ID: 917516794

View in Genome Browser
Species Human (GRCh38)
Location 1:175715023-175715045
Sequence AAACCATGCTTCTCAAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 967
Summary {0: 1, 1: 1, 2: 21, 3: 161, 4: 783}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917516787_917516794 26 Left 917516787 1:175714974-175714996 CCAACCCTTCTACTCTCTCCCAG 0: 1
1: 0
2: 2
3: 47
4: 491
Right 917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG 0: 1
1: 1
2: 21
3: 161
4: 783
917516791_917516794 8 Left 917516791 1:175714992-175715014 CCCAGGCTCTTGACTCAGTCAAC 0: 1
1: 0
2: 0
3: 16
4: 110
Right 917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG 0: 1
1: 1
2: 21
3: 161
4: 783
917516790_917516794 21 Left 917516790 1:175714979-175715001 CCTTCTACTCTCTCCCAGGCTCT 0: 1
1: 0
2: 4
3: 64
4: 619
Right 917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG 0: 1
1: 1
2: 21
3: 161
4: 783
917516789_917516794 22 Left 917516789 1:175714978-175715000 CCCTTCTACTCTCTCCCAGGCTC 0: 1
1: 0
2: 2
3: 53
4: 491
Right 917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG 0: 1
1: 1
2: 21
3: 161
4: 783
917516792_917516794 7 Left 917516792 1:175714993-175715015 CCAGGCTCTTGACTCAGTCAACT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG 0: 1
1: 1
2: 21
3: 161
4: 783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917516794 Original CRISPR AAACCATGCTTCTCAAAGTG TGG Intronic