ID: 917514707

View in Genome Browser
Species Human (GRCh38)
Location 1:175697860-175697882
Sequence TTATATCTGCAAAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 394}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917514707_917514711 -2 Left 917514707 1:175697860-175697882 CCATCCTCATTTTGCAGATATAA 0: 1
1: 0
2: 1
3: 55
4: 394
Right 917514711 1:175697881-175697903 AAGGTGACTAAGGCTCAGAATGG 0: 1
1: 2
2: 10
3: 121
4: 976
917514707_917514714 19 Left 917514707 1:175697860-175697882 CCATCCTCATTTTGCAGATATAA 0: 1
1: 0
2: 1
3: 55
4: 394
Right 917514714 1:175697902-175697924 GGGAGCTTCATGTTCATGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 159
917514707_917514712 -1 Left 917514707 1:175697860-175697882 CCATCCTCATTTTGCAGATATAA 0: 1
1: 0
2: 1
3: 55
4: 394
Right 917514712 1:175697882-175697904 AGGTGACTAAGGCTCAGAATGGG 0: 1
1: 0
2: 4
3: 23
4: 300
917514707_917514713 15 Left 917514707 1:175697860-175697882 CCATCCTCATTTTGCAGATATAA 0: 1
1: 0
2: 1
3: 55
4: 394
Right 917514713 1:175697898-175697920 GAATGGGAGCTTCATGTTCATGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917514707 Original CRISPR TTATATCTGCAAAATGAGGA TGG (reversed) Intronic
901385806 1:8908322-8908344 TTCTGTCTTCAAAATAAGGAGGG + Intergenic
902206347 1:14870970-14870992 TGATATCTGGAGAATGAGGAAGG + Intronic
902721267 1:18305839-18305861 TCCTTTCTGTAAAATGAGGACGG - Intronic
902867866 1:19292367-19292389 TTATGTTTGGAAAATGAGTAAGG + Intergenic
903418795 1:23203362-23203384 TAAAATCTGGAAAATGAGCAGGG + Intergenic
904914273 1:33958651-33958673 TTACAGCTGTAAAATCAGGATGG - Intronic
905323733 1:37135438-37135460 TGATTTCTGCAAAAGGTGGATGG + Intergenic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
907162844 1:52383999-52384021 TTAAATCTGCAAATGGAGGGAGG + Intronic
907383704 1:54111699-54111721 TTTCATTTGCCAAATGAGGATGG - Intronic
907913252 1:58845552-58845574 TTTTATGTGCAAAATGGGGCAGG + Intergenic
908400750 1:63770892-63770914 TTATATCATCAAAATAAGGTTGG - Intergenic
908423570 1:63983209-63983231 CCATATCTGTAAAATGCGGAGGG - Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
909065870 1:70934702-70934724 TTATATCTTCACATTGAGGTAGG - Intronic
909977701 1:82064646-82064668 TGAGACCTGCAAAATGAGTAGGG - Intergenic
910154790 1:84203415-84203437 TTATAAGTGCAAAAGAAGGAAGG - Intronic
911604769 1:99891466-99891488 TTATAACTGAAAGATGATGAAGG - Intronic
911902500 1:103524056-103524078 TTATATCTGAAGAATGACAAAGG - Intergenic
912563790 1:110570384-110570406 TTTGATCTGGAAAATGGGGATGG + Intergenic
912897894 1:113612423-113612445 TTATTTCTGCATAAGGATGATGG + Intronic
913425490 1:118724250-118724272 TTATCTCTGGGAAGTGAGGATGG + Intergenic
914963583 1:152229985-152230007 TTACATATGCTAACTGAGGAGGG + Intergenic
916025681 1:160831502-160831524 TTAAATCTGTAAAATGGGGATGG - Intronic
916963765 1:169914528-169914550 ACATATCTTCAGAATGAGGAAGG - Intergenic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
918625432 1:186651651-186651673 TAAGAACTGAAAAATGAGGAAGG - Intergenic
918679683 1:187336848-187336870 TTTAATCTTCAAAATGAGTAAGG - Intergenic
919192500 1:194241397-194241419 TTATATCTTCAAAGTGCTGATGG - Intergenic
919360379 1:196585307-196585329 TTATCTCTTCAAAGAGAGGATGG + Intronic
919506400 1:198403712-198403734 ATATATCTGCACAGTGTGGAAGG - Intergenic
920201809 1:204264165-204264187 TTATATTTGGAAAATGAAAAGGG + Intronic
920878670 1:209860183-209860205 TGCTATCTGTAAAATGGGGATGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921575013 1:216824819-216824841 TTTTATCTGAGAAATGAAGATGG + Intronic
923001928 1:230013247-230013269 ATATATCTGATAAATGAGAAAGG - Intergenic
923246986 1:232142139-232142161 TTAATTCTGCCAAATGAAGAAGG + Intergenic
923292652 1:232561636-232561658 TTCTATCTGTAGAATAAGGAAGG - Intergenic
923339420 1:232994998-232995020 CTTTATCTGCAAGATGAGGAGGG + Intronic
924077491 1:240355480-240355502 TTATAACTGCACAGTGAGGCAGG + Intronic
924316903 1:242807358-242807380 TTATAGCTCCAAAATAGGGAAGG + Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924410219 1:243796719-243796741 TGAGATCTGAAAAATGAGAAGGG - Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1063234557 10:4099447-4099469 TTCTGTCTTCAAAATTAGGAGGG - Intergenic
1064350214 10:14569229-14569251 TTATATCTGCAAACCCATGAGGG - Intronic
1064451551 10:15446354-15446376 TTATTTCTGCAAGCTGAGCATGG - Intergenic
1064593146 10:16915389-16915411 ATATCTCAGCACAATGAGGAAGG + Intronic
1065098715 10:22311163-22311185 TTATATCTTTAAAAAGAGGGAGG - Intergenic
1065329281 10:24577077-24577099 TAATATCTCCAAAATGTTGAGGG + Intergenic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071437202 10:85658404-85658426 TTTAATCTGTAAAATGAGGGGGG - Intronic
1071780757 10:88841667-88841689 TTATGTTTGCAAATTGAGCAAGG - Intronic
1072476536 10:95766623-95766645 ATATATCAGCCAAATGAGAAGGG - Intronic
1073001208 10:100287383-100287405 TTGAAGGTGCAAAATGAGGAGGG + Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073610102 10:104934738-104934760 TTATAATTCCAAAAGGAGGATGG - Intronic
1073725426 10:106224629-106224651 TTCTTTCTGCAAAAGCAGGAGGG + Intergenic
1074288902 10:112123641-112123663 TTAAATCTGGGAAAAGAGGAAGG + Intergenic
1074455982 10:113595414-113595436 TTTTATCTGCAAAATGGTAATGG - Intronic
1074737896 10:116454739-116454761 TTATACCTGCACAATGAAAAAGG - Intronic
1074916020 10:117955705-117955727 TTATATCAGCAAAGTAGGGAAGG - Intergenic
1075877678 10:125822094-125822116 TTTTCTCTGTAAAATGAGGGGGG - Intronic
1075926785 10:126257719-126257741 TTACCTCTATAAAATGAGGATGG - Intronic
1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG + Intergenic
1077525039 11:3059057-3059079 TTAAATCTGCAAAGTGGGGCCGG + Intergenic
1079032928 11:16998991-16999013 GTATATCTGCAATTTCAGGAGGG + Intronic
1080374372 11:31690442-31690464 TTATATCTGCAATATTGTGATGG + Intronic
1081841551 11:46205323-46205345 TAATGTCTGGAGAATGAGGAGGG + Intergenic
1081953590 11:47069202-47069224 TTATATTTACACAATGGGGAAGG - Intronic
1083122164 11:60524446-60524468 TTTTATCTGTAAAATTATGAGGG - Intronic
1084521122 11:69663549-69663571 ATATCTCTGCAAAGTGAGGGTGG + Intronic
1084598284 11:70130249-70130271 TTCGTTCTGGAAAATGAGGAGGG - Intronic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1085567854 11:77530931-77530953 TTAAATCTGGAAAATGAAAAGGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086325993 11:85700036-85700058 TTGTATCTGCACAATGTGAATGG - Intronic
1086723516 11:90150893-90150915 TTATATCTGAATAATGAAGTGGG - Intronic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1087154038 11:94883894-94883916 TTATAACTGCAATTTGAGCAGGG + Intergenic
1087187838 11:95220745-95220767 TTATACCTGCATAATGAGCCAGG + Intronic
1087671184 11:101108724-101108746 TTATATCTGAAAAAAGGAGATGG + Intronic
1087920237 11:103858587-103858609 TGTAATCTGTAAAATGAGGAAGG + Intergenic
1088077288 11:105866052-105866074 TTATATCTCCCAAATTATGATGG + Intronic
1088272673 11:108050935-108050957 AGATATATGGAAAATGAGGACGG - Intronic
1088296179 11:108297712-108297734 TTATATCTTCAAAATAAGTGAGG + Intronic
1088314687 11:108496157-108496179 TTATATTTTTAAAATGGGGATGG + Intronic
1090144694 11:124309079-124309101 TTATATCTTCCCTATGAGGAAGG + Intergenic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1091014741 11:132039768-132039790 TTACATCTGCAATATGAGCATGG - Intronic
1092517693 12:9232965-9232987 TTATCTCTGAATAATGAGCAGGG + Intergenic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1094574428 12:31671209-31671231 ATATATGTGCAAAATGGGTAAGG - Exonic
1095251823 12:39988464-39988486 TTATATTTAAAAAAAGAGGAAGG + Intronic
1096984516 12:55747426-55747448 TGAGTTCTGCAAAATCAGGATGG - Intronic
1097631418 12:62068138-62068160 TTGTATTTTCAAAGTGAGGAAGG - Intronic
1098412154 12:70198022-70198044 TTATATCTCCAAAATAATAATGG + Intergenic
1098420865 12:70296160-70296182 CTATATCTGAAAGATGGGGAGGG - Intronic
1098457008 12:70685851-70685873 TCCTATCTGAAAAATGGGGAAGG - Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098842969 12:75499229-75499251 CTAAATCTGCAAAATGAGCAAGG + Exonic
1098975170 12:76895132-76895154 CTGTATCTGCAAAAGGAGCAAGG + Intergenic
1099557764 12:84130700-84130722 TTATAACTGAAAAATGTGCATGG - Intergenic
1100085799 12:90909080-90909102 TTATTTCTCCAAATTGAGGAAGG + Intronic
1100922102 12:99499760-99499782 TTAAATCTGCAATTTGGGGAGGG - Intronic
1102511462 12:113418398-113418420 TTAAATCTGCAAATTGGGAAAGG + Intronic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1103718797 12:122962334-122962356 TCATATCTGCAAAATGGGCTGGG + Intronic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1105073608 12:133254153-133254175 TTAAATATGCAAAATGCTGAAGG + Intergenic
1105718859 13:23094192-23094214 TTATATCTGGAGACAGAGGAGGG + Intergenic
1107163747 13:37262333-37262355 TTATATTTTCAAAGTGAGAAAGG - Intergenic
1107494153 13:40908456-40908478 TTATATCTGTGAAATTAGTAAGG - Intergenic
1107539092 13:41369261-41369283 TTATACCTGAAAAATTAGAAAGG + Exonic
1108584411 13:51856616-51856638 TTACCTTTGCAAAATGATGACGG - Intergenic
1108595788 13:51947866-51947888 TTTTATCTGCAATATCAGGGAGG - Intronic
1109494497 13:63150070-63150092 ATATATCAGGAAAAAGAGGATGG - Intergenic
1109877537 13:68426147-68426169 TTATATATGACAAATAAGGAAGG + Intergenic
1110744914 13:79040625-79040647 TTATATCTGCCCATTGAGGTAGG - Intergenic
1110967434 13:81717463-81717485 TTATATTTTTGAAATGAGGAAGG - Intergenic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113673666 13:112194031-112194053 GTTTATCTACAAAATGAGGAAGG - Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1114954651 14:27802970-27802992 CTATATCTGTAAAATAAAGAAGG - Intergenic
1116277323 14:42852278-42852300 TTGTATCCCCAAAATAAGGAGGG + Intergenic
1116375435 14:44193360-44193382 TTATATGTGCAAAATGTGGTTGG + Intergenic
1116585249 14:46695218-46695240 TTATATTTTAAAAATGAGAATGG - Intergenic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118675293 14:68178041-68178063 TGATTACTGCAAAATGAAGAGGG - Intronic
1119579209 14:75760684-75760706 TTATTTTTTAAAAATGAGGATGG + Intronic
1120257060 14:82134033-82134055 TTGAATCTGCAAAAAGAGAAAGG - Intergenic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122286517 14:100655671-100655693 GTATTTCTTAAAAATGAGGAGGG - Intergenic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1126601143 15:50428715-50428737 TTTTATCTGCAAAATTATGAAGG - Intronic
1126718059 15:51543383-51543405 TTCCATATGCAAAATGAGAAGGG - Intronic
1127721017 15:61699358-61699380 TAATATCTGCACCAGGAGGAGGG - Intergenic
1128181669 15:65610720-65610742 TTATATCTGAGAACTGGGGAGGG - Intronic
1128918579 15:71590359-71590381 TTATGGCTGCATAATGAGAATGG - Intronic
1129743261 15:78000527-78000549 TGATTTCTGCCAAATGAGGAGGG - Intronic
1129792607 15:78351398-78351420 TTTTATCTGGAAAATGCAGAAGG - Intergenic
1129842213 15:78750913-78750935 TGATTTCTGCCAAATGAGGAGGG + Intergenic
1130927039 15:88393300-88393322 CTTTATCTGTAATATGAGGATGG + Intergenic
1130960554 15:88656026-88656048 TCCTATTTGTAAAATGAGGAAGG + Exonic
1130971346 15:88736161-88736183 TTATCTTTGGAAAAGGAGGAAGG + Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131659691 15:94500304-94500326 TAAAATCAGCAAAATGAAGATGG - Intergenic
1132193861 15:99894809-99894831 TTCTGTCTCCAAAGTGAGGATGG - Intergenic
1133658691 16:7892800-7892822 CTATATTTGCATGATGAGGATGG + Intergenic
1134297609 16:12961009-12961031 TTATATCTGTAACATGTGGGGGG + Intronic
1134373730 16:13650233-13650255 TTACATAAGCAAAATGAGGTGGG + Intergenic
1134693450 16:16206027-16206049 TTCCATCTGCAAAATGGGGTCGG + Intronic
1134866983 16:17617155-17617177 GTAAATCTGAAAAATGTGGATGG - Intergenic
1135054328 16:19218483-19218505 TTGTATCTGCAAAGGGAAGAAGG + Intronic
1135862241 16:26067311-26067333 TTATGCATTCAAAATGAGGAGGG - Intronic
1136191614 16:28618861-28618883 TTCTATTTGCAAAATAAGGATGG - Intronic
1136415617 16:30101639-30101661 AAATCTCTGCAAAATCAGGAAGG + Intergenic
1136616181 16:31399873-31399895 TCATATCTGTAAAATGAGAATGG - Intronic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1138018813 16:53457570-53457592 TTAAAGCTATAAAATGAGGAGGG + Intronic
1138834818 16:60421398-60421420 CTAGATCTGAAAAATGAGAAAGG - Intergenic
1138835629 16:60431105-60431127 TCCTATCTGTAAAATGAGGAAGG - Intergenic
1138853140 16:60654755-60654777 TTATAGCTACAAAAGAAGGATGG + Intergenic
1140739801 16:77931007-77931029 CTAAATCTGTAAAATGAGGAGGG - Intronic
1141277203 16:82599121-82599143 TTATATCTCCAAAGTCAGGTTGG - Intergenic
1141333919 16:83137350-83137372 TTCTACCTGGAAAATGAGGAAGG + Intronic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1144116390 17:12096558-12096580 TAACATTTGCAAAATGAGAAAGG - Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1147361289 17:39932237-39932259 TAATATCCACAACATGAGGAGGG - Intergenic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1148244842 17:46023939-46023961 TTCAATCTGCAAGAAGAGGAAGG - Exonic
1149329125 17:55563422-55563444 ATCTATCTGTAAAATGAGGGTGG - Intergenic
1150428803 17:65099630-65099652 TGATTTCTGTAAAATGGGGATGG - Intergenic
1151806425 17:76408375-76408397 GCGTATCTGCAAAATGAGCATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152723114 17:81932518-81932540 TTCTGTCTGCCACATGAGGAGGG - Intronic
1153774471 18:8440576-8440598 ATGTATCTGTAAAATGGGGAGGG - Intergenic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1158779781 18:60633683-60633705 TTATATCTGTATAAAGAGGTAGG - Intergenic
1159171692 18:64777509-64777531 TATTATCTGCAAAATGATAAAGG + Intergenic
1159253369 18:65910854-65910876 TTAAATCTCCAAAATGCTGACGG + Intergenic
1159863715 18:73680542-73680564 TTTCATCTGTAAAATGAGCATGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160306673 18:77746499-77746521 TTATATTTGCAAAGTAAGGAAGG - Intergenic
1161692568 19:5745320-5745342 CTACATCTTCAAAATGAGGCCGG + Intronic
1164569235 19:29358054-29358076 TAATATATTCAAAATGATGAAGG + Intergenic
1164719112 19:30418906-30418928 TGGTCTCTGCTAAATGAGGATGG + Intronic
1168455475 19:56504365-56504387 TTATTTCTGGAGAATGAGGATGG - Intergenic
926927152 2:17998646-17998668 TTTTATATGCAAAATGTGTAAGG + Intronic
927183489 2:20465844-20465866 CTATGTCAGCAAAATGAGGCTGG - Intergenic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
928216651 2:29367043-29367065 TTGTATTTTCAAAAAGAGGACGG - Intronic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928478158 2:31652506-31652528 TTATATCAGAAAGATGAGGAGGG + Intergenic
929323036 2:40568961-40568983 TTCCACCTGTAAAATGAGGATGG + Intronic
929834991 2:45387499-45387521 TTATAACTGCAAAGTGTGCATGG - Intergenic
930464302 2:51726303-51726325 TTATAACTGCAATCTGTGGAAGG + Intergenic
930688452 2:54333586-54333608 TTTTAACTGCAAAATGATGTGGG + Intronic
931334917 2:61329929-61329951 TTCTATCTGTCAAATTAGGAAGG - Intronic
931456148 2:62411267-62411289 TCATCTCTGCAAAGTGAGGCTGG - Intergenic
933143110 2:78817902-78817924 TTTTCTCTGAAGAATGAGGAAGG + Intergenic
934482667 2:94666320-94666342 CTATATCTGTAAAATAAAGAAGG + Intergenic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935800280 2:106688995-106689017 TTATATCTGAAAAGCCAGGAGGG + Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
938804062 2:134789615-134789637 TGAGATCTGAAAGATGAGGAAGG + Intergenic
940275759 2:151938977-151938999 TTATATCTGCAGATAGAGAAAGG - Intronic
940747623 2:157586641-157586663 ATATATCTGAACAATGATGAAGG + Intronic
941808789 2:169734868-169734890 TAATAAATGCAAAATGTGGATGG - Intronic
942138387 2:172952395-172952417 TTAGATTTGTAAAAGGAGGAGGG + Intronic
943919820 2:193691540-193691562 TTATCTCTACAAAATGTAGAGGG + Intergenic
944568350 2:201015301-201015323 TTACTTCTGCAAGATGGGGAGGG - Intronic
945665847 2:212741311-212741333 TCTTATCTGCAACATGAGGAAGG - Intergenic
946697108 2:222370951-222370973 TAATATCTTCAAAATGTTGAAGG + Intergenic
947914846 2:233824447-233824469 GTAAATCTTCAAAATGAGGATGG + Intronic
1169278881 20:4250560-4250582 TCATAGTTGCAGAATGAGGAGGG + Intergenic
1169634796 20:7677471-7677493 TTTTATTTACAAAAGGAGGAAGG - Intergenic
1169720320 20:8668860-8668882 TTAAAGCTGCAAAGTGAGGTGGG - Intronic
1169859254 20:10134168-10134190 ATATGTCTGCAAACTGCGGAAGG + Intergenic
1170521946 20:17195690-17195712 TTATTTCTGAAAGATTAGGATGG - Intergenic
1173007893 20:39155175-39155197 TTCTATCTTAAAAACGAGGATGG - Intergenic
1173400649 20:42723252-42723274 TAATATTGGCAAAATGAAGATGG - Intronic
1173635520 20:44553530-44553552 TTAGATCAGCAAAATGGTGAAGG + Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174333463 20:49840209-49840231 ATATATCAGCAAACTGAGGACGG - Intronic
1174942444 20:54944716-54944738 TTATTTCTGGAAAATAAGGATGG - Intergenic
1175075384 20:56367960-56367982 TGATCTCTGCAAAACCAGGATGG - Exonic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175820356 20:61905782-61905804 GGATATCTGGAAAATAAGGAAGG + Intronic
1177152365 21:17468122-17468144 GCATATCTGTAAAATGAAGAGGG - Intergenic
1177408911 21:20704852-20704874 TTATATGTGTACAATGATGATGG - Intergenic
1177524839 21:22277659-22277681 GTATATCTGCAAAGTTAAGATGG + Intergenic
1177939801 21:27395447-27395469 TTATATCTTCAAAATATGCATGG + Intergenic
1178211908 21:30544780-30544802 TAATATCTGGAACATGAGGAGGG - Intronic
1178972248 21:37190434-37190456 TTAAATCTTGAAAATGAAGAAGG - Intronic
1179831573 21:44000400-44000422 TGATCTCTGCAAAGGGAGGAGGG + Intergenic
1180749171 22:18112168-18112190 TTTTACCTGCGAAATGAAGAGGG + Intronic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182544415 22:31066201-31066223 TTATTTCTGCCATAGGAGGAAGG - Intronic
1182893251 22:33836753-33836775 TTTTATCTGTAAAATAGGGATGG + Intronic
1183053982 22:35290130-35290152 TTAAATCTGAAAAATAAGTAAGG - Intronic
1183527018 22:38329133-38329155 TTCTACCTGCAAAATGGGCAGGG - Intronic
1183687829 22:39371890-39371912 TCTTATCTGCAAAATGCTGATGG + Intronic
1184658587 22:45954876-45954898 GCACACCTGCAAAATGAGGATGG - Intronic
949102973 3:168209-168231 TTTTATCTACAAAATGGTGAAGG - Intergenic
949169563 3:982155-982177 TTTTATCTACAACATGAGGCGGG - Intergenic
949319293 3:2790880-2790902 TCATGTCTGCAAAATGGTGATGG - Intronic
950256048 3:11506982-11507004 TTAAATGTGCAAAATCAGGCTGG + Intronic
950648636 3:14393437-14393459 GTCCATCTGTAAAATGAGGATGG - Intergenic
951320555 3:21239146-21239168 TTATGGATGCAAAATGTGGATGG - Intergenic
951421781 3:22494868-22494890 TTATATCAGCAGAATGAGACTGG - Intergenic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
953730917 3:45447315-45447337 TTGTATCTGCTAAATGGGAATGG + Intronic
953746677 3:45579631-45579653 CCATTTCTGCCAAATGAGGATGG + Intronic
954905585 3:54059798-54059820 ATAAATCTTCAAAATGTGGAAGG - Intergenic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
957366318 3:79228611-79228633 ATATTTCTCCAAAATTAGGAGGG + Intronic
957366617 3:79232693-79232715 TAATATCTTCAAAGTTAGGAAGG + Intronic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
957764432 3:84603675-84603697 TCACCTCTGCAAAATGAGAAGGG + Intergenic
957765126 3:84614430-84614452 TTATTTCTGTAAAATGAAAATGG - Intergenic
959163627 3:102748627-102748649 TTTTATGTGGTAAATGAGGAAGG + Intergenic
959258611 3:104047543-104047565 TTATATTTACAAAATGTAGAAGG - Intergenic
959539690 3:107524546-107524568 TCATTTCTGCTAAATGAGGAAGG + Intronic
959643299 3:108666162-108666184 GTATATTTGAAAAGTGAGGAGGG + Intronic
960817107 3:121685206-121685228 TTACATCAAGAAAATGAGGAAGG + Intronic
961096889 3:124164955-124164977 TTATATTTGTAAAATGAGGGGGG + Intronic
961498465 3:127312654-127312676 TTACAACATCAAAATGAGGAAGG - Intergenic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
962193317 3:133334048-133334070 TTGGACCTGCAAAATGAGGATGG - Intronic
963888160 3:150603670-150603692 TTATACCTGGAAAAGGAGGGCGG - Intronic
964091052 3:152876012-152876034 TTCCATCTGTAAAATGAGGGTGG - Intergenic
964742502 3:159982457-159982479 TCATATCAGCAAAATGGAGATGG - Intergenic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
966035323 3:175406147-175406169 TAATAGCTGCAAAATGACAATGG + Intronic
966197858 3:177331273-177331295 AAAAATCTGCAAAATGAAGATGG + Intergenic
966211275 3:177455873-177455895 TTATATCTGATAAATGATGGTGG - Intergenic
968693226 4:2007631-2007653 TTACCTTTCCAAAATGAGGAAGG + Intronic
970050566 4:11909822-11909844 ATATATCTGCAAAAAAAGTAAGG - Intergenic
970230199 4:13901946-13901968 TTTTAGCTGAAAAATGAGAATGG + Intergenic
970490858 4:16572200-16572222 GTATATCAGGAAAATGGGGAGGG - Intronic
971612085 4:28738476-28738498 TTATTTCTGCCAAATGAGTCAGG - Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973238679 4:47933298-47933320 TTGTATTTGTAAAATGAGTAGGG + Intronic
973648894 4:52977757-52977779 ATATACCTGAAAAATGAGCAAGG - Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
973726350 4:53780768-53780790 ATATATTTGGAAAGTGAGGATGG - Intronic
975196679 4:71533119-71533141 TAATAACTGCTTAATGAGGAAGG + Intronic
975588080 4:75971327-75971349 TTGTATCTGGAAAATGAGATAGG - Intronic
975824939 4:78309486-78309508 TCCTATCTGGAAAATGAGAATGG - Intronic
976231184 4:82844990-82845012 TTAAAACTGCAAAAGAAGGAGGG + Intronic
976859051 4:89640837-89640859 TTATCTCTGCCAGCTGAGGATGG - Intergenic
977279320 4:95019787-95019809 TTTTATCTGAAAAATGAACATGG - Intronic
977415705 4:96730294-96730316 TCTTATCTGCCACATGAGGAAGG - Intergenic
977805219 4:101289512-101289534 GTTTCACTGCAAAATGAGGAAGG - Intronic
978249821 4:106617210-106617232 TTACATCAGCAAAACAAGGATGG - Intergenic
978547267 4:109884599-109884621 TTACCTCTATAAAATGAGGATGG - Intergenic
978723593 4:111944315-111944337 TGATATCTGAAGTATGAGGAGGG - Intergenic
979471209 4:121099298-121099320 TCATTTCTGCAAATAGAGGAAGG - Intergenic
980074019 4:128274909-128274931 TTTTATCTGCCAAATGGGGAAGG - Intronic
980314383 4:131177906-131177928 TAAAATTTGCAAAATGAGAAGGG - Intergenic
980394658 4:132195190-132195212 TTGTATCTTCAAAATGAGTGTGG - Intergenic
980495688 4:133585887-133585909 TTATAACTGCAAAATTGGCAAGG + Intergenic
980636667 4:135514662-135514684 TTATCTCTGAAGAGTGAGGATGG - Intergenic
981104121 4:140861324-140861346 TTACTTCTGCAAAATGTTGAAGG - Exonic
982475956 4:155850727-155850749 TTTTAATTGCAAAATGAAGAGGG - Intronic
983261674 4:165463689-165463711 GTTTATCTGCAAAATGAAGTTGG + Intronic
984467191 4:180115587-180115609 TTATATCTCCAAAATTAAAAAGG - Intergenic
985348396 4:189032084-189032106 TTATATCACGAAAATGAGAACGG - Intergenic
986884030 5:12212405-12212427 TTATATTTGCAAATTTAGGGTGG + Intergenic
986941868 5:12962371-12962393 TTATATATGCAAAATGTGTAAGG + Intergenic
987483646 5:18493476-18493498 TTGTACCTGCAATGTGAGGAAGG + Intergenic
987642559 5:20631501-20631523 TTGTATCTGAAAAAAAAGGAAGG + Intergenic
988352257 5:30124488-30124510 TTCTCTCTGCAACATGAGGTAGG - Intergenic
990370335 5:55111519-55111541 TTTTAACTGCAAAAAGAGGATGG + Intergenic
993610782 5:90051789-90051811 TTATATCTGGGAAATGGTGAGGG + Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
994968626 5:106706927-106706949 TTATAACTGCATTATTAGGATGG - Intergenic
995234677 5:109814174-109814196 TTATATCTTCAGAATGGGGAGGG - Intronic
995648264 5:114338485-114338507 TTTTATCTATAAAGTGAGGATGG - Intergenic
998356062 5:141537685-141537707 TTATATTTAAAAAGTGAGGAGGG + Intronic
998466224 5:142346370-142346392 TTAGAAATGCAAAATGAGGTGGG + Intergenic
1000845703 5:166277488-166277510 TTATATTAGCACATTGAGGAAGG - Intergenic
1000943948 5:167397534-167397556 TTATCTCTTCAAAATGAGAAGGG - Intronic
1002029927 5:176420391-176420413 TTTTAAAGGCAAAATGAGGAAGG - Intergenic
1002460570 5:179371510-179371532 TTTCATCTGTAACATGAGGATGG - Intergenic
1003241380 6:4348528-4348550 CTATTTCTGCACAATTAGGAAGG + Intergenic
1003719490 6:8684900-8684922 ATATATTTTCAAAATTAGGAAGG - Intergenic
1007051329 6:38833507-38833529 TTATGTCTGCAAATTGTGGAAGG - Intronic
1007614928 6:43174250-43174272 TTCTATCAGGAAAGTGAGGATGG - Intronic
1007701225 6:43767725-43767747 TTATATCTCCACAATGAAGGGGG + Intergenic
1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG + Intronic
1008334023 6:50278272-50278294 TTATATCACCAGAATCAGGAAGG + Intergenic
1008444468 6:51572038-51572060 TTATATCAGCAAAATGTTTAGGG + Intergenic
1011346282 6:86372519-86372541 CTATGTCTTCACAATGAGGAAGG + Intergenic
1011554258 6:88558088-88558110 CTATATATTAAAAATGAGGAAGG - Intergenic
1011604853 6:89093002-89093024 TTATATCTTTAAAATAAGAAGGG - Intergenic
1012509757 6:99989772-99989794 TTATATTTTCAAAAAGTGGAAGG - Intronic
1014832273 6:126116703-126116725 TTTTAACTGTAAAATAAGGATGG + Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015427730 6:133091586-133091608 TTTTGTATGCAATATGAGGAAGG - Intergenic
1015698896 6:136012708-136012730 TTTTAGCTGAGAAATGAGGAAGG + Intronic
1015744350 6:136493929-136493951 TCATGTCTGTAAAATGGGGAAGG + Intronic
1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG + Intergenic
1016388930 6:143555816-143555838 TTTTATCTGCAAATGGAGGTGGG - Intronic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1017274560 6:152551092-152551114 TTATATCCACAAATAGAGGAAGG - Intronic
1019416325 7:928357-928379 CTATCTCTGCAAAAAAAGGAAGG + Intronic
1020506082 7:8989989-8990011 TTAAAACTGCAAAATGTTGAAGG + Intergenic
1021285225 7:18772464-18772486 TTACATCAGCAGAAAGAGGAGGG + Intronic
1021553340 7:21895271-21895293 TTAAATCTGAAAAATGTAGATGG + Intronic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1022236774 7:28469053-28469075 TTATATCTGATAAATAAGTAGGG + Intronic
1023799237 7:43819079-43819101 TGATATTTGCAGAAAGAGGAGGG + Intergenic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026827475 7:73593583-73593605 TTCAATCTGCAAAATGGGGATGG - Exonic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030344636 7:108418687-108418709 TTATAACTTGAAAATGAGGATGG - Intronic
1030631376 7:111899624-111899646 TGAGATCTGTAAAATGAGGCCGG + Intronic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1031235700 7:119173555-119173577 TTATATTTGCATAATAAGAATGG - Intergenic
1031345666 7:120662767-120662789 TTAAAGCTGGAAAGTGAGGATGG + Intronic
1031462970 7:122074645-122074667 TTTTATATGCAATATGAGGTAGG + Intergenic
1032091146 7:128912275-128912297 TTCTTTCTGTAAAATGGGGATGG - Intergenic
1034032384 7:147782261-147782283 ATATTTTTGCAAAATCAGGAAGG + Intronic
1034046667 7:147936606-147936628 TTATACCCTCAAAATGAGGGAGG - Intronic
1034877890 7:154741514-154741536 TTATTCCTGCAAAAAGAAGAAGG - Intronic
1036420247 8:8588751-8588773 GTTTATCTGGAAAATGAGAAAGG + Intergenic
1037095947 8:14988035-14988057 TTATACCTTAAACATGAGGATGG - Intronic
1037187044 8:16076978-16077000 TTATACCTACAATATCAGGATGG - Intergenic
1039074961 8:33681951-33681973 TTATATTTGCAAAAGGAGATTGG + Intergenic
1039794458 8:40900419-40900441 TTCTCTCTGGAAAATGAGGCAGG + Intergenic
1040404269 8:47085051-47085073 ATATATCTGAAAGATGAGAATGG - Intergenic
1040446042 8:47494400-47494422 TTATTTCTCAAAAATGAGGTGGG - Intronic
1040641406 8:49338353-49338375 TTATATCTGACAAATGTGTAGGG + Intergenic
1040907403 8:52482565-52482587 TTATAGCTACTAAATGAGGAAGG + Intergenic
1041531295 8:58870743-58870765 TTATCTCTGGAAAAGGAGCAAGG + Intronic
1041696045 8:60737466-60737488 TTTCATCTGTTAAATGAGGAGGG + Intronic
1041911056 8:63088421-63088443 TTTTATCTGCAAAACTAGGTAGG - Intergenic
1042636123 8:70877414-70877436 TGTAATCTGTAAAATGAGGATGG - Intergenic
1042684421 8:71422291-71422313 TAATGTCTCCAAAAGGAGGAAGG - Intronic
1043528484 8:81122947-81122969 CTTTATCTGTAAAATGAGAATGG - Intergenic
1044290681 8:90465402-90465424 AAATACCTGCAAAATGATGAGGG + Intergenic
1044702312 8:94975821-94975843 TTATATCCACAAAATGAGAATGG - Intronic
1045031240 8:98138456-98138478 TGAAATCTGAAGAATGAGGAAGG - Intronic
1045486922 8:102638759-102638781 TTATATTTGCATAATTAAGAGGG - Intergenic
1045585967 8:103537850-103537872 TTTTTTCTGCCAAATGAGAATGG + Intronic
1046852468 8:118990638-118990660 TTTTCTCTTCAAAATGAAGATGG - Intergenic
1046891844 8:119430653-119430675 CTATGTCCACAAAATGAGGATGG + Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1047699936 8:127438941-127438963 TTAAATGGGCAAAAGGAGGAAGG + Intergenic
1047742081 8:127814587-127814609 CAACATCTGTAAAATGAGGATGG - Intergenic
1047984656 8:130220409-130220431 TTATATCTACACAGTGAGGATGG - Intronic
1048896351 8:138995890-138995912 TTAAATCAGCAGAATGAGTAAGG - Intergenic
1051107039 9:13592322-13592344 TTATATCTACAGAATTAAGAAGG - Intergenic
1052024617 9:23560762-23560784 CTATAGCTGCAAAATAAAGATGG - Intergenic
1052513268 9:29448843-29448865 TTATACCCGCAAAGTGAGGATGG + Intergenic
1052686846 9:31767440-31767462 TTATAACAGAAATATGAGGAAGG + Intergenic
1053675174 9:40418406-40418428 CTATATCTGTAAAATAAAGAAGG - Intergenic
1053924961 9:43044747-43044769 CTATATCTGTAAAATAAAGAAGG - Intergenic
1054288452 9:63256938-63256960 CTATATCTGTAAAATAAAGAAGG - Intergenic
1054386273 9:64558475-64558497 CTATATCTGTAAAATAAAGAAGG - Intergenic
1054509446 9:65957887-65957909 CTATATCTGTAAAATAAAGAAGG + Intergenic
1054942942 9:70763510-70763532 TTATATTTAGAAAAAGAGGATGG + Intronic
1056874135 9:90311737-90311759 TTATTTCTGGAAACTGAGGGTGG - Intergenic
1056923949 9:90816575-90816597 TTATATCTGTACAAGGTGGAAGG + Intronic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057059675 9:91992349-91992371 TTGTATCTGCCAGATTAGGAGGG + Intergenic
1057967476 9:99518164-99518186 TTATAACAACAACATGAGGAGGG + Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058958249 9:109969154-109969176 TGACATCTGAAAGATGAGGAAGG + Intronic
1059016718 9:110525496-110525518 TTATATCTGCATATTAATGATGG - Intronic
1059368692 9:113807619-113807641 TTCTATCCGCCTAATGAGGAAGG - Intergenic
1059459286 9:114419753-114419775 TAGGATCTGTAAAATGAGGATGG - Intronic
1059576680 9:115496875-115496897 CTTTATCTACAAAATGAGAAGGG - Intergenic
1059665265 9:116440326-116440348 TCCTATCTGTAAAATGAGGTGGG + Intronic
1060084826 9:120688328-120688350 TAAAGTCTGCAAAATAAGGAAGG + Intronic
1060326423 9:122620576-122620598 TTTTTTCTTCAAAATAAGGAGGG + Intergenic
1060884660 9:127142226-127142248 ATACATCTGCAATATGAGGCTGG - Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186531176 X:10297297-10297319 CTATAACTCTAAAATGAGGATGG + Intergenic
1186826823 X:13348819-13348841 ATTTATCTGCAAAATAAGGATGG - Intergenic
1186930904 X:14388923-14388945 TTATAGCAGCAGTATGAGGAAGG - Intergenic
1187650782 X:21403192-21403214 TCACATCTGCAAAATGAGGTGGG - Intronic
1188169073 X:26899694-26899716 TAATATATTCAAAATAAGGAGGG + Intergenic
1189072243 X:37876181-37876203 TTATTTCTGAAATAGGAGGAGGG + Intronic
1189589059 X:42492670-42492692 TTATATCTGCAATTTGAGAAGGG - Intergenic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1191959613 X:66686479-66686501 TTATATCTGCAAAATCCTTATGG - Intergenic
1192658417 X:73016874-73016896 TTCTAGCTGCAAATTGAGGGTGG - Intergenic
1192770056 X:74179759-74179781 TTATATTTGCAACATAAGGCTGG - Intergenic
1193335391 X:80282116-80282138 TAATATGTGCAAAATGTGAAAGG - Intergenic
1193751226 X:85346831-85346853 TTTCATCTGCAAAATTAGTAGGG - Intronic
1195767770 X:108314777-108314799 TCCTATCTGTAAAATGAGGATGG + Intronic
1195768466 X:108321909-108321931 TTTTATCTGTAAAATGATAATGG - Intronic
1197098698 X:122625799-122625821 CTATATCTCAAAAATGAAGAGGG + Intergenic
1198039288 X:132833992-132834014 CTGTATCTGCCAAATGAGGATGG - Intronic
1201220405 Y:11763897-11763919 TTATAGCTCCAAAATAGGGAAGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic