGTGGAGAGGGAGGAGGAGGG + Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024230961 7:47363057-47363079 GTGGTGATGGTGGATGATGACGG - Intronic
1024684348 7:51729135-51729157 GTGGCTGAGAAGGACGAGGAAGG + Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1024832032 7:53472321-53472343 CTGGTGAGAAAGGATGTGGACGG - Intergenic
1024922777 7:54577336-54577358 ATGGTGAAAAAGGAAGAGGCAGG - Intergenic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1025813223 7:64888590-64888612 GTGGTGGAGAAGGTGGAGGGCGG - Intronic
1026000126 7:66554541-66554563 GTTGTGGAGAAGGACTAGGAAGG - Intergenic
1026032366 7:66805418-66805440 GTTGTGGAGAAGGACTAGGAAGG + Intronic
1026104160 7:67407877-67407899 GAGGGGAGGAGGGATGAGGAAGG - Intergenic
1026191905 7:68136490-68136512 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1026245377 7:68615082-68615104 GAGGAGAAGAAGGAGGAGAAGGG + Intergenic
1026364317 7:69632500-69632522 GGGGTGGAGAGGGATGGGGAAGG - Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1027814704 7:82953695-82953717 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1028429050 7:90725848-90725870 TGGGTGAAGAAGGAAGAAGAAGG + Intronic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1028987272 7:97018275-97018297 CCGGTGAATAGGGATGAGGAAGG + Intergenic
1029373859 7:100166523-100166545 GTGGTGACAGAGGATGTGGAAGG + Exonic
1029424768 7:100488698-100488720 GTGCTGAAGGAGGTTGGGGAAGG - Exonic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029630473 7:101747228-101747250 GCGGAAAAGAGGGATGAGGAAGG - Intergenic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030659587 7:112205717-112205739 TTGGGGAAGAAGGGTAAGGAAGG + Intronic
1030962064 7:115936817-115936839 GAGTTGAAAAAGGAAGAGGAAGG + Exonic
1031484670 7:122312091-122312113 CTTGCGAAGACGGATGAGGAGGG + Intergenic
1031824649 7:126548165-126548187 GTGGGGTGGAGGGATGAGGAGGG + Intronic
1032220124 7:129988156-129988178 GAGGCGAGGAAGGATGGGGAAGG + Intergenic
1032403912 7:131642302-131642324 GTGGTTAAAATGGATTAGGAAGG + Intergenic
1032439768 7:131933426-131933448 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1032519970 7:132536473-132536495 GTGGTGCAGAAGGAAGGAGAAGG + Intronic
1032523515 7:132562972-132562994 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032523545 7:132563110-132563132 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032610571 7:133408214-133408236 GTGGTGATGATGGGTGGGGAGGG + Intronic
1033182367 7:139193390-139193412 GTGGTGAAGGAGGAAGGAGATGG + Intergenic
1033209053 7:139446792-139446814 GGGGTGAAGGAGGAGGAGGTTGG - Intergenic
1033277543 7:139984043-139984065 GTGATGAAGTAGGATGAAGATGG + Intronic
1033683407 7:143618720-143618742 GGGGAAAAGAGGGATGAGGAAGG + Intergenic
1033701206 7:143838918-143838940 GGGGAAAAGAGGGATGAGGAAGG - Intergenic
1033807488 7:144971378-144971400 GTGGTGATGGAGGAGGAGGATGG + Intergenic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1035419718 7:158717432-158717454 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419745 7:158717571-158717593 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035662474 8:1358650-1358672 GTGGTGAAGAAGGCTTCTGATGG + Intergenic
1035811240 8:2493049-2493071 GTGGAGAAGAAGGGAGATGAAGG + Intergenic
1035941446 8:3905770-3905792 GTGGTGAAGAATTCTGAGCAAGG - Intronic
1036553597 8:9837696-9837718 GTTTTGAAGATGGAGGAGGAAGG - Intergenic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1036730791 8:11262289-11262311 GGAGTGAAGCAGGATAAGGAAGG - Intergenic
1037458035 8:19083172-19083194 GAGGTGAGGAAGGGTGTGGAGGG - Intronic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1037676608 8:21056555-21056577 GTTGTGAAGAAAGAAAAGGAGGG - Intergenic
1037714019 8:21381743-21381765 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1038040730 8:23722239-23722261 GTGGGGGAGAGGGAGGAGGATGG + Intergenic
1038238385 8:25784452-25784474 GTGGTGATGGAGGAGGAGGAAGG - Intergenic
1038483763 8:27919277-27919299 GTGAAGGAGGAGGATGAGGAGGG + Intronic
1038626425 8:29197676-29197698 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1038837851 8:31148250-31148272 GTCATTAAGAAGGAGGAGGAAGG - Intronic
1039600530 8:38833243-38833265 GCGGAAAAGAGGGATGAGGAAGG + Intronic
1039884400 8:41646960-41646982 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1040969840 8:53123829-53123851 GTGGTCACCAAGGATGGGGAAGG - Intergenic
1041755336 8:61307463-61307485 AAGATGAAGAAGTATGAGGAAGG + Intronic
1041846039 8:62330205-62330227 GGGGTGATGAATAATGAGGATGG + Intronic
1042074867 8:64981282-64981304 GTAGTGAGGAAGAATGGGGAGGG + Intergenic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042836012 8:73079638-73079660 TTGGGGGAGAAGGAGGAGGAGGG - Intronic
1042966677 8:74361086-74361108 GTGGAGAAAAAGGAAGAGAAGGG - Intronic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043545035 8:81306055-81306077 TTGGTGATAAAGGAAGAGGATGG - Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1043979820 8:86624741-86624763 CAGGTTAAGAAGGATGAGGGTGG - Intronic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044431368 8:92111622-92111644 CTGCTGAAGAAGGATGAGAAGGG - Intergenic
1044596162 8:93960921-93960943 TTGGTGAGAAAGGATCAGGAAGG - Intergenic
1045469423 8:102497897-102497919 GTGGGCAAGAAGTATGAGTAGGG - Intergenic
1046718937 8:117597221-117597243 GTGGTGAAGGAGGGAGATGATGG + Intergenic
1046819523 8:118620807-118620829 GTACTGAAGTAGGAAGAGGAGGG - Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1047009066 8:120651532-120651554 GTGGTGAAAAGAGATGAGAATGG + Intronic
1047299860 8:123604415-123604437 GAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1047376993 8:124309004-124309026 GAGGTGGAGGAGGAAGAGGAAGG - Intergenic
1048031123 8:130633446-130633468 GAGGAGAAGAAGGAAGGGGAGGG - Intergenic
1048054744 8:130852740-130852762 GGGGTGCAGAAGGGTGAGGGAGG - Intronic
1048073030 8:131040936-131040958 GGGGCAAAGAAGGAGGAGGAGGG + Exonic
1048477226 8:134754669-134754691 GTTTTGAAGAAGGGTGAGGTGGG - Intergenic
1048636554 8:136302024-136302046 GTGGTGAAGAAAGCAGGGGACGG - Intergenic
1048738003 8:137523087-137523109 GGGGTGGTGAAGGATGAGTAGGG - Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1049969902 9:812799-812821 TTGGCCAAGAAGGATGATGAGGG + Intergenic
1050094169 9:2047060-2047082 GAGGGCAAGAAGGAAGAGGAGGG - Intronic
1050143093 9:2537263-2537285 GTGCTAAAGGAGCATGAGGATGG + Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050475942 9:6041107-6041129 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1050487669 9:6151296-6151318 GTGGTCAAGTAGGATAAGAATGG - Intergenic
1051136863 9:13932638-13932660 GTGGTGGAGAGGGAGGATGAGGG + Intergenic
1051318093 9:15865506-15865528 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051873406 9:21765384-21765406 AGGGTGGAGAAGGAGGAGGAAGG + Intergenic
1052223315 9:26054197-26054219 ATGGTGAAGATGGAGGTGGAGGG - Intergenic
1052442040 9:28510499-28510521 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1052711342 9:32060423-32060445 GGAGTGCAGAAGGATGAGGAAGG - Intergenic
1052820169 9:33132213-33132235 GTTGTGAAGTGGGAAGAGGAGGG + Intronic
1052879662 9:33593592-33593614 GTGGGGTCGAAAGATGAGGATGG + Intergenic
1053095343 9:35322435-35322457 TTGTTGAAGAAAGCTGAGGAAGG + Intronic
1053095595 9:35325250-35325272 GTTGTGAAGAGGAATGAGGGGGG + Intronic
1053453450 9:38212540-38212562 GGGGAGAAGAAGGAGGAGTAGGG + Intergenic
1053735166 9:41096611-41096633 GTTATAAAGAAGGATGAGCAGGG + Intergenic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1054936254 9:70691930-70691952 GAGGAAAAGAGGGATGAGGAAGG - Intronic
1055000990 9:71448171-71448193 AAGGTGAAGAAGGATTAAGAGGG + Intergenic
1055163920 9:73167372-73167394 GAGGTGAAGAATGATGATGAGGG + Intronic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056388306 9:86117448-86117470 GGGGTAAAGAAGGAAGAGGAGGG + Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056701759 9:88917120-88917142 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057775198 9:98002174-98002196 GTGGTTAATGAGGATGAGGATGG - Intronic
1057791849 9:98129896-98129918 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1057896456 9:98912781-98912803 GAGGAGAAGAAGGTAGAGGAGGG + Intergenic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058788518 9:108416809-108416831 GTGATGAAGAAGGAGAAGGAAGG - Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059187370 9:112287009-112287031 TTGGTGGAGACGGATGAGGGGGG - Intronic
1059354226 9:113687062-113687084 GGAGGGAAGAAGGAGGAGGAAGG + Intergenic
1059417374 9:114170238-114170260 GTGGGCCAGAAGGAAGAGGAAGG + Intronic
1059510184 9:114837897-114837919 TTGGTGAAGAAGAAAGATGAGGG - Intergenic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059747266 9:117215002-117215024 CTTGTGAAGAAGGAAGAGCAGGG - Intronic
1059787651 9:117603607-117603629 GTGGTTACTAAAGATGAGGAAGG + Intergenic
1059822152 9:117985171-117985193 GTGTTGCAGATTGATGAGGAAGG - Intergenic
1060031178 9:120216334-120216356 ATGGTGAAGAAGGCAGAGAATGG + Intergenic
1060239770 9:121892885-121892907 GGGTTGCAGAAGGATCAGGAAGG + Intronic
1060381534 9:123179022-123179044 GAAGTGAAGAAAGATGAGGCCGG - Exonic
1060623595 9:125090469-125090491 ATGATGAAGAAGGAGAAGGAAGG + Intronic
1060765351 9:126291650-126291672 GTGGGGAAGAAGGATCAGGAGGG - Intergenic
1061224996 9:129276315-129276337 CTACTCAAGAAGGATGAGGAGGG - Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061618911 9:131798249-131798271 GTGGTGGGGAAGACTGAGGAAGG - Intergenic
1062450324 9:136612755-136612777 GGGGAGGAGAAGGAAGAGGAGGG - Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185499346 X:585140-585162 GAGGAGAAGAAGGTGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185540500 X:899418-899440 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186343899 X:8671065-8671087 ATGATGAAGAAGGCTGAGAATGG - Intronic
1186788036 X:12971588-12971610 GAAGAGAAGAAGGAAGAGGAGGG - Intergenic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187965746 X:24609737-24609759 GGGGTGAAGAAGGTGGAGAAAGG + Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188538835 X:31227045-31227067 GTGGAGAAGGAGGATTAGAAAGG - Intronic
1188835386 X:34948331-34948353 GCGGTGCAGTAGGGTGAGGATGG - Intergenic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189141962 X:38616532-38616554 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1189193566 X:39133000-39133022 GTGGTGATGATGGGTGTGGATGG - Intergenic
1190154090 X:47973655-47973677 GTGGTGAACAGGGAAGAGTAGGG - Intronic
1190328357 X:49220493-49220515 GTGGAGAAAGAGGAAGAGGAGGG - Exonic
1191666656 X:63709400-63709422 GTGGTTTAGAAGGAGGAGGGAGG - Intronic
1191670106 X:63740915-63740937 GTGGTCATTAAGGATGAGGCTGG + Intronic
1191836619 X:65470205-65470227 GTGGAGAAAAAGGAGGTGGAGGG + Intronic
1192059938 X:67813279-67813301 GGGGTGAAGTTGGATGAGGTTGG - Intergenic
1192185052 X:68941000-68941022 GAGGGGAGGAAGGGTGAGGAGGG + Intergenic
1192288066 X:69759806-69759828 CTGGGGAATAAGGATAAGGAAGG + Intronic
1192326050 X:70133353-70133375 GGGGTGAAGGGGGAAGAGGACGG + Intergenic
1192605043 X:72507532-72507554 GTTGTGAGGAAGGATGGAGATGG - Intronic
1192764180 X:74125642-74125664 ATGGTGATGTAGGATGTGGAAGG + Intergenic
1194210358 X:91062977-91062999 GTGGGGAAGAAGTATGTAGATGG + Intergenic
1194536251 X:95108444-95108466 GGGGTGCAGAAGGGTCAGGATGG + Intergenic
1194543910 X:95207918-95207940 GGAGTGAGGAGGGATGAGGAGGG + Intergenic
1194817560 X:98462863-98462885 GTGGTGAAGAAGGAGAAGCCGGG - Intergenic
1195013219 X:100753120-100753142 GTAGCCAAGAAGGGTGAGGAAGG + Intergenic
1195392403 X:104376362-104376384 GAGGTGGAGGAGGAAGAGGAGGG - Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1196059981 X:111397887-111397909 GTGGTTAAGTAGGATTGGGATGG + Intronic
1196264773 X:113629747-113629769 GGGGTGGAGAAGAGTGAGGATGG + Intergenic
1196605902 X:117656721-117656743 GTGGTGGTGCAGGATGTGGAAGG - Intergenic
1197097498 X:122613037-122613059 TTGGGGAAGAAGTATGCGGATGG + Intergenic
1197439114 X:126468914-126468936 GTGGTGTTGGAGGATAAGGATGG + Intergenic
1197457601 X:126697206-126697228 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198311813 X:135432493-135432515 GGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198479792 X:137030929-137030951 GTGGAGAATGAGGATGAAGAGGG - Exonic
1199296807 X:146168671-146168693 GTGGTGCAGAAGTTTGTGGAAGG + Intergenic
1199453686 X:148002763-148002785 GTGAGAAAGAAGGATAAGGAAGG + Intronic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1200745969 Y:6904244-6904266 TTGGGGAAGAAGTATGTGGATGG - Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1200941074 Y:8782565-8782587 GGGGTGAATTTGGATGAGGAAGG - Intergenic