ID: 917516794

View in Genome Browser
Species Human (GRCh38)
Location 1:175715023-175715045
Sequence AAACCATGCTTCTCAAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 967
Summary {0: 1, 1: 1, 2: 21, 3: 161, 4: 783}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917516787_917516794 26 Left 917516787 1:175714974-175714996 CCAACCCTTCTACTCTCTCCCAG 0: 1
1: 0
2: 2
3: 47
4: 491
Right 917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG 0: 1
1: 1
2: 21
3: 161
4: 783
917516789_917516794 22 Left 917516789 1:175714978-175715000 CCCTTCTACTCTCTCCCAGGCTC 0: 1
1: 0
2: 2
3: 53
4: 491
Right 917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG 0: 1
1: 1
2: 21
3: 161
4: 783
917516790_917516794 21 Left 917516790 1:175714979-175715001 CCTTCTACTCTCTCCCAGGCTCT 0: 1
1: 0
2: 4
3: 64
4: 619
Right 917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG 0: 1
1: 1
2: 21
3: 161
4: 783
917516792_917516794 7 Left 917516792 1:175714993-175715015 CCAGGCTCTTGACTCAGTCAACT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG 0: 1
1: 1
2: 21
3: 161
4: 783
917516791_917516794 8 Left 917516791 1:175714992-175715014 CCCAGGCTCTTGACTCAGTCAAC 0: 1
1: 0
2: 0
3: 16
4: 110
Right 917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG 0: 1
1: 1
2: 21
3: 161
4: 783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917516794 Original CRISPR AAACCATGCTTCTCAAAGTG TGG Intronic
900861402 1:5235200-5235222 GAATCTTGCTGCTCAAAGTGTGG + Intergenic
901217591 1:7563345-7563367 AAACCAGGCTTCTTGAGGTGCGG - Intronic
901682022 1:10918687-10918709 GAGCCTCGCTTCTCAAAGTGTGG - Intergenic
901926847 1:12571453-12571475 GAACAGTGGTTCTCAAAGTGAGG + Intronic
902165052 1:14563421-14563443 GAACCATTATTCTCAAAATGTGG - Intergenic
902566998 1:17318148-17318170 GACCAATGCTTCCCAAAGTGTGG - Intronic
903704724 1:25277317-25277339 GATCCATGTTTCTCAAAGTGTGG + Intronic
903722509 1:25416007-25416029 GATCCATGTTTCTCAAAGTGTGG - Intronic
904786761 1:32988762-32988784 AGATCATGCATATCAAAGTGTGG + Intergenic
904843633 1:33391212-33391234 AGACAGTGGTTCTCAAAGTGTGG - Intronic
904903080 1:33872982-33873004 AAACACTGCTACTCAAAGGGAGG - Intronic
905923830 1:41736181-41736203 ACTCCTTGCTTCTAAAAGTGGGG - Intronic
906257829 1:44364218-44364240 AAACCTTGCTACTCAAGGTGTGG - Intergenic
906481488 1:46202317-46202339 TAACCTTGTTACTCAAAGTGTGG + Intronic
906931141 1:50170721-50170743 AAACCTTGCTACTCAAGGTGTGG - Intronic
906973520 1:50544466-50544488 AAGCAATGTGTCTCAAAGTGTGG - Intronic
907098917 1:51809543-51809565 GAATCGTGCTACTCAAAGTGTGG + Intronic
907198364 1:52705445-52705467 AATCCTTGCTACTCAAAGTGTGG + Intergenic
907334491 1:53691383-53691405 AATCCATGTTCCTCAAAGTCTGG + Intronic
907391077 1:54158618-54158640 AAGTCATGGTTCTCAAGGTGTGG - Intronic
907711502 1:56886859-56886881 GAACGGTGGTTCTCAAAGTGTGG + Intronic
907827394 1:58032055-58032077 AAACTCTGCTTCTCAAAGTGTGG + Intronic
907927955 1:58972432-58972454 AATCCTTGCTAATCAAAGTGTGG + Intergenic
908193418 1:61726191-61726213 ATACCAGTGTTCTCAAAGTGGGG - Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909505375 1:76382586-76382608 AAATGGTGCTTCTCAAAGTATGG + Intronic
909600869 1:77459645-77459667 AATCTGTGGTTCTCAAAGTGTGG - Intronic
909902488 1:81155341-81155363 AAACAATGTTTCTCTATGTGTGG - Intergenic
909943417 1:81636113-81636135 AGGCCTTGCTTCTCATAGTGGGG + Intronic
910060377 1:83084653-83084675 ACCCCTTGCTACTCAAAGTGTGG - Intergenic
910135122 1:83958921-83958943 GAGCCTTGCTACTCAAAGTGTGG - Intronic
910151168 1:84148915-84148937 ACAGCTTGCTACTCAAAGTGTGG + Intronic
910415949 1:86998819-86998841 AAACTTTGCTACTCAAACTGTGG + Intronic
910474135 1:87588941-87588963 AAGCAGTGTTTCTCAAAGTGTGG + Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
912366176 1:109135613-109135635 AACCAATGGTTCCCAAAGTGTGG - Intronic
912992655 1:114504637-114504659 AAGCAGTGATTCTCAAAGTGTGG - Intronic
913022604 1:114803460-114803482 ACACCATGCTTCTTAAAGTAGGG - Intergenic
913164600 1:116173279-116173301 GAGCATTGCTTCTCAAAGTGTGG - Intergenic
913164606 1:116173395-116173417 AACCCCTGCTACTCAAAGTGAGG + Intergenic
913171582 1:116237559-116237581 TACCCTTGTTTCTCAAAGTGTGG + Intergenic
913177549 1:116288753-116288775 GAACACTGGTTCTCAAAGTGTGG + Intergenic
913348056 1:117827789-117827811 GAACGATGGTTTTCAAAGTGTGG - Intergenic
913360247 1:117972513-117972535 GACCAATGTTTCTCAAAGTGTGG - Intronic
915263844 1:154700322-154700344 AACCCTTGCTACTCAAAGTGTGG - Exonic
916024124 1:160819429-160819451 AAGTCTTGCTGCTCAAAGTGTGG + Intronic
916145679 1:161736935-161736957 GCACCCTGCTACTCAAAGTGTGG - Intergenic
916201625 1:162277024-162277046 GCTCCTTGCTTCTCAAAGTGTGG + Intronic
916314825 1:163437437-163437459 AAGCCAAGTTTATCAAAGTGTGG - Intergenic
916452135 1:164930865-164930887 TAACCAGGCTTCTCAAATTGAGG - Intergenic
916583272 1:166127372-166127394 AAACCCTTCTGCTCAAAGTCTGG - Intronic
917218329 1:172701312-172701334 AAACCTTGCTACTCAAAGTGTGG - Intergenic
917457604 1:175198832-175198854 ATACTATGCTTCTCAAACTGTGG - Intergenic
917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG + Intronic
917554365 1:176068292-176068314 AGACAATGGTTCTCAAAGTGTGG + Intronic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919468682 1:197952352-197952374 AAGCAATGGTTCTCAAATTGTGG - Intergenic
919799939 1:201347944-201347966 GGACCTTGCTGCTCAAAGTGTGG - Intergenic
919911912 1:202116573-202116595 AAAACATGCATCTAAAAGTCAGG - Intergenic
920294873 1:204949934-204949956 AAATCATGCTTCTCAATGGGAGG - Intronic
920456522 1:206105834-206105856 AAGCTATGCTCCTCAAAGGGTGG - Intergenic
920662180 1:207924572-207924594 TGACCTTGCTGCTCAAAGTGTGG - Intergenic
921215520 1:212933635-212933657 AAAACTTGCTTCTCAAAGTGGGG + Intergenic
922148493 1:222974865-222974887 AAAGAATGCTCATCAAAGTGCGG + Intronic
922609166 1:226911622-226911644 CAGCCGTGCTTCTCAAAGTGTGG + Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923336022 1:232970981-232971003 CAGCAGTGCTTCTCAAAGTGCGG - Intronic
923622673 1:235591039-235591061 GAGCCTTGCTACTCAAAGTGTGG - Intronic
924151176 1:241131504-241131526 AAACAGTAGTTCTCAAAGTGTGG - Intronic
924159781 1:241218934-241218956 AGCCAATGGTTCTCAAAGTGTGG - Intronic
924268882 1:242311475-242311497 AACCAGTGGTTCTCAAAGTGTGG - Intronic
924353750 1:243147540-243147562 AAACCATGACTTTCAAAATGAGG + Intronic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063421860 10:5918592-5918614 AAGCCATGGTTCTCAAAGTGTGG + Intronic
1063533954 10:6864304-6864326 CAGCGGTGCTTCTCAAAGTGTGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1063868436 10:10392177-10392199 AAATAATTGTTCTCAAAGTGTGG - Intergenic
1064614278 10:17136315-17136337 GAACCTTGCTACTCCAAGTGTGG + Intergenic
1064874963 10:19983713-19983735 TAACCTTGCTGCTCAAAGTACGG + Intronic
1064911994 10:20412408-20412430 TAACTGTGCTCCTCAAAGTGTGG - Intergenic
1065220909 10:23495155-23495177 AAATAATGGTTCTTAAAGTGGGG - Intergenic
1065420343 10:25536804-25536826 AACCCATGCTACTCTAACTGTGG + Intronic
1066112517 10:32210030-32210052 AAGCAATGCTTCTCAAAGTGTGG + Intergenic
1066296667 10:34059995-34060017 GAACCTCGCTACTCAAAGTGTGG - Intergenic
1066716030 10:38287290-38287312 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1067190657 10:44065202-44065224 AAACTGTGCTTCTCAAAGTGGGG - Intergenic
1067723969 10:48752161-48752183 CAGCAATGCTTCTCATAGTGTGG + Intronic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1068656986 10:59585945-59585967 TATCCATGTTTCTCAAAGAGTGG - Intergenic
1068973084 10:62979671-62979693 GAGCAATGGTTCTCAAAGTGTGG - Intergenic
1069090292 10:64192295-64192317 AAAACATGCTTATAAAAATGGGG + Intergenic
1069256442 10:66336797-66336819 TAGCAATGCTTCTCAAAGAGTGG + Intronic
1069658775 10:70109596-70109618 AGGCCTTGCTACTCAAAGTGTGG + Intronic
1069850207 10:71399194-71399216 GAACCTTGCTCCTCAGAGTGTGG + Intronic
1069888909 10:71640892-71640914 AAACAGTGGTTCTCCAAGTGTGG - Intronic
1069924871 10:71842080-71842102 AACCAGTGGTTCTCAAAGTGTGG + Intronic
1069988468 10:72299543-72299565 ATCCAATACTTCTCAAAGTGGGG - Intergenic
1069998099 10:72355335-72355357 AAACCATGCCTCACAAACAGTGG - Intergenic
1070025693 10:72629429-72629451 AAACAGTGGTTCTCAAAGTGTGG - Intergenic
1070126913 10:73629844-73629866 AAACAATGCTACTCAAAACGTGG - Intergenic
1070528592 10:77316590-77316612 AACCAATGCTTCTCAAAGTGGGG - Intronic
1070680281 10:78444163-78444185 AAGGCATGCTTCTCAAACTCTGG + Intergenic
1071399882 10:85258816-85258838 AACCAGTGCTGCTCAAAGTGTGG + Intergenic
1071414434 10:85427925-85427947 AAGCTTTGCTACTCAAAGTGTGG + Intergenic
1071561702 10:86650682-86650704 GGTCCTTGCTTCTCAAAGTGTGG - Intergenic
1071982846 10:91021282-91021304 AAACCTTGCTACTCAGAGTGTGG + Intergenic
1072060410 10:91804731-91804753 AAACCATACTTCCCAAACTGAGG - Intronic
1072177130 10:92937842-92937864 AAGCACTTCTTCTCAAAGTGTGG + Intronic
1072192351 10:93086418-93086440 AGACTATGCTTCTGAAAGTAGGG - Intergenic
1073493122 10:103868162-103868184 GGTCCATGCTACTCAAAGTGTGG - Intergenic
1073513774 10:104059547-104059569 AGACCTTGCTACTCAAAGTGTGG - Intronic
1073568240 10:104554071-104554093 GAACCTTGCCACTCAAAGTGAGG - Intergenic
1073680880 10:105702020-105702042 AAAGCAAAATTCTCAAAGTGTGG + Intergenic
1073831289 10:107386253-107386275 AAATAGTGCTTCTCAAAGTATGG - Intergenic
1074310861 10:112322149-112322171 GACCCATGGTTCTCAAACTGTGG - Intergenic
1074889868 10:117726504-117726526 AACCTAGGCTCCTCAAAGTGTGG - Intergenic
1075260449 10:120958831-120958853 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1075887634 10:125915172-125915194 ACGCCATGCTTCTCAAAGTGTGG - Intronic
1076523966 10:131099163-131099185 AAACCCTGCTCCTCAATGGGAGG + Intronic
1077967558 11:7151473-7151495 GAGAAATGCTTCTCAAAGTGTGG - Intergenic
1078155374 11:8795372-8795394 AAGCAGTGGTTCTCAAAGTGGGG + Intronic
1078925105 11:15867721-15867743 AAACCGTGGTTCTCAAAATGTGG + Intergenic
1079551737 11:21707535-21707557 ACACAGTGATTCTCAAAGTGTGG - Intergenic
1079567264 11:21898234-21898256 ACACCATACTTCTCAACGTTAGG - Intergenic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080300795 11:30783020-30783042 AAGCCTTGCTACTCAAAGTTTGG + Intergenic
1080757794 11:35218818-35218840 GGACCTTGCTACTCAAAGTGTGG - Intronic
1080934086 11:36843412-36843434 GAACAGTGTTTCTCAAAGTGTGG - Intergenic
1081333527 11:41834191-41834213 GAACCATGCTGCTCATAGTGTGG + Intergenic
1081684253 11:45030456-45030478 AAACAGTGGTTCTCAAAGTGAGG + Intergenic
1082090320 11:48083808-48083830 GACCCATGGTTCTCAAAGAGTGG + Intronic
1083338658 11:61944486-61944508 GAACCTGGCTTCTCAAACTGAGG - Intergenic
1083710618 11:64546231-64546253 TACCCTTGCTACTCAAAGTGTGG - Intergenic
1083915131 11:65737813-65737835 AAACCATGTTGCTCAAGGGGAGG + Intergenic
1084450359 11:69233206-69233228 GAACAGTGCTACTCAAAGTGTGG - Intergenic
1085799210 11:79572564-79572586 GGCCCATGGTTCTCAAAGTGTGG - Intergenic
1086006245 11:82041240-82041262 AAGCCATGCTTCACAGAGTGAGG + Intergenic
1087025713 11:93647508-93647530 TAACCTTGCTGCTCAAAATGTGG + Intergenic
1087140372 11:94759906-94759928 AACCAGTGGTTCTCAAAGTGTGG + Intronic
1087642660 11:100771988-100772010 AATCCCTGCTTCTCAGAGCGTGG - Intronic
1087921905 11:103876411-103876433 GAACACTGCTTCTCAAAGTATGG - Intergenic
1087971037 11:104484498-104484520 AAATCCTGCTTCTCAACATGTGG + Intergenic
1088542128 11:110924057-110924079 ATTCCTTGCTTCTCAAAGTGTGG + Intergenic
1088592163 11:111413248-111413270 ATACCTTGCTACTTAAAGTGTGG + Intronic
1089397811 11:118147132-118147154 GCACCGTGGTTCTCAAAGTGTGG - Intronic
1089414618 11:118277119-118277141 GGACAATGCATCTCAAAGTGTGG + Intergenic
1089583587 11:119496428-119496450 CAACAGTGGTTCTCAAAGTGTGG - Intergenic
1089712224 11:120323936-120323958 AGCCCTTGCTACTCAAAGTGTGG - Intergenic
1089848086 11:121474186-121474208 AAACCTTGCTACCCAAAGTGTGG + Intronic
1089909309 11:122080119-122080141 GAGCAATGATTCTCAAAGTGTGG + Intergenic
1090035380 11:123245457-123245479 AAACAGTGGTTCTCAAAGTGTGG + Intergenic
1090330791 11:125930661-125930683 AAACTTTGCTACTCAAAGTGTGG - Intergenic
1090874412 11:130775993-130776015 AATCAATGCTTCTCAAAAGGTGG - Intergenic
1090941332 11:131390702-131390724 TCTCCATGGTTCTCAAAGTGTGG + Intronic
1091175395 11:133553247-133553269 GAGCCTTGCTTCTCAGAGTGTGG - Intergenic
1091244809 11:134082825-134082847 AAAGCAGGCTTCTCAACCTGAGG - Intronic
1091910182 12:4224303-4224325 AAACCTTGCTGCTCTCAGTGTGG + Intergenic
1091951146 12:4594039-4594061 AATCCTTGCTTCTCAAAGTGTGG - Intronic
1092786592 12:12032388-12032410 AAATAGTGGTTCTCAAAGTGTGG + Intergenic
1093658251 12:21722595-21722617 CAGCCATGGTTCTCAAAGTGTGG - Intronic
1093756623 12:22860055-22860077 GAACAGTGCTTCTCAAAGTGTGG + Intergenic
1094059085 12:26294345-26294367 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1094073960 12:26451978-26452000 ATAGAATGCTTCTCAAAATGGGG + Intronic
1094329545 12:29275940-29275962 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1094356347 12:29582315-29582337 CACCCAGACTTCTCAAAGTGAGG - Intronic
1094497226 12:30995894-30995916 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
1094663149 12:32491356-32491378 AGACAATGATTGTCAAAGTGTGG - Intronic
1094754480 12:33450719-33450741 AAAGGGTGGTTCTCAAAGTGTGG - Intergenic
1096783589 12:54004782-54004804 AAACAATGCTTCTGGAATTGGGG - Intronic
1097297412 12:57981846-57981868 AAATCTTTCTTCTCAAAGTATGG + Intergenic
1097361757 12:58666070-58666092 GGACCATGGTTCTCAAAGTGTGG + Intronic
1097585383 12:61509453-61509475 CCACCAGGCTCCTCAAAGTGTGG - Intergenic
1097900900 12:64873028-64873050 AAACCATGCTACTCAAACCATGG - Intronic
1098013967 12:66084818-66084840 CACCCAAGCTTCCCAAAGTGTGG - Intergenic
1098064893 12:66603395-66603417 AACTCTTGCTTCTCAAAATGTGG + Intronic
1098864097 12:75742200-75742222 AAACCTTGCTATTCAAGGTGTGG + Intergenic
1099072350 12:78061039-78061061 AAACAGTGCCTCTTAAAGTGTGG + Intronic
1099707521 12:86176104-86176126 AAGCAATGATTCTCAAAGTTTGG - Intronic
1100211245 12:92400735-92400757 GACCCTTGCTCCTCAAAGTGTGG - Intergenic
1100337929 12:93650069-93650091 GATCAATGGTTCTCAAAGTGTGG - Intergenic
1101040410 12:100749803-100749825 AACTCTTGCTACTCAAAGTGTGG + Intronic
1101232103 12:102752070-102752092 CAGCCTTGCTACTCAAAGTGTGG - Intergenic
1101457984 12:104857226-104857248 AATCAATGGTTCTCAAAGTGTGG + Intronic
1101673961 12:106900799-106900821 GAGCCTTGCTTCTCAAGGTGTGG - Intergenic
1102145923 12:110655123-110655145 AGACCTTGCTACTCCAAGTGGGG + Intronic
1102368105 12:112356986-112357008 GAACAATGCCTCTCAAAGTATGG - Intronic
1102753753 12:115320050-115320072 GAACCTTGCTTCTCAAAGTGTGG + Intergenic
1102762727 12:115402795-115402817 GAATCTTGCTCCTCAAAGTGTGG - Intergenic
1102856826 12:116301467-116301489 AACCCAGGCTCCTCAAAGTTAGG - Intergenic
1103054939 12:117811364-117811386 GCACAGTGCTTCTCAAAGTGTGG + Intronic
1103186415 12:118961585-118961607 AAACTTTGCTCCTCAAAGTGTGG + Intergenic
1103238073 12:119390775-119390797 ACTCCTTGCTACTCAAAGTGTGG - Intronic
1103290271 12:119839959-119839981 GAACAATGGTTCTCAAAATGAGG + Intronic
1103645290 12:122387211-122387233 ATACAGTGGTTCTCAAAGTGTGG + Intronic
1103691612 12:122779561-122779583 GAGCCTTGCTTCTCAAAATGTGG - Intronic
1103702360 12:122854570-122854592 ACACAGTGGTTCTCAAAGTGCGG - Intronic
1104216122 12:126735665-126735687 GAACAGTGATTCTCAAAGTGAGG - Intergenic
1104423558 12:128656709-128656731 ACACAGTGGTTCTCAAAGTGTGG - Intronic
1104898802 12:132176823-132176845 GACCCCTGATTCTCAAAGTGGGG + Intergenic
1104960528 12:132486622-132486644 AACCCATGGTTCCCAGAGTGTGG + Intergenic
1105982042 13:25527274-25527296 AATCCCTGCTACTCAAAGTGTGG + Intronic
1106017275 13:25881742-25881764 AACCCCTGCTACTCAAAGTGTGG + Intronic
1106140646 13:27008113-27008135 GATCCTTGCTTCCCAAAGTGTGG - Intergenic
1106257764 13:28037432-28037454 GACCCTTGCTACTCAAAGTGTGG + Intronic
1106759887 13:32858102-32858124 AAACCCTGCTGCTCAAATTGTGG - Intergenic
1106815334 13:33401371-33401393 AAACAATGCATTTCAGAGTGTGG - Intergenic
1106851846 13:33802141-33802163 CATCCTTGCTACTCAAAGTGTGG - Intergenic
1107088764 13:36453234-36453256 CAGCCTTGCTGCTCAAAGTGTGG + Intergenic
1107896170 13:44966099-44966121 TAACAATGTTACTCAAAGTGTGG + Intronic
1107910985 13:45105619-45105641 GAACCTTGCTATTCAAAGTGTGG - Intergenic
1107963436 13:45578711-45578733 AAATCTAGCTACTCAAAGTGTGG + Intronic
1108394404 13:49978800-49978822 CACCCTTGCTTCTGAAAGTGGGG - Intergenic
1108695856 13:52901738-52901760 ATACAGTGGTTCTCAAAGTGTGG + Intergenic
1109042864 13:57362667-57362689 AAGCAATGCTTCACAAAGTGTGG - Intergenic
1109707196 13:66111876-66111898 ATATCATGCTCCTCAAAGTCAGG + Intergenic
1109854490 13:68109125-68109147 ACACCACGCTTCTCCAATTGTGG + Intergenic
1110142367 13:72146519-72146541 AAACCTTGTTCCTCTAAGTGTGG + Intergenic
1110144956 13:72179192-72179214 CAGCCTTGTTTCTCAAAGTGCGG + Intergenic
1110539601 13:76693563-76693585 AAAACATGCTTGTAAAAATGTGG + Intergenic
1110792041 13:79597088-79597110 GAACAGTGCTTCTCAAAGTGTGG - Intergenic
1111055795 13:82948604-82948626 AAACCATGCTCTTCAGGGTGAGG - Intergenic
1111824640 13:93252208-93252230 AGACAGTGGTTCTCAAAGTGTGG - Intronic
1111913971 13:94341983-94342005 AAACAGTGTTTCTCAAAGTAGGG + Intronic
1111981406 13:95019442-95019464 AAATAATGATTCTCAAAGTGTGG - Intergenic
1112611468 13:100959050-100959072 ACACTATGCTTTTCAAATTGGGG + Intergenic
1112877632 13:104064532-104064554 CAGCAATGGTTCTCAAAGTGTGG + Intergenic
1112937891 13:104824031-104824053 TACCCATGCTCCTCAAAGTGGGG + Intergenic
1113523591 13:110956922-110956944 GAGCCTTGCTTCTCAAAGTGAGG - Intergenic
1113619533 13:111703740-111703762 GAGCCTTGCTACTCAAAGTGTGG - Intergenic
1113625062 13:111789001-111789023 GAGCCTTGCTACTCAAAGTGTGG - Intergenic
1113701675 13:112393313-112393335 GAGCCTTGCTTCTCAAAGTGAGG + Intronic
1113774398 13:112934591-112934613 AACCAGTGGTTCTCAAAGTGGGG - Intronic
1113977954 13:114245471-114245493 AATCCCTGCTGCTCAGAGTGTGG + Intronic
1114854207 14:26418075-26418097 AAACTTTGCTACTCAAAGTGTGG + Intergenic
1115044659 14:28976847-28976869 AAAACACTGTTCTCAAAGTGGGG + Intergenic
1115186949 14:30699679-30699701 AAGCCATACTTCTCAAATTGGGG - Intronic
1115212768 14:30984431-30984453 AAGCCATCCTTCTCAAAATTAGG - Intronic
1115230004 14:31150367-31150389 AGACCATGTTTCTAAAAGGGGGG - Intronic
1115950144 14:38712110-38712132 CTACCTTGCTACTCAAAGTGTGG + Intergenic
1116131039 14:40855938-40855960 AAACCAGGATTCTTAAGGTGGGG - Intergenic
1116588652 14:46742602-46742624 GAACAGTGGTTCTCAAAGTGTGG - Intergenic
1117045786 14:51811726-51811748 ACCCCTTGCTACTCAAAGTGTGG - Intergenic
1117070157 14:52048944-52048966 AAACTGTATTTCTCAAAGTGTGG - Intronic
1117235226 14:53767529-53767551 GAACAGTGATTCTCAAAGTGTGG + Intergenic
1117268538 14:54116579-54116601 AAACAATGGTTCTCAAAGTGTGG + Intergenic
1117813103 14:59569424-59569446 AGTCCTTGCTACTCAAAGTGTGG - Intronic
1117894515 14:60468011-60468033 AAAGCATGCTACTAAATGTGTGG - Intronic
1118461143 14:65988428-65988450 GAGCCATGTTTCTCAAAGTATGG - Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118611426 14:67543460-67543482 AGACAGTGATTCTCAAAGTGTGG + Intronic
1118791236 14:69094917-69094939 GAATCATGTTTCTCACAGTGTGG - Intronic
1118970891 14:70636681-70636703 AACACTTGCTTCTCAAAATGTGG + Intergenic
1119131811 14:72179734-72179756 TAACAGTGATTCTCAAAGTGTGG + Intronic
1119436480 14:74600818-74600840 AGGCCCTGCTACTCAAAGTGTGG + Intronic
1119541000 14:75438183-75438205 TAACCTTGCTGTTCAAAGTGTGG + Intronic
1119661187 14:76452958-76452980 AGACTGTGGTTCTCAAAGTGTGG + Intronic
1119687844 14:76646891-76646913 AAATCTTGCTATTCAAAGTGTGG - Intergenic
1119910924 14:78348623-78348645 GGGCCATGCTTCTCAAAGTGTGG + Intronic
1119935809 14:78591406-78591428 ACACCACGCTACTCAAAATGTGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1120659328 14:87233718-87233740 AAACCTTCCTACTCAAAGTGTGG + Intergenic
1120847412 14:89138714-89138736 CAACCCTGCTACTCAAAGTGTGG - Intronic
1121099312 14:91239196-91239218 GCACCTTGCTACTCAAAGTGTGG - Intronic
1121585520 14:95060540-95060562 ACCCCTTGCTACTCAAAGTGTGG - Intergenic
1121641037 14:95485045-95485067 AGCCCATGGTTCTCAAAGTGAGG - Intergenic
1122301826 14:100735751-100735773 TAACTGTGTTTCTCAAAGTGGGG + Exonic
1122452087 14:101817614-101817636 ACACCCTGCCTCTTAAAGTGCGG - Intronic
1123480085 15:20622993-20623015 GGACAGTGCTTCTCAAAGTGAGG - Intergenic
1123637922 15:22377371-22377393 GGACAGTGCTTCTCAAAGTGAGG + Intergenic
1124065642 15:26341175-26341197 AAACCTCGCTTCTCAAAGTGTGG - Intergenic
1124479484 15:30065504-30065526 ATACCATTCTTCTCATACTGCGG + Intergenic
1124553743 15:30707253-30707275 GAACAGTGGTTCTCAAAGTGAGG - Intronic
1124677505 15:31698421-31698443 GAACAGTGGTTCTCAAAGTGAGG + Intronic
1125090371 15:35783885-35783907 AAACAGTGTTTCTCAAAGTATGG - Intergenic
1125313986 15:38411259-38411281 AAGCAATGGTTCTCAAAGTGTGG - Intergenic
1125483107 15:40093815-40093837 CATCCTTGCTTCTCAAAGGGTGG + Intronic
1126866392 15:52941703-52941725 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1127025177 15:54797190-54797212 AAACCATGCTTCTTAATCTGAGG - Intergenic
1127643221 15:60934704-60934726 ATACAGTGGTTCTCAAAGTGTGG - Intronic
1127872260 15:63083361-63083383 GAGCCCTGCTACTCAAAGTGTGG - Intergenic
1128229777 15:66026327-66026349 AAGCAGTGCTACTCAAAGTGTGG - Intronic
1128260656 15:66230651-66230673 AAACCATTCTTATAAAAGGGGGG + Intronic
1128317032 15:66667417-66667439 CCACCCTGCTTCTCACAGTGAGG - Intronic
1128546553 15:68572548-68572570 AATCCGTGGTTCTCAAACTGGGG + Intergenic
1128615455 15:69105344-69105366 AGGCGATGGTTCTCAAAGTGTGG - Intergenic
1129127488 15:73455931-73455953 AACCCCTGCCTCTCAAAGTGTGG - Intronic
1129135947 15:73551368-73551390 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1129509264 15:76108571-76108593 GATCCTTGCTTTTCAAAGTGCGG - Intronic
1129639365 15:77358631-77358653 AAACTATGCTTCTTGAAGTCAGG - Intronic
1129999728 15:80036121-80036143 AAGGCTTGCTACTCAAAGTGTGG - Intergenic
1130537322 15:84796654-84796676 AAACCATTTTTCTGAAATTGAGG - Intronic
1130665269 15:85864138-85864160 AAACAATGGTTCTCAAAGCATGG + Intergenic
1130704785 15:86223040-86223062 GAATCTTGCTACTCAAAGTGTGG - Intronic
1131029079 15:89171159-89171181 GGACAATGGTTCTCAAAGTGTGG + Intronic
1131312420 15:91303045-91303067 AAACCAGGCTTCTCCAAGGTTGG + Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1131869136 15:96743566-96743588 AGAACATACTTCTCAAATTGGGG + Intergenic
1132319295 15:100913791-100913813 GATCAATGGTTCTCAAAGTGTGG - Intronic
1133492882 16:6288436-6288458 AATCCTTGCTACCCAAAGTGTGG - Intronic
1133646117 16:7766324-7766346 CACCCATGCTACTCTAAGTGTGG + Intergenic
1133824028 16:9261164-9261186 AATCCTTGCTGCTCAAAGTGTGG - Intergenic
1133849323 16:9486954-9486976 AAACCAGGATTTTCGAAGTGAGG + Intergenic
1133866371 16:9647758-9647780 ACATCTTGCTTCTAAAAGTGGGG + Intergenic
1133907391 16:10034585-10034607 TCAACATCCTTCTCAAAGTGTGG - Intronic
1134315196 16:13112599-13112621 AACTCATGCTTCTCAATGAGAGG - Intronic
1134438331 16:14282092-14282114 AAGCAGTGCTTCCCAAAGTGAGG + Intergenic
1134908209 16:18000276-18000298 AAACAATGGTTCTCAAAGTGTGG + Intergenic
1135141847 16:19928703-19928725 AAATCTTGCTATTCAAAGTGAGG - Intergenic
1135182364 16:20286958-20286980 AGGACATGCTTCTCAAAGTGGGG - Intergenic
1135249306 16:20887450-20887472 AATCACTGTTTCTCAAAGTGTGG - Intronic
1135844388 16:25905446-25905468 ATACCTTGTTTCTCAAAGAGTGG + Intronic
1135853616 16:25986756-25986778 AGACCAAGATTCTCAAAGGGAGG + Intronic
1136076027 16:27817845-27817867 GAACAGTGCTACTCAAAGTGTGG - Intronic
1136291303 16:29273211-29273233 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1137279122 16:46960221-46960243 AACCAATGATTCTCTAAGTGTGG + Intronic
1137427828 16:48394623-48394645 AAACCAAGCTTCTTGAGGTGTGG - Intronic
1137891447 16:52166924-52166946 GAACAATGGTTCTCAAAGTGAGG + Intergenic
1137930219 16:52580100-52580122 GAACCTTGCTACTCAAAGTGTGG + Intergenic
1138217125 16:55214333-55214355 AAACCTTGCCTCTCACAGTATGG + Intergenic
1138911174 16:61401054-61401076 AAACAGTGGTTCTCAAAGTGCGG + Intergenic
1139158128 16:64469020-64469042 AATCACTGTTTCTCAAAGTGAGG - Intergenic
1139354359 16:66358538-66358560 AGACAGTGGTTCTCAAAGTGTGG - Intergenic
1139942225 16:70613514-70613536 GAACCTTGGTACTCAAAGTGTGG + Intronic
1140138625 16:72231827-72231849 AAACAGTGCTATTCAAAGTGAGG - Intergenic
1141176642 16:81724671-81724693 AAGCCTTGCTGCTCAATGTGTGG + Intergenic
1141414661 16:83861038-83861060 ACACAATGATCCTCAAAGTGTGG - Intergenic
1141631313 16:85289591-85289613 GCTCCATGGTTCTCAAAGTGTGG - Intergenic
1141837143 16:86549148-86549170 GAACAGGGCTTCTCAAAGTGAGG + Intronic
1142097170 16:88246677-88246699 AAGCGGTGGTTCTCAAAGTGTGG - Intergenic
1142261369 16:89043987-89044009 TAAGCATGCTTCTCCAAGCGAGG - Intergenic
1143383755 17:6512640-6512662 AATACACGCTTCTCAAAGAGTGG - Intronic
1143834630 17:9680716-9680738 AAATAGTGGTTCTCAAAGTGTGG - Intronic
1144040691 17:11408273-11408295 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1144314492 17:14046951-14046973 AAACCCTGCTACTAAAAGTGTGG + Intergenic
1144814536 17:18024840-18024862 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1145283378 17:21485212-21485234 AAAACCTGATTCTCAATGTGAGG + Intergenic
1145285443 17:21502875-21502897 AAACCAAGCTAGGCAAAGTGTGG - Intergenic
1145392082 17:22462869-22462891 AAACCAAGCTAGGCAAAGTGTGG + Intergenic
1145394108 17:22480618-22480640 AAAACCTGATTCTCAACGTGAGG - Intergenic
1146114662 17:30124304-30124326 AACCCATCCTTCTCAAACTGTGG - Intronic
1146889628 17:36497926-36497948 AAGCCTTGGTTCTCACAGTGTGG + Intronic
1147252904 17:39164285-39164307 AACTCTTGCTCCTCAAAGTGTGG - Intronic
1147302879 17:39543976-39543998 AAAACATGGTTCTTAAAGTTAGG - Intronic
1147494469 17:40902812-40902834 AAGCGAGGGTTCTCAAAGTGTGG + Intergenic
1147564033 17:41525622-41525644 AAAATATGCTTCGCATAGTGGGG - Intronic
1148037754 17:44680912-44680934 AAACAGTGGTTCTCAAAGTGTGG + Intronic
1148226168 17:45899152-45899174 AAACCATGGTTCTCAACTGGGGG + Intronic
1148234650 17:45960494-45960516 AATCCATGATTGTCAAAGTCTGG + Intronic
1149772756 17:59333692-59333714 AAGCGATGCTTCTCAAACTATGG - Intronic
1149867489 17:60158768-60158790 AAACAGTGGTTCTCAAAGTGCGG + Intronic
1150477377 17:65485328-65485350 TATGCATGCTACTCAAAGTGTGG - Intergenic
1150536729 17:66050510-66050532 ATCCCATGCTTCACAAAATGGGG + Intronic
1151011610 17:70504473-70504495 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1151426022 17:74031672-74031694 AAACCTTGCTGCTCATTGTGTGG - Intergenic
1151993152 17:77591591-77591613 TTACCTGGCTTCTCAAAGTGTGG - Intergenic
1152165717 17:78704057-78704079 AGACCAAGCTTCTCAAAGTCTGG + Intronic
1152202423 17:78954817-78954839 AACCTGTACTTCTCAAAGTGGGG - Intergenic
1152990636 18:360705-360727 AATCCTTGCTCCTCGAAGTGTGG - Intronic
1153947522 18:10030846-10030868 GAACAGTGGTTCTCAAAGTGGGG - Intergenic
1154504052 18:15017297-15017319 AAAATATGGTTTTCAAAGTGTGG + Intergenic
1154958691 18:21286176-21286198 AACCACTGCTTCTGAAAGTGTGG - Intronic
1154975794 18:21456254-21456276 GAGCCATGCTACTCAAAGTGTGG - Intronic
1155111460 18:22719584-22719606 AGACCAGTTTTCTCAAAGTGTGG + Intergenic
1155237747 18:23838372-23838394 AGAGCCTGCTTTTCAAAGTGAGG - Intronic
1155518487 18:26645755-26645777 AAACAGAGGTTCTCAAAGTGCGG + Intronic
1156020345 18:32593254-32593276 AGACAATGCTTCTGAAAGTTGGG + Intergenic
1157108077 18:44793436-44793458 GATCAGTGCTTCTCAAAGTGTGG + Intronic
1157315985 18:46590112-46590134 ACACAGTGGTTCTCAAAGTGTGG + Intronic
1157524022 18:48365038-48365060 ATATCAGGGTTCTCAAAGTGTGG - Intronic
1157681634 18:49612059-49612081 AAGTAGTGCTTCTCAAAGTGTGG - Intergenic
1157753562 18:50198491-50198513 GAGCAATGTTTCTCAAAGTGTGG - Intergenic
1158162074 18:54496428-54496450 GACCTGTGCTTCTCAAAGTGGGG - Intergenic
1158324237 18:56297108-56297130 AACCCTTGCAACTCAAAGTGTGG + Intergenic
1158338036 18:56434642-56434664 AAAACAGGGTTCTCAAAGAGTGG + Intergenic
1158404840 18:57151826-57151848 ACACAATGGTTCTCAAGGTGTGG - Intergenic
1158482004 18:57830514-57830536 AAACGGTGCTACTCCAAGTGAGG - Intergenic
1158545703 18:58394639-58394661 ACACTGTGCTTCTCAAACTGGGG - Intronic
1158670390 18:59468898-59468920 GAACCATGTGTCTGAAAGTGTGG - Intronic
1158842746 18:61405666-61405688 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1158902007 18:61972768-61972790 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160052559 18:75449056-75449078 GAACCAGGCTTATCACAGTGAGG + Intergenic
1162854808 19:13460129-13460151 GACCCTTGCTACTCAAAGTGTGG + Intronic
1162870156 19:13580406-13580428 AAGCCATGCTTCTTAAAATGCGG + Intronic
1163626033 19:18390291-18390313 CAACCAGGCTCCGCAAAGTGGGG - Intergenic
1164464080 19:28472740-28472762 AAGCCTGGCTACTCAAAGTGTGG - Intergenic
1164663795 19:30007290-30007312 CAGCCTTGCTACTCAAAGTGTGG - Intronic
1165142169 19:33706173-33706195 ATGCCATGCATCTCATAGTGTGG - Intronic
1165357849 19:35314897-35314919 TGACAATGGTTCTCAAAGTGTGG + Intergenic
1166254714 19:41595137-41595159 GAGCCTTGCTACTCAAAGTGTGG + Intronic
1166255177 19:41599231-41599253 AAGCCTTGCTTCTCACAGCGTGG + Intronic
1166259389 19:41627224-41627246 CAACCCTGCTTCTCAAAGTGTGG - Intronic
1166274898 19:41746458-41746480 AACCCTTGCTACTCAAAGTGTGG + Intronic
1166279941 19:41785410-41785432 AACCCTTGCTACTCAAAGTGTGG + Intergenic
1166407008 19:42528626-42528648 CAGCCTTGATTCTCAAAGTGTGG - Intronic
1166412802 19:42567786-42567808 AAGCCTTGCTACTCAAAGTGTGG - Intergenic
1167052934 19:47090608-47090630 AAATGATGCTTTCCAAAGTGTGG + Intronic
1167401803 19:49277521-49277543 ACACCAGGCTGCTCAAAGTGTGG + Intergenic
1168387448 19:55976447-55976469 GAGCCGTGGTTCTCAAAGTGTGG + Intronic
1168673983 19:58263522-58263544 AAAACATGACTCTCAGAGTGGGG + Exonic
925399653 2:3563230-3563252 AAGTCATGGTTTTCAAAGTGTGG + Intergenic
925782151 2:7390905-7390927 ACACAGTGCTTTTCAAAGTGTGG - Intergenic
925934540 2:8742725-8742747 AAATCTTGCTTCACAGAGTGTGG - Intronic
926111672 2:10187874-10187896 ATGCCACGGTTCTCAAAGTGTGG + Intronic
926288033 2:11506249-11506271 AAACCACGCTTCTCAAGGACAGG - Intergenic
926924473 2:17973271-17973293 AAACAATGCTACTTAAAGTATGG - Intronic
927107544 2:19840965-19840987 AATGCTTGCTTCTCTAAGTGTGG - Intergenic
927705840 2:25296113-25296135 AACAAATGCTTCTCAAAGTGAGG + Intronic
928393554 2:30927314-30927336 GAACCTTGCTCCTCAAATTGTGG + Intronic
928946453 2:36776209-36776231 AACCAGTGGTTCTCAAAGTGTGG + Intronic
928947464 2:36784358-36784380 AGACCTTGCTACCCAAAGTGTGG + Intronic
929078004 2:38094542-38094564 AGACAATGGTTCTCAAAGTGTGG - Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929263397 2:39891994-39892016 AAACTTTCCTTATCAAAGTGAGG + Intergenic
929837726 2:45422408-45422430 AATCCATGTTTTTCAAACTGAGG + Intronic
930486863 2:52021710-52021732 AAACAATGCTTCTCAAATCAAGG - Intergenic
931229424 2:60361615-60361637 AAAGAATGCTTATCAAAGTAGGG + Intergenic
931267734 2:60675333-60675355 CAACCCTGCTACTCAAAGGGTGG - Intergenic
931580770 2:63770618-63770640 ATACAGTGGTTCTCAAAGTGTGG + Intronic
931670025 2:64639185-64639207 AAATAGTGTTTCTCAAAGTGTGG + Intronic
931923149 2:67042915-67042937 AAGCACTGGTTCTCAAAGTGTGG + Intergenic
932309144 2:70725907-70725929 AAACTTTGCTACTCAAAGTATGG - Intronic
932698514 2:73977195-73977217 AACTCCTGCTACTCAAAGTGTGG - Intergenic
932733155 2:74234723-74234745 GAACAGTGATTCTCAAAGTGTGG - Intronic
932963955 2:76448572-76448594 AAACACTGTTTATCAAAGTGAGG - Intergenic
933135970 2:78736233-78736255 ATGCAATGATTCTCAAAGTGTGG + Intergenic
933331277 2:80895866-80895888 AACCAATGATTCTCGAAGTGTGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
933666095 2:84966442-84966464 AACTAATGGTTCTCAAAGTGCGG - Intergenic
933759729 2:85665283-85665305 AAGCCATGATTCCCAAGGTGAGG - Exonic
934045416 2:88169651-88169673 GAGCCTTGCTTCTCAAACTGCGG - Intergenic
935333529 2:101994823-101994845 AATCCTTTCTACTCAAAGTGTGG - Intronic
935813555 2:106824937-106824959 AAAGAATGGTTCTCAAAGCGTGG + Intronic
936234900 2:110733822-110733844 AAGTTATGGTTCTCAAAGTGTGG + Intronic
936486245 2:112928331-112928353 GAGCCATGGTTCCCAAAGTGTGG + Intergenic
936490189 2:112963465-112963487 ATACATTGCTACTCAAAGTGTGG - Intergenic
936688722 2:114860019-114860041 TACCCTTGCTTCTCAAAGTATGG - Intronic
936714996 2:115176017-115176039 AAGCCTTACTTCTCAGAGTGTGG - Intronic
937056505 2:118941835-118941857 CATCCTTGCTGCTCAAAGTGTGG - Intergenic
937437256 2:121890603-121890625 CAACTGTGCTTCTCAAGGTGTGG - Intergenic
938242680 2:129755515-129755537 AAACAGTGGTTCTCAAAGTGTGG + Intergenic
938503239 2:131847488-131847510 AAAATATGGTTTTCAAAGTGTGG + Intergenic
938796577 2:134722459-134722481 GATCCTTGCTTCTCAAAGTGTGG - Intergenic
938922732 2:136009796-136009818 GTACCATACTTCTCAAAGTGTGG - Intergenic
938940741 2:136167706-136167728 AAGCTGTGCTTCTCAAACTGGGG - Intergenic
939401364 2:141698942-141698964 ATTCCATGTTTCTCAAGGTGTGG - Intronic
940564170 2:155339475-155339497 AAACCCTGCTTCTCAGAGGGAGG + Intergenic
941028729 2:160487711-160487733 AAACCTAGATTCTAAAAGTGAGG - Intronic
941172252 2:162153578-162153600 AAGCCTTGCTTTGCAAAGTGTGG + Intergenic
941209164 2:162614351-162614373 CAGCAATGCTACTCAAAGTGTGG - Intronic
941412348 2:165174911-165174933 AAAGCTTGCTATTCAAAGTGTGG + Intronic
941432189 2:165426479-165426501 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
941490871 2:166140864-166140886 AAACCTTGCTTCTGAAAGTGTGG + Intergenic
941897151 2:170640485-170640507 AACACACGTTTCTCAAAGTGTGG + Intronic
942799158 2:179856969-179856991 GCACCTTGCTTCTCAAAGCGTGG + Intronic
943370724 2:187012512-187012534 AATCAATGCTTTTCAAACTGTGG + Intergenic
943720717 2:191200786-191200808 AACCAATGGTTCTTAAAGTGTGG + Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944397308 2:199282986-199283008 TATCAATGATTCTCAAAGTGTGG + Intronic
944510409 2:200459284-200459306 AGACCATATTTCTCAAAGTATGG + Intronic
944982112 2:205133341-205133363 GAACAATGGTTCTCAGAGTGTGG + Intronic
945288250 2:208103679-208103701 AAGCCTTTCTTCTCAAAGTGTGG - Intergenic
946011173 2:216564686-216564708 AGACAGTGCTTATCAAAGTGTGG - Intronic
946505651 2:220297902-220297924 AAGCAATGGTTCTCAAAGTGCGG + Intergenic
946598123 2:221328836-221328858 AATCCTTGCTACTCAAAGTGTGG + Intergenic
946646048 2:221835241-221835263 AAGCCTTGCTGCTCAAAATGTGG + Intergenic
946722520 2:222625470-222625492 GAACCTTGCTACTCAAAATGCGG + Intronic
947088372 2:226480970-226480992 AAATAATGCTTTTCAAACTGTGG + Intergenic
947164112 2:227244099-227244121 AACCCTTGCTACTCAAAGTGGGG - Intronic
947328826 2:229006815-229006837 TAACAGTGGTTCTCAAAGTGTGG - Intronic
948277878 2:236724017-236724039 AATCCATTTTACTCAAAGTGGGG - Intergenic
948494016 2:238333682-238333704 AGACAGTGTTTCTCAAAGTGTGG + Intronic
948727252 2:239942396-239942418 AATCCATCGTTCTCCAAGTGTGG - Intronic
948779020 2:240305628-240305650 AAGGAATGGTTCTCAAAGTGTGG + Intergenic
948818271 2:240524885-240524907 GAGCCATGGTTCCCAAAGTGTGG + Intronic
1168968896 20:1917359-1917381 CAGCTATGCTTGTCAAAGTGTGG + Intronic
1169033116 20:2428527-2428549 AGACCACGGTTCTCCAAGTGTGG - Intronic
1169065230 20:2691460-2691482 AAATCTTGCTTCTCACAGTGTGG - Intergenic
1169286812 20:4315155-4315177 GGCCCTTGCTTCTCAAAGTGTGG - Intergenic
1169413268 20:5392937-5392959 TAAACTTGCTGCTCAAAGTGGGG - Intergenic
1169694039 20:8367296-8367318 AATTAGTGCTTCTCAAAGTGTGG + Intronic
1169702958 20:8469078-8469100 AAGCTTTGCTACTCAAAGTGTGG - Intronic
1169738123 20:8859466-8859488 AAGCCTTGCTACTCAAAGTGTGG - Intronic
1169806201 20:9561859-9561881 GAACCTTGCTTCTCCAAGTATGG + Intronic
1169855024 20:10092925-10092947 GAACACTGGTTCTCAAAGTGGGG - Intergenic
1169919039 20:10713823-10713845 ATACCATATTTCTCAAAATGTGG + Intergenic
1169965506 20:11213224-11213246 ACACTTTGCTACTCAAAGTGTGG + Intergenic
1170434171 20:16307577-16307599 AAGCAGTGCTACTCAAAGTGTGG + Intronic
1170459661 20:16565472-16565494 AAACAGTGATTCTCCAAGTGTGG - Intronic
1170474363 20:16700442-16700464 AAACCTTGATACTCAAAGTATGG + Intergenic
1170546607 20:17440185-17440207 AGTCAGTGCTTCTCAAAGTGTGG + Intronic
1170763557 20:19272541-19272563 CAGCCTTGCTTCTCAAAGTGTGG - Intronic
1170768240 20:19310218-19310240 AACCCTTGCTACTCAGAGTGTGG + Intronic
1171214320 20:23341349-23341371 AAACTACAGTTCTCAAAGTGAGG - Intergenic
1172036224 20:32012533-32012555 AACCGGTGGTTCTCAAAGTGTGG - Intronic
1172205607 20:33160871-33160893 TAAGCATGCTGCTCAAAGGGTGG - Intergenic
1172557658 20:35856495-35856517 AACCAGTGCTTCTCAAAGTGTGG - Intronic
1172573853 20:35991810-35991832 ATCCAGTGCTTCTCAAAGTGCGG + Intronic
1173299715 20:41791244-41791266 AAGCAGTGGTTCTCAAAGTGAGG + Intergenic
1173387953 20:42605964-42605986 GAGCCTTGCTGCTCAAAGTGTGG + Intronic
1173552022 20:43938960-43938982 AGACCATGCTTCTAGAAGCGAGG - Intronic
1173703903 20:45096240-45096262 GAGCCTTGCTACTCAAAGTGAGG - Intronic
1174757883 20:53177499-53177521 AAGCCTTGCTTCTTCAAGTGTGG - Intronic
1174768624 20:53276799-53276821 AAGCAATGGTTCTCAACGTGTGG - Intronic
1174797162 20:53531773-53531795 GATCCTTGCTTCTCAAAGTGTGG + Intergenic
1174848416 20:53967124-53967146 AAAACATGTTTTACAAAGTGGGG + Intronic
1175166203 20:57046595-57046617 GGACCTTGCTACTCAAAGTGTGG - Intergenic
1175308156 20:57992179-57992201 CAACCTTGCTACTCAAAGTGTGG + Intergenic
1175426790 20:58872592-58872614 AAAACTTGTTTTTCAAAGTGGGG - Intronic
1175498813 20:59434642-59434664 TCGCCATGGTTCTCAAAGTGTGG + Intergenic
1175549638 20:59808789-59808811 GACCCTCGCTTCTCAAAGTGTGG - Intronic
1175573262 20:60040085-60040107 ACACCTTGCTACTCAACGTGTGG + Intergenic
1176664581 21:9673612-9673634 GAACATTGATTCTCAAAGTGTGG - Intergenic
1177038228 21:16071732-16071754 AATACATGCTTCTCCAAGTTGGG + Intergenic
1178073357 21:28993093-28993115 AAACCTAGCTTCTGAAAGCGGGG - Intergenic
1178233195 21:30811290-30811312 AAACAGTGCTTCTTAGAGTGTGG + Intergenic
1179148325 21:38788534-38788556 GAGCCATGGTTCTCAATGTGTGG + Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179336000 21:40454723-40454745 GAAGCATTCTTCTCAAAGTAGGG + Intronic
1179444196 21:41420168-41420190 GACCCGTGCTTCTCAAAGGGTGG - Intergenic
1179446277 21:41433134-41433156 AGACTGTGGTTCTCAAAGTGTGG + Intronic
1179898522 21:44376931-44376953 CAAGCAGGGTTCTCAAAGTGTGG - Intronic
1180657835 22:17438692-17438714 AAACAATTCTTCTTCAAGTGTGG + Intronic
1180678692 22:17607698-17607720 AAACACTATTTCTCAAAGTGTGG + Intronic
1180704880 22:17803169-17803191 AGGCCGTGGTTCTCAAAGTGTGG - Intronic
1180738487 22:18036370-18036392 AAAGCAAGCTTCTCAAAGTTAGG - Intergenic
1180965723 22:19787127-19787149 CAACCATGTTCCTCACAGTGGGG + Exonic
1181825387 22:25511160-25511182 AACCAGTGATTCTCAAAGTGTGG - Intergenic
1182494544 22:30696519-30696541 AAACAGTGCTTCTCAGAGTGTGG - Intronic
1182767367 22:32767438-32767460 AAAACATGGATCTCAAAATGAGG - Intronic
1182814934 22:33153910-33153932 AAACCATCATTCTCTAAGTTTGG + Intergenic
1182933046 22:34193160-34193182 GGACAATGGTTCTCAAAGTGTGG - Intergenic
1183039028 22:35162248-35162270 AAGCCATACTTCACAAAGTGAGG - Intergenic
1183245310 22:36688759-36688781 AAGCCTTGCTTCTCAAACTGTGG + Intronic
1183794198 22:40101470-40101492 GAGCAATGGTTCTCAAAGTGTGG - Intronic
1184304413 22:43586720-43586742 AAACAGTGGTTCTCAAGGTGGGG + Intronic
949325437 3:2858170-2858192 AAACAGTGTTTCTCAGAGTGTGG + Intronic
949367999 3:3303895-3303917 AAACTATCTTTCTCAAAGTCAGG - Intergenic
949744274 3:7270143-7270165 AAGCATTGGTTCTCAAAGTGTGG - Intronic
949937441 3:9127024-9127046 AACCCTTGCTACTCAAAGTGTGG + Intronic
950160463 3:10756911-10756933 AAACCTTGATACTCAAAGTGAGG + Intergenic
950196093 3:11010344-11010366 GGGCCTTGCTTCTCAAAGTGCGG - Intronic
950335310 3:12188468-12188490 CACCCCTGCTTCTCAGAGTGAGG + Intronic
950577176 3:13839162-13839184 AATCCTTGCTGCTCAAGGTGTGG + Intronic
950892930 3:16420950-16420972 GAATCTTGCTACTCAAAGTGTGG - Intronic
951256771 3:20458890-20458912 AAGCCTTGCTCCTCAAAGTGTGG - Intergenic
951530318 3:23692886-23692908 AAACGATGATCCTCAAAATGTGG - Intergenic
951559553 3:23952156-23952178 AAACCAACCATCTCAAAGTGTGG - Intronic
951587367 3:24229339-24229361 AGATCTTGCTTCTCAAGGTGTGG + Intronic
951696992 3:25455427-25455449 AATCAATGTTCCTCAAAGTGTGG - Intronic
951710842 3:25583773-25583795 AAAACATGAAACTCAAAGTGTGG - Intronic
951941309 3:28081835-28081857 AAGCCTTGCATCTCAAAGTGTGG + Intergenic
952164130 3:30727882-30727904 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
952186625 3:30976252-30976274 TAGCCATGCTTTTCAAAATGTGG - Intergenic
952187354 3:30984405-30984427 GAACCCTGCCTCTCAAAGGGTGG - Intergenic
952330542 3:32360722-32360744 AACTCTTGCTGCTCAAAGTGTGG + Intronic
952681277 3:36096267-36096289 AAAAGAACCTTCTCAAAGTGCGG - Intergenic
952857061 3:37780951-37780973 GACCCTTGCTACTCAAAGTGTGG + Intronic
952860571 3:37808994-37809016 AGACCCTGCTTCTCAATGAGAGG + Intronic
952907366 3:38150620-38150642 GAACGCTGCTACTCAAAGTGTGG + Intergenic
953391317 3:42535480-42535502 AAACCTTGCTGCTCCAAGTATGG + Intronic
953754049 3:45631481-45631503 AAACCATGGGTCACAGAGTGAGG - Intronic
953828229 3:46272596-46272618 AATCCATGCTTAGCAAACTGGGG + Intergenic
953891043 3:46751715-46751737 GAGCATTGCTTCTCAAAGTGAGG + Intronic
954069353 3:48131482-48131504 AGGCAATGGTTCTCAAAGTGTGG - Intergenic
954166504 3:48763252-48763274 GACCAAGGCTTCTCAAAGTGAGG - Intronic
955040419 3:55312409-55312431 GAGCAATGATTCTCAAAGTGTGG + Intergenic
955129690 3:56153287-56153309 GATCCATGCTACTCAAAGTGTGG + Intronic
955295510 3:57731489-57731511 AAAACATGCTGTTCAAAGTCTGG + Intergenic
955648272 3:61164301-61164323 GAAGAAGGCTTCTCAAAGTGTGG + Intronic
955956031 3:64291269-64291291 GAATCTTGCTACTCAAAGTGTGG + Intronic
956002387 3:64742993-64743015 AAACCATACTTCTCAGAGCTGGG - Intergenic
956125424 3:66006787-66006809 AAACCATGTTCTTCAAAGAGAGG - Intronic
956334326 3:68146294-68146316 ACACCTTGCTACACAAAGTGTGG - Intronic
956723332 3:72137184-72137206 AAGCTTTGCTCCTCAAAGTGTGG - Intergenic
956892830 3:73629090-73629112 ATACAGTGCTGCTCAAAGTGTGG + Intergenic
956933059 3:74068052-74068074 GAACAGTGGTTCTCAAAGTGTGG + Intergenic
957463340 3:80552332-80552354 AAACTGTGCTACTCAAAGTATGG - Intergenic
957785339 3:84875354-84875376 AAACAATGCTACTCAAAGTGAGG - Intergenic
958405554 3:93753773-93753795 GAACCATGCTTTTCATAGAGTGG - Intergenic
958797386 3:98720128-98720150 AAACTATGATTTTTAAAGTGTGG + Intergenic
958995360 3:100898371-100898393 AAATCATACTTCTCAAAGTGTGG - Intronic
959091971 3:101912554-101912576 AGACCTTGCTACTCAAAGTATGG + Intergenic
959613679 3:108323112-108323134 AAACAATCCTTCCCATAGTGGGG + Intronic
959697917 3:109269594-109269616 GAACAATGTTTCTCAAACTGGGG - Intergenic
960113886 3:113873384-113873406 ATACAGTGGTTCTCAAAGTGTGG + Intronic
960609394 3:119541553-119541575 ATTCCTTGCTTCTCAAATTGTGG + Intronic
960620493 3:119632297-119632319 AAGCCATGTTTCCCAAAGTGTGG - Intergenic
960891296 3:122451187-122451209 AAACAGTGGTTCTCAAAGTGTGG - Intronic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
962145337 3:132834315-132834337 TAACCACAGTTCTCAAAGTGTGG + Intergenic
962428810 3:135300641-135300663 ATAACTTGCTACTCAAAGTGTGG - Intergenic
962649172 3:137471362-137471384 AACCAATCCTTCTCAAAGCGTGG + Intergenic
962784621 3:138755657-138755679 AGACATTGCTTTTCAAAGTGTGG - Intronic
962932631 3:140051981-140052003 AGGCCATGCTTCTCAAAGTGGGG - Intronic
962983247 3:140509456-140509478 GAACAGTGGTTCTCAAAGTGTGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
963760429 3:149282769-149282791 GACTCTTGCTTCTCAAAGTGTGG - Intergenic
964757066 3:160097947-160097969 AAACCTTGCTGTGCAAAGTGAGG - Intergenic
965765808 3:172128806-172128828 AAAACAAGCTACACAAAGTGTGG + Intronic
965814231 3:172620127-172620149 AGGCCTTGCTACTCAAAGTGTGG + Intergenic
966419010 3:179719075-179719097 GAACCTGGCTTCTCAAAGTGGGG - Intronic
966580560 3:181557655-181557677 ACACCTTGCTTCTCAAAGTATGG + Intergenic
966617002 3:181924401-181924423 AATCCATGCTTATAAAAGTATGG + Intergenic
966648609 3:182274083-182274105 AATCAGTGGTTCTCAAAGTGTGG - Intergenic
966674104 3:182566438-182566460 AATCTTTGCTGCTCAAAGTGTGG - Intergenic
966723092 3:183084249-183084271 AAATCTTGCTACTCAAAGTGTGG - Intronic
966989361 3:185213231-185213253 TATCAATGGTTCTCAAAGTGTGG + Intronic
967218057 3:187226863-187226885 AGGCCTTGCTTCTCAAAGTGTGG + Intronic
967247669 3:187504242-187504264 AATCCTTGCTGCTCAAAATGTGG - Intergenic
967314485 3:188138274-188138296 AGGCCTTGCTTCTCAAAGTGTGG - Intergenic
967576118 3:191095981-191096003 AAACAGTGCTACTCAAAGTGTGG - Intergenic
967683385 3:192391965-192391987 AAGCCTTGCTACTCAATGTGTGG + Intronic
968230029 3:197000059-197000081 AAGGCTTGCTTCTCAAAGTGTGG + Intronic
970693888 4:18652852-18652874 AAACCATGATTTTCAAACCGTGG - Intergenic
970809363 4:20073627-20073649 CAAACATGGTTCTCAAAGTGTGG + Intergenic
970873872 4:20847324-20847346 AACCAGTGATTCTCAAAGTGTGG + Intronic
971904264 4:32705675-32705697 CAGCCTTGCTTCTCAAAGTGTGG + Intergenic
972199753 4:36700790-36700812 AGATCTTGCTTCTCAAAGTGTGG + Intergenic
972308063 4:37851321-37851343 AAACAGTGGTTCTCAAAGTGAGG - Intronic
972572539 4:40323945-40323967 AAACCTTGCTACTCAATGTGTGG + Intergenic
972725451 4:41743332-41743354 TACCAATGGTTCTCAAAGTGTGG - Intergenic
972741637 4:41892753-41892775 TATCCTAGCTTCTCAAAGTGTGG + Intergenic
972818708 4:42674478-42674500 AAATATTGGTTCTCAAAGTGTGG - Intergenic
973290651 4:48467052-48467074 ATATCTTGCTACTCAAAGTGTGG + Intergenic
973618955 4:52708749-52708771 CATCCTTGCTTCTCAAAGCGTGG - Intergenic
974120960 4:57638783-57638805 AGACCATGCTTCTCAAACTTGGG - Intergenic
974121037 4:57639639-57639661 AAGCCTTGGTACTCAAAGTGTGG + Intergenic
974675390 4:65081074-65081096 AATCCTTGCTACTCCAAGTGTGG - Intergenic
975539685 4:75494835-75494857 TAACCATGTTACCCAAAGTGTGG - Intronic
975573698 4:75842450-75842472 GGACCTTGCTACTCAAAGTGTGG + Intergenic
975754689 4:77561184-77561206 AAACCTTGCTGCAAAAAGTGTGG + Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
976908053 4:90263986-90264008 AAAAAATGCTTCCCCAAGTGGGG - Intronic
976928674 4:90534874-90534896 ATGCCATGCTACTCAAAATGTGG + Intronic
977202629 4:94134899-94134921 TTTCCATGATTCTCAAAGTGTGG + Intergenic
977498067 4:97802117-97802139 AAACAGTGTTTCTCAAAGTGTGG - Intronic
977643658 4:99386641-99386663 AGCCCTTGCTACTCAAAGTGAGG + Intergenic
977898457 4:102391638-102391660 AAACAGTGATACTCAAAGTGTGG - Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978503000 4:109428934-109428956 GAACCTTGCTACTCAAAGTGTGG + Intergenic
978524961 4:109655793-109655815 AAGCCCAGCTTCTCACAGTGTGG + Intronic
978634609 4:110789476-110789498 AAATAGTGCTTCTCAGAGTGTGG + Intergenic
978951117 4:114560829-114560851 GAACCATGTTTCTAAAATTGTGG - Intergenic
979248056 4:118532098-118532120 AAACCATGACTTTCAAAATGAGG - Intergenic
979431103 4:120632209-120632231 TAAACTTGCTACTCAAAGTGTGG + Intergenic
980834302 4:138172518-138172540 AATCAGTGATTCTCAAAGTGCGG + Intronic
981021491 4:140034008-140034030 ATACCACCCTTCTCACAGTGTGG + Intronic
981543030 4:145865595-145865617 AGGCAGTGCTTCTCAAAGTGTGG - Intronic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
982123605 4:152165119-152165141 AAGCCATGTATCTCAAAGTGTGG - Intergenic
982837020 4:160131470-160131492 AAACCATGCCTGTCCAAGTTCGG + Intergenic
983264611 4:165494910-165494932 AAACCTTGCTCTTCAAAGTGTGG + Intronic
983544293 4:168946320-168946342 TAACAATGGTTCTCAAAGTATGG + Intronic
983641193 4:169945357-169945379 AGATGATGATTCTCAAAGTGAGG - Intergenic
983701477 4:170600689-170600711 CAGCCATGGTTCTCAAAGTGTGG + Intergenic
983725225 4:170914421-170914443 AAGCCCTGCTTCCCAAACTGGGG - Intergenic
984594718 4:181654463-181654485 AACCAATTCTTCTCAAAGAGTGG + Intergenic
984604715 4:181771794-181771816 AAGCCTTGCTTCGCAAAATGTGG - Intergenic
985410055 4:189674271-189674293 GAACATTGATTCTCAAAGTGTGG - Intergenic
986051933 5:4098352-4098374 AATCTGTGCTTCTCAAACTGTGG + Intergenic
986171041 5:5314864-5314886 AAACCTTGCTACTCACAGTGAGG - Intronic
986267320 5:6201792-6201814 AAACCCTGCAGCTCAAAGAGAGG + Intergenic
987087237 5:14482287-14482309 GAACAGTGGTTCTCAAAGTGTGG - Intronic
987093848 5:14531048-14531070 AAGCCATGTTTCTTCAAGTGAGG + Intronic
987302635 5:16610075-16610097 GAGCCATGGCTCTCAAAGTGAGG - Intronic
987381925 5:17293538-17293560 AAACCTTGCTACTCAATGTGTGG - Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988877815 5:35467867-35467889 GAACAAGGTTTCTCAAAGTGTGG - Intergenic
989182954 5:38596549-38596571 CAGCAATGGTTCTCAAAGTGTGG - Intronic
989269271 5:39512835-39512857 AAACCCTGATACTTAAAGTGTGG - Intergenic
989385993 5:40855055-40855077 ACCCCATTCTTCTCCAAGTGGGG - Exonic
989706097 5:44332712-44332734 AACTCATGCTACTCAAAGTGTGG - Intronic
990174742 5:53094956-53094978 AAGCATTGCTCCTCAAAGTGTGG + Intergenic
990490913 5:56302052-56302074 GAACCTTGTTACTCAAAGTGTGG + Intergenic
990637418 5:57744510-57744532 CAACCTTGCTACTCAAAATGTGG + Intergenic
991068554 5:62451583-62451605 AAACAGTGGTTCTCAAAGTGTGG - Intronic
991068754 5:62453715-62453737 AAGCCATAATCCTCAAAGTGAGG - Intronic
991291183 5:65035252-65035274 AGGCCATGCTTCTTAAAGTATGG - Intergenic
992112260 5:73506738-73506760 CAATCATGCTACTCAAAGTAGGG - Intergenic
992134294 5:73727746-73727768 AAGCCTTTCTTCTCATAGTGTGG + Intronic
992283712 5:75210089-75210111 AAACAATGATTCTCAAAGTATGG - Intronic
992434698 5:76744753-76744775 GATCCATGGTTCTCAAAGTTTGG - Intergenic
993425075 5:87753136-87753158 AACCAGTGATTCTCAAAGTGGGG - Intergenic
993684588 5:90922664-90922686 AAACCTTGCTACTCAGAATGTGG + Intronic
994062475 5:95495691-95495713 AAACCCTGCTGATCAAACTGTGG + Intronic
994312093 5:98285269-98285291 AACAAATGCTACTCAAAGTGTGG + Intergenic
994491768 5:100456099-100456121 AAAACATGCTTATCAAATTTTGG + Intergenic
994523480 5:100873085-100873107 AATCCTTGCTACTCAAAGTGTGG - Intronic
995026225 5:107426333-107426355 TAATCTTGCTACTCAAAGTGTGG + Intronic
995385994 5:111589596-111589618 AAACAGTGATTCTCAAAGTATGG + Intergenic
995396079 5:111688620-111688642 AAATCACGCTACTCAAAGTGGGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995816992 5:116181662-116181684 TAACAATGATTCTCAAAGTATGG - Intronic
995836131 5:116401366-116401388 CAGCCTTGCTACTCAAAGTGTGG - Intronic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996373473 5:122777141-122777163 AAACAGTGCTTCTCAAACTGTGG + Intronic
996781398 5:127190767-127190789 AAACCATGCTACTCAAAGGGTGG - Intergenic
997167613 5:131677751-131677773 AAAGCATTCCTCTCAGAGTGTGG - Exonic
997550015 5:134744152-134744174 AATCAGTGCTACTCAAAGTGTGG + Intronic
998867138 5:146516664-146516686 AAACAGTGGTTCTCAAAGTGTGG - Intergenic
999718022 5:154377589-154377611 AACCAGTGCTTCTCAAAGTGTGG - Intronic
999841020 5:155426568-155426590 AAACTATGTTTCTCAAACAGGGG - Intergenic
999917895 5:156283804-156283826 GAACACTGCTTCTCAACGTGTGG - Intronic
999960702 5:156753019-156753041 GAGCCGTGCTTCTCAAAGTGTGG + Intronic
1000013416 5:157255564-157255586 GAGCCCTGCTACTCAAAGTGTGG + Intergenic
1000183745 5:158838923-158838945 AAACTTTGCAACTCAAAGTGTGG + Intronic
1000288641 5:159849327-159849349 GAACCTTGCTACTCAAAGTGTGG - Intergenic
1000368663 5:160514434-160514456 GAACAGTGCTACTCAAAGTGTGG + Intergenic
1000448023 5:161348601-161348623 GAACTGTGATTCTCAAAGTGTGG - Intronic
1000655122 5:163868392-163868414 ATCCCAGACTTCTCAAAGTGTGG + Intergenic
1000744837 5:165019792-165019814 AAACAGTTGTTCTCAAAGTGTGG - Intergenic
1000992056 5:167921495-167921517 GGTCCATGTTTCTCAAAGTGTGG + Intronic
1001017395 5:168153829-168153851 GAGCAGTGCTTCTCAAAGTGTGG - Intronic
1001259805 5:170218749-170218771 AATACTTGCTCCTCAAAGTGTGG - Intergenic
1001571209 5:172731908-172731930 GAACATTGGTTCTCAAAGTGTGG - Intergenic
1001651055 5:173316742-173316764 AAACCTGGCTTCTCCATGTGAGG - Exonic
1001756931 5:174177640-174177662 AACCAGTGCTTCTCAAAGTGAGG + Intronic
1001786166 5:174415641-174415663 TCACAATGATTCTCAAAGTGGGG + Intergenic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1001912478 5:175532419-175532441 AAGCAATGGTTCTCAAAGTGTGG + Intergenic
1002787214 6:411297-411319 AAAGGATGCTTCACAAACTGAGG + Exonic
1002938712 6:1697561-1697583 AACCAATGGTTCTCAAAGTATGG + Intronic
1002978685 6:2112429-2112451 GAACAAGGGTTCTCAAAGTGCGG + Intronic
1003124186 6:3342495-3342517 AAACAGTGCTTCTCAAAGGTGGG + Intronic
1003557529 6:7154207-7154229 ACACTTTGGTTCTCAAAGTGTGG + Intronic
1003803687 6:9701310-9701332 AATCTATGGTTCTCAAAGTGTGG - Intronic
1004136161 6:12969048-12969070 GAACCTTGTTTCTCCAAGTGTGG - Intronic
1004200171 6:13541100-13541122 AGACAGTGGTTCTCAAAGTGTGG + Intergenic
1004544091 6:16580423-16580445 AAACCATACTACTCAAAGTGCGG - Intronic
1004607534 6:17207939-17207961 AAGCGATGTTTCTCAAAGGGTGG + Intergenic
1004770081 6:18771507-18771529 ATACCCTGCTTCACAAAGTTAGG - Intergenic
1005150435 6:22742640-22742662 AAACCATGTTTCTAAAAGAAAGG - Intergenic
1006189381 6:32198285-32198307 GAACAATGATTCTCAAAGTGTGG - Intronic
1006479894 6:34283674-34283696 AAACCCTGCCTCTAAAAGGGCGG - Exonic
1007189430 6:40000726-40000748 AAACAATGCTTCTCAAAGTGTGG - Intergenic
1007259334 6:40552094-40552116 ACACCGTGGTTCTCAAAGTGTGG + Intronic
1008334910 6:50291222-50291244 AAGCCCTGTTCCTCAAAGTGTGG + Intergenic
1009658032 6:66570750-66570772 GAACAGTGATTCTCAAAGTGTGG + Intergenic
1009927629 6:70139265-70139287 AACCCTTGCTGCTTAAAGTGTGG - Intronic
1010258524 6:73788931-73788953 AGGCCTTGCTACTCAAAGTGTGG - Intronic
1010372022 6:75121526-75121548 ACACCTTGCTACGCAAAGTGTGG + Intronic
1010408066 6:75528194-75528216 TAACAATGTTTTTCAAAGTGTGG + Intergenic
1010443956 6:75930691-75930713 AGAGCAGGGTTCTCAAAGTGGGG + Intronic
1010489388 6:76455540-76455562 TCACCAGGCTTCTCAGAGTGGGG + Intergenic
1010597460 6:77781414-77781436 AAAACTTGCTGCTCAAAATGTGG + Intronic
1011183177 6:84644614-84644636 ACAAAGTGCTTCTCAAAGTGTGG + Intergenic
1011507293 6:88059778-88059800 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1011662971 6:89609959-89609981 AACTCATGCGTCTCAAAGGGAGG + Intronic
1011819532 6:91235232-91235254 GAACCTTGCTACTCAATGTGAGG + Intergenic
1012172545 6:96036976-96036998 GACCCTTGCTTGTCAAAGTGTGG - Intronic
1012253023 6:97000261-97000283 AATTGATGCTACTCAAAGTGTGG + Intronic
1012389350 6:98719799-98719821 AAAAGGTGCTTCTCAAAGTGAGG + Intergenic
1012621404 6:101348735-101348757 ATACCATTCTTGTCAAAGTTGGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013185126 6:107750850-107750872 CAACCTTGCTACTCGAAGTGTGG - Intronic
1013217527 6:108041379-108041401 GATCCATGCTTCTTACAGTGTGG - Intergenic
1013411478 6:109887827-109887849 AAACCAGGCTTCAGAAGGTGAGG + Intergenic
1013489339 6:110630058-110630080 AAATTGTGCTTCTCAAAGTGTGG + Intronic
1013570205 6:111415577-111415599 GACCAATGATTCTCAAAGTGTGG - Intronic
1013655507 6:112242631-112242653 AAACATTGCTACTGAAAGTGTGG - Intronic
1013833661 6:114305904-114305926 CAATCCTGCTTCTCAAATTGTGG - Intronic
1013947009 6:115733436-115733458 AAGCTTTGCTTCTCATAGTGTGG - Intergenic
1014052236 6:116968290-116968312 CAACCTGGCTTTTCAAAGTGTGG - Intergenic
1014685563 6:124495583-124495605 AGACCTTGCTCCTCAAAGTGTGG - Intronic
1014839890 6:126206435-126206457 AACCCTTGCTACTCAAAGTGTGG - Intergenic
1015098038 6:129440738-129440760 AATCCATGCTTGACAAAGCGAGG - Intronic
1015705367 6:136082058-136082080 AATAAATGCTTCTCAGAGTGTGG - Intronic
1015805867 6:137107840-137107862 AAATCATGTTTCTCAAACTTTGG - Intergenic
1015876481 6:137827939-137827961 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1016900116 6:149092808-149092830 AACCAATGCTTCTCAAAATGTGG + Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017340557 6:153316860-153316882 AAAGCATGTTTCTCAAACTGTGG + Intergenic
1017364365 6:153616703-153616725 AGGCCTTGCTACTCAAAGTGTGG + Intergenic
1017398693 6:154033755-154033777 AATCAGTGCTTCTGAAAGTGTGG + Intronic
1017667557 6:156735991-156736013 AAGCCTGGCTTCTCAAAGAGTGG - Intergenic
1017802407 6:157909130-157909152 GAACAATGCTACTCAAAGTATGG + Intronic
1017906411 6:158760032-158760054 ACACCATCCTTCTCCCAGTGGGG - Intronic
1018025087 6:159799514-159799536 GAACTATGGTCCTCAAAGTGAGG - Intergenic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1020431282 7:8118829-8118851 GAACCATGGTTCTCACAATGTGG + Intronic
1021197044 7:17685487-17685509 AAAGCAAGGTTCTAAAAGTGGGG - Intergenic
1021666052 7:22981610-22981632 AACCAATGCTTCGGAAAGTGTGG + Intronic
1021750153 7:23790112-23790134 GATCCTTGCTTCTCAAAGTATGG - Intronic
1021889174 7:25170916-25170938 TAACAATGGTTCTCAAAGAGTGG + Intronic
1021897020 7:25246681-25246703 AATCAATGGTTCTCAAAGTGGGG - Intergenic
1021930639 7:25577889-25577911 GATCAATGGTTCTCAAAGTGTGG - Intergenic
1022265146 7:28746395-28746417 AGGCCTTGCTGCTCAAAGTGGGG + Intronic
1022411579 7:30142482-30142504 TGCCCATGGTTCTCAAAGTGTGG + Intronic
1022748953 7:33203420-33203442 AGAGCAGGGTTCTCAAAGTGTGG - Intronic
1022834698 7:34102508-34102530 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1022970762 7:35514622-35514644 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1024010842 7:45265451-45265473 AAAACAGGCTGCTCAAACTGTGG - Intergenic
1024101068 7:46033404-46033426 AATCCAAGCTTCTCAACATGTGG - Intergenic
1024304178 7:47913071-47913093 TAACCATGGTTCTCCAAGTTTGG - Intronic
1026084214 7:67249583-67249605 CAACAATGGTTCTGAAAGTGTGG - Intergenic
1026093383 7:67319549-67319571 GAACCCTGCTACTGAAAGTGTGG + Intergenic
1026146708 7:67752768-67752790 AAACAGTAGTTCTCAAAGTGTGG - Intergenic
1026271532 7:68841367-68841389 GAACAATGGTTTTCAAAGTGGGG + Intergenic
1026308530 7:69164201-69164223 ACACCATGCTTTGCACAGTGAGG + Intergenic
1026326817 7:69317719-69317741 AAACAGTGATTCTCAAAGTAGGG + Intergenic
1026628276 7:72015797-72015819 TAACAGTGGTTCTCAAAGTGTGG - Intronic
1026659271 7:72285029-72285051 AAGCAGTGCTACTCAAAGTGTGG + Intronic
1026692869 7:72564758-72564780 CAACAATGGTTCTGAAAGTGTGG + Intronic
1028072717 7:86471976-86471998 AAAGATTGGTTCTCAAAGTGTGG + Intergenic
1028249007 7:88517686-88517708 AAACCACGGTTCTCAAAGTGTGG - Intergenic
1028449109 7:90960389-90960411 TAACTATGCTTGTCAAAATGTGG + Intronic
1028455467 7:91033599-91033621 CAGCCCTGCTGCTCAAAGTGTGG - Intronic
1028663911 7:93317692-93317714 AACCAATGGTTCTCAAAGTGTGG - Intronic
1028920213 7:96302747-96302769 GACCAATGGTTCTCAAAGTGTGG + Intronic
1029257719 7:99280693-99280715 AACCTTGGCTTCTCAAAGTGTGG - Intergenic
1030581596 7:111363218-111363240 AATCCTTGCTACTCAAAGTATGG + Intronic
1030803953 7:113890210-113890232 AAACAGTGCCTCTCAAAATGTGG + Intronic
1031228535 7:119074296-119074318 AGACAATGATTCTCCAAGTGTGG - Intergenic
1031416269 7:121500087-121500109 AATCAGTGGTTCTCAAAGTGTGG + Intergenic
1031844989 7:126794699-126794721 AAACGGTGTTTGTCAAAGTGTGG + Intronic
1032062136 7:128733783-128733805 AAAGCATGCTGCTGACAGTGAGG - Intergenic
1032403807 7:131641621-131641643 AAACCATGCTTTGCATAGAGAGG + Intergenic
1032540949 7:132702824-132702846 AAACCATGCTTCATCAAGGGCGG + Intronic
1032848620 7:135773173-135773195 GAACCATGATACTCAAAGTGTGG + Intergenic
1033383831 7:140852008-140852030 AAGTCTTGCTACTCAAAGTGTGG + Intronic
1033508060 7:142025605-142025627 AATCAGTGCTCCTCAAAGTGTGG + Intronic
1034706943 7:153154254-153154276 AAACCATGTTTGTAAAACTGAGG - Intergenic
1034713193 7:153215165-153215187 AAACCATGTTTTCAAAAGTGAGG - Intergenic
1034948001 7:155276514-155276536 AAAGCCCACTTCTCAAAGTGGGG + Intergenic
1035030821 7:155857663-155857685 ATAACCTGCTCCTCAAAGTGTGG + Intergenic
1035296654 7:157871189-157871211 AAGCTGTGGTTCTCAAAGTGGGG + Intronic
1035696856 8:1604392-1604414 GATCCATGTTTCTCAAAGTGTGG + Intronic
1036428154 8:8665515-8665537 CAACCTTGCTGCTCAAAGTGTGG + Intergenic
1037989166 8:23308385-23308407 CATCCCTGCTTCTCAAAGTGAGG - Intronic
1038512878 8:28156771-28156793 GAACCATGTCTTTCAAAGTGTGG - Intronic
1039344053 8:36684460-36684482 ACACAGTGCTGCTCAAAGTGTGG + Intergenic
1040488513 8:47897587-47897609 AAGCAGTGCTTCTCAAAGTGTGG + Intronic
1042028788 8:64451498-64451520 GAACCATGCTTGACAACGTGTGG - Intergenic
1042642623 8:70952827-70952849 AACCACTGCTACTCAAAGTGTGG + Intergenic
1042764161 8:72302324-72302346 GGGCCATGGTTCTCAAAGTGTGG - Intergenic
1043192716 8:77247033-77247055 GAAACATTTTTCTCAAAGTGTGG - Intergenic
1043355390 8:79405514-79405536 ATACCTTCCTACTCAAAGTGTGG - Intergenic
1043504286 8:80887173-80887195 AAACTGTGGTTCTCAAAGTATGG + Intergenic
1043934098 8:86123390-86123412 AACTCCTGCTTCGCAAAGTGAGG + Intronic
1044753869 8:95441664-95441686 ACAATATGCTTCTCAAAGTCAGG + Intergenic
1044770425 8:95625397-95625419 AGTCCTTGCTACTCAAAGTGTGG + Intergenic
1045013017 8:97975005-97975027 AAACATTGGTTCTCAAAGTGTGG - Intronic
1045901930 8:107292132-107292154 AGAGCCTGCTTCTCAAAATGTGG - Intronic
1045906356 8:107349943-107349965 AATCAGTGCATCTCAAAGTGTGG + Intronic
1045950922 8:107850775-107850797 AATCCTTGCTACTCAAAGTGTGG - Intergenic
1046242600 8:111516333-111516355 ACACCATGCCTCTCAAACTGCGG + Intergenic
1046612177 8:116438161-116438183 AAAACATGCTTATCAAAATGTGG + Intergenic
1047093747 8:121601398-121601420 AAACAAGGCTTATCAAAGTGAGG + Intergenic
1047186338 8:122636746-122636768 AAAGGATGCTTCTCACTGTGTGG - Intergenic
1047613249 8:126541288-126541310 AGACAATTGTTCTCAAAGTGTGG - Intergenic
1047645533 8:126866150-126866172 AACCCTTGCTTCTCAGAGCGTGG - Intergenic
1048259876 8:132936502-132936524 ACAGCTTGCTACTCAAAGTGTGG - Intronic
1048488431 8:134869815-134869837 AAACAGTGATTCTCCAAGTGTGG + Intergenic
1048541542 8:135346457-135346479 AAACTATGCTTCTCCAAATTTGG - Intergenic
1049162567 8:141106542-141106564 AGGCCTCGCTTCTCAAAGTGAGG - Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050656911 9:7838954-7838976 AAACAGTGATTCTCAAAGTATGG + Intronic
1051361074 9:16282171-16282193 GACCCTTGCTTCTCAAAGCGTGG + Intergenic
1051726631 9:20093668-20093690 GAACAATGGTTCTAAAAGTGTGG + Intergenic
1052428480 9:28335579-28335601 AGAATATGCTTCTCAAACTGGGG - Intronic
1052503277 9:29320211-29320233 AAGCTTTGCTTCTCAAAATGAGG - Intergenic
1052956521 9:34256702-34256724 AAAGGATGCCTCCCAAAGTGAGG - Exonic
1053115911 9:35502200-35502222 GAGTCATGCTACTCAAAGTGTGG - Intronic
1053254598 9:36605137-36605159 CTACCTTGCTTCCCAAAGTGTGG + Intronic
1053257705 9:36632222-36632244 AATCTGTGGTTCTCAAAGTGTGG - Intronic
1053602937 9:39629164-39629186 AAACTGTGTTTCTCCAAGTGTGG - Intergenic
1053860586 9:42382912-42382934 AAACTGTGTTTCTCCAAGTGTGG - Intergenic
1054250600 9:62713272-62713294 AAACTGTGTTTCTCCAAGTGTGG + Intergenic
1054564708 9:66747784-66747806 AAACTGTGTTTCTCCAAGTGTGG + Intergenic
1054715693 9:68555995-68556017 ACTCCTTGCTACTCAAAGTGTGG - Intergenic
1054720790 9:68601796-68601818 AGTCAATGCTTCTCCAAGTGTGG - Intergenic
1054828708 9:69599631-69599653 AAACAGTGGTTCTCAAAGTGTGG + Intronic
1055215828 9:73860938-73860960 GAGCAATGATTCTCAAAGTGTGG - Intergenic
1055256307 9:74375819-74375841 AAGGCATGTTTCTCAAAATGTGG - Intergenic
1055480098 9:76701215-76701237 AAACTGTGGTTCTCTAAGTGGGG - Intronic
1055685141 9:78765206-78765228 GGACAGTGCTTCTCAAAGTGTGG + Intergenic
1055991871 9:82114904-82114926 GAACCATGGTTCTCAGGGTGTGG - Intergenic
1056160569 9:83887575-83887597 ATACCAGGCTACTCAGAGTGTGG + Intronic
1056289633 9:85129634-85129656 GAACCACGCCACTCAAAGTGTGG + Intergenic
1056359643 9:85842325-85842347 ATACCAGGCTACTCAGAGTGTGG - Intergenic
1056541714 9:87577168-87577190 CAACTGTGGTTCTCAAAGTGTGG + Intronic
1056802098 9:89699300-89699322 GAACCCTGCTATTCAAAGTGTGG - Intergenic
1056972499 9:91218586-91218608 AAACTTTACTTCCCAAAGTGTGG - Intronic
1057002923 9:91529437-91529459 ATTCAGTGCTTCTCAAAGTGTGG + Intergenic
1057599744 9:96447678-96447700 AAGCAGTGCTTCTCAAAGTGTGG + Intergenic
1057891751 9:98874930-98874952 GCACCATGCTACTCATAGTGTGG + Intergenic
1057960828 9:99455095-99455117 AACCAGTGGTTCTCAAAGTGTGG - Intergenic
1058757610 9:108097723-108097745 AATCCATGCTTCTCCTAGGGAGG + Intergenic
1059393360 9:114014856-114014878 ACACAGTGCTTCTCAAAGTGCGG - Intronic
1059408617 9:114118076-114118098 CTACCTTGCTACTCAAAGTGTGG - Intergenic
1060278140 9:122197786-122197808 CAACCAGGCTGCTCACAGTGTGG + Intronic
1060651896 9:125335061-125335083 AAACTATACTTCTCAAGATGTGG + Intronic
1060898033 9:127231639-127231661 AGACATTGCTTCTCAAAGTGTGG + Intronic
1061761074 9:132851732-132851754 CAGCCAGGCTTCTCAGAGTGTGG - Intronic
1061769852 9:132910492-132910514 TAATTAGGCTTCTCAAAGTGAGG + Intronic
1062678699 9:137764079-137764101 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1203733950 Un_GL000216v2:117681-117703 ATGCCATGCTTCTCAAAGTATGG - Intergenic
1203661519 Un_KI270753v1:48136-48158 GAACATTGATTCTCAAAGTGTGG + Intergenic
1203672702 Un_KI270755v1:31209-31231 GAACATTGATTCTCAAAGTGTGG + Intergenic
1186215614 X:7297200-7297222 TAACCTTTCCTCTCAAAGTGTGG + Intronic
1186572253 X:10727585-10727607 AAGCAGTGATTCTCAAAGTGTGG + Intronic
1186648168 X:11529579-11529601 GATCCATGCTACTCAAAGTATGG - Intronic
1186837018 X:13448321-13448343 AATCCTTTCTACTCAAAGTGTGG - Intergenic
1186894524 X:13992629-13992651 GGACCTTGCTTCTCAAAATGTGG - Intergenic
1186996401 X:15128201-15128223 TAACAGTGGTTCTCAAAGTGTGG + Intergenic
1187067986 X:15859539-15859561 GAGCAATGGTTCTCAAAGTGTGG - Intergenic
1187133268 X:16523247-16523269 GAGCCTTGCTACTCAAAGTGTGG - Intergenic
1187208976 X:17210217-17210239 CACCCTTGCTTCTCAAGGTGTGG + Intergenic
1187232758 X:17438240-17438262 AACTCTTGCTTCTGAAAGTGGGG - Intronic
1187242984 X:17530472-17530494 GACCCTTGCTACTCAAAGTGTGG + Intronic
1187297702 X:18018083-18018105 AAGCCTTGCTCCTCAAACTGTGG - Intergenic
1187418809 X:19116796-19116818 AAACAATGTTTTTCAAACTGTGG + Intronic
1187421049 X:19133964-19133986 ATACAATGGCTCTCAAAGTGTGG - Intergenic
1187453939 X:19424504-19424526 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1187484216 X:19686713-19686735 GAGCCATGCTTCACAAACTGGGG - Intronic
1187510536 X:19913666-19913688 ATACAGTGGTTCTCAAAGTGTGG - Exonic
1187681123 X:21768871-21768893 AGCCAATGCTACTCAAAGTGTGG + Intergenic
1187708921 X:22034693-22034715 CAACTTTGCTTCTCAAAATGGGG + Intronic
1187717555 X:22118286-22118308 AGACCTTGCTGCGCAAAGTGTGG - Intronic
1188290088 X:28376937-28376959 CTACCTTGCTACTCAAAGTGTGG + Intergenic
1188415788 X:29932371-29932393 AAACCAGGTTTCGCAAAGTTAGG - Intronic
1188659912 X:32746424-32746446 AGGCTATGGTTCTCAAAGTGTGG + Intronic
1188681303 X:33010835-33010857 ACACTGTGGTTCTCAAAGTGTGG + Intronic
1188736117 X:33718398-33718420 GAACAGTGTTTCTCAAAGTGTGG + Intergenic
1188898300 X:35697024-35697046 GAAACTTGCTTCTCAAAGTGTGG - Intergenic
1189122531 X:38409674-38409696 GAACATTGCTTCTCAAAGTGTGG - Intronic
1189178151 X:38978688-38978710 ACACCTTGCTACCCAAAGTGTGG - Intergenic
1189439647 X:41023710-41023732 GAACAATGGTTCTCTAAGTGTGG - Intergenic
1190450971 X:50580367-50580389 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1190459704 X:50660347-50660369 ATACCTTGCTACTCAAAGTGTGG - Intronic
1190576040 X:51839901-51839923 AGACAATGGTTCTCAAAATGTGG + Intronic
1191601360 X:63012907-63012929 GAAGCATGCTTCTTACAGTGTGG + Intergenic
1191693637 X:63965769-63965791 AAACAATGTTTCTCAAAGTTTGG + Intergenic
1191940425 X:66474402-66474424 TCCCCATGCTTCTCACAGTGAGG + Intergenic
1192355457 X:70398774-70398796 AGACCAGGGTTTTCAAAGTGTGG + Intronic
1192500815 X:71650642-71650664 AAACAGTGCTTCTCAACCTGAGG - Intergenic
1192558633 X:72110126-72110148 GATCCTTGCTGCTCAAAGTGAGG + Intergenic
1192847279 X:74919415-74919437 AAACCATGATTCTCAATTTGGGG - Intronic
1193127634 X:77886301-77886323 AACCTGTGTTTCTCAAAGTGTGG + Intronic
1193200298 X:78681828-78681850 ATCCAATGTTTCTCAAAGTGTGG - Intergenic
1193408275 X:81131216-81131238 GAGCAATGCTTCTCAATGTGTGG - Intronic
1194620113 X:96160778-96160800 AAAATATGTTTCTCAAAATGGGG - Intergenic
1194721519 X:97346148-97346170 AGAACATACTACTCAAAGTGTGG + Intronic
1195555582 X:106218525-106218547 AAATCTTGCTTCTGAGAGTGTGG + Intergenic
1196037503 X:111162141-111162163 TGGCCATGGTTCTCAAAGTGTGG - Intronic
1196388691 X:115187889-115187911 AAGCCTTGCTACTCAAACTGAGG + Intronic
1197362188 X:125518377-125518399 AAGTCATGTTTCTCAAAGTGGGG - Intergenic
1197712197 X:129679314-129679336 ACCCCTTGCTTCTCAAGGTGTGG - Intergenic
1197804708 X:130387545-130387567 GAGCAGTGCTTCTCAAAGTGTGG - Intergenic
1198165816 X:134055715-134055737 AAGCCTTGCTACTCAAATTGTGG - Intergenic
1198318266 X:135491692-135491714 ATGCAGTGCTTCTCAAAGTGTGG + Intergenic
1198500447 X:137239553-137239575 ACACTTTGCTTTTCAAAGTGTGG - Intergenic
1198975490 X:142331390-142331412 AAGTCTTGCTACTCAAAGTGAGG - Intergenic
1198990679 X:142511149-142511171 AAACCTTGTTTCTCAAAATATGG - Intergenic
1199654434 X:149980706-149980728 GAGCCTTGCTTCTCAAAGTGTGG + Intergenic
1199694446 X:150334010-150334032 ATACCATGGTTCTCAAAGTACGG - Intergenic
1200824716 Y:7625925-7625947 AAATAATTCATCTCAAAGTGCGG + Intergenic
1200839537 Y:7766598-7766620 GAATCTTGCTACTCAAAGTGTGG - Intergenic
1201569118 Y:15395601-15395623 ACACCCTGATTCTCAAAGTGAGG + Intergenic
1202235339 Y:22705162-22705184 AAATAATTCATCTCAAAGTGCGG - Intergenic
1202307820 Y:23491006-23491028 AAATAATTCATCTCAAAGTGCGG + Intergenic
1202562981 Y:26179580-26179602 AAATAATTCATCTCAAAGTGCGG - Intergenic
1202627062 Y:56870728-56870750 ATGCCATGCTTCTCAAAGTATGG + Intergenic