ID: 917517474

View in Genome Browser
Species Human (GRCh38)
Location 1:175719928-175719950
Sequence GCAGGCACGCCTGCCACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917517474_917517480 7 Left 917517474 1:175719928-175719950 CCTGTAGTGGCAGGCGTGCCTGC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 917517480 1:175719958-175719980 GGCACTGCCTGCTGCCTTCCCGG 0: 1
1: 0
2: 8
3: 64
4: 392
917517474_917517481 8 Left 917517474 1:175719928-175719950 CCTGTAGTGGCAGGCGTGCCTGC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 917517481 1:175719959-175719981 GCACTGCCTGCTGCCTTCCCGGG 0: 1
1: 0
2: 2
3: 63
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917517474 Original CRISPR GCAGGCACGCCTGCCACTAC AGG (reversed) Intronic
900554081 1:3271054-3271076 GCAGGCAGGCCGGCCACAGCCGG - Intronic
902118690 1:14143096-14143118 GCAGTCCCTCCTGCCACTATGGG - Intergenic
902516772 1:16993766-16993788 GCAGGAATGCCTGCCCCTTCAGG + Exonic
906296932 1:44654675-44654697 GGAGGCACGCCTGGCACGCCGGG - Exonic
908589066 1:65609404-65609426 ATAGGCACACTTGCCACTACGGG - Intronic
914401708 1:147327271-147327293 GGAGGCATGCCTGCCTCTATAGG - Intergenic
916870182 1:168905474-168905496 GCAGTCAAACCTGCCACTATAGG + Intergenic
917517474 1:175719928-175719950 GCAGGCACGCCTGCCACTACAGG - Intronic
918697285 1:187560282-187560304 GCGGCCACGCCTCCCACTAGGGG + Intergenic
920193057 1:204207197-204207219 GCAGGCACACCTGTCACTCCTGG - Intronic
1063115254 10:3067902-3067924 GCAGGTACCCCTGCCGCTTCCGG - Intronic
1064261674 10:13791270-13791292 GCAGGCACCCCTGGCAGAACTGG + Intronic
1064702462 10:18036132-18036154 GGAGGCCTGCCTGCCACTGCAGG - Intronic
1066639218 10:37538503-37538525 GGAGGCCTGCCTGCCTCTACAGG + Intergenic
1069714892 10:70514291-70514313 GCAGGCGGGGCTGCCACTGCGGG - Intronic
1074003386 10:109393975-109393997 GCAGCCACCCCTTCCCCTACGGG - Intergenic
1074770855 10:116732799-116732821 GCAGTCCCGCCAGCCACTCCCGG - Intronic
1077836666 11:5932491-5932513 GCAGGCACGGCTGCCAGCCCTGG - Intronic
1078315427 11:10289754-10289776 GCAGGCACTGCTCCCACTTCCGG + Intronic
1079106054 11:17573174-17573196 GCAGGGATGCCTGCCGCTGCGGG + Exonic
1079800308 11:24860308-24860330 GCAGCCACCCCTCCCACTAGGGG - Intronic
1084222740 11:67694363-67694385 CCAGGCCCCCCTGCCACTCCAGG - Intergenic
1084222748 11:67694381-67694403 CCAGGCCCCCCTGCCACTCCAGG - Intergenic
1085295577 11:75429888-75429910 GCACGTGCGCCTGCCGCTACTGG - Exonic
1086621087 11:88887559-88887581 GCAGTCATGCCTGCAACTATGGG + Intronic
1087929314 11:103958082-103958104 GCAGTAACGCCTGCCACTTATGG + Intronic
1096859210 12:54511336-54511358 GCAGGGAAGCCTGCCAATAATGG - Intronic
1099684284 12:85865833-85865855 GCAGCCACCCCTCCCACTAGGGG + Intergenic
1101066573 12:101027727-101027749 GCAGCCACTCCTCCCACTAGGGG - Intronic
1102026401 12:109716177-109716199 GCAGGGAAGCGTGCCAGTACTGG - Intronic
1104107249 12:125674742-125674764 GCAGGCACCCCTCCCACTGCAGG + Intergenic
1112330276 13:98472053-98472075 GCAGGCAAGCCAGCCACTGGAGG + Intronic
1113139256 13:107128742-107128764 CCAGGCACCACTGCCAATACTGG - Intergenic
1114443158 14:22767132-22767154 GCAGGCAGCTCGGCCACTACAGG - Intronic
1117343220 14:54808958-54808980 GCAGGCGCGGCTCCCACTACAGG + Intergenic
1118478652 14:66142044-66142066 GCTGCCACTGCTGCCACTACTGG + Intergenic
1118839194 14:69498469-69498491 GGAGGCAGGCCTGGGACTACTGG - Intronic
1119582936 14:75803923-75803945 GCAGGCAAGCCTGAGACTGCAGG + Intronic
1122229542 14:100298867-100298889 ACAAGCACGCCTGCCACACCTGG + Exonic
1122664098 14:103316879-103316901 TCTGGCACGCCTCCCACTCCAGG + Intergenic
1122859922 14:104577924-104577946 GCAGGCAGGCCTGACACAACTGG + Intronic
1123030738 14:105449937-105449959 GGAGGCACGCCTCCCAGGACTGG + Intronic
1124642056 15:31401902-31401924 GCAGGCTTGCGTGCCACTCCAGG - Intronic
1125274960 15:37979762-37979784 GCAGGCCTGTCTGCCACCACTGG + Intergenic
1125469184 15:39985927-39985949 ACAGGCCCACCCGCCACTACTGG - Intronic
1129976246 15:79824538-79824560 GCAGGCATGACAGGCACTACTGG - Intergenic
1132578234 16:673687-673709 GCAGGCCAGGCTGCCACTCCGGG + Exonic
1136276103 16:29180343-29180365 CCAGCCACGGCTGCCACTGCAGG - Intergenic
1141160344 16:81625452-81625474 GCAGACAGGCCTGTCACCACAGG - Intronic
1142080482 16:88146405-88146427 CCAGCCACGGCTGCCACTGCAGG - Intergenic
1147806979 17:43138774-43138796 GCCTGCACGCCTGCTGCTACAGG - Intergenic
1147921406 17:43919350-43919372 GCCTGCACGCCTGCTGCTACGGG - Intergenic
1151471654 17:74322115-74322137 GCAGGGAAGGCTGCAACTACAGG + Intergenic
1152060949 17:78074839-78074861 GCAGCCACACCAGCCACTGCTGG - Intronic
1160910955 19:1473608-1473630 GCAGCCACAGCAGCCACTACCGG + Exonic
1161326549 19:3667071-3667093 CCAGGCACCCCTGCCACTGAGGG + Intronic
1164610292 19:29627134-29627156 GCAGGCACACCCACCACTCCCGG - Intergenic
1167037564 19:47003151-47003173 GAAGGCCGGCCTGCCACGACTGG - Exonic
1167705994 19:51081617-51081639 GCAGGGCCGCCTGCCACGGCTGG + Exonic
1202659163 1_KI270708v1_random:52033-52055 GCAAGCCCCCCTGCCACCACAGG - Intergenic
934720164 2:96568612-96568634 GCAGGCAGTCCTGCTACTTCTGG - Intergenic
934776093 2:96938431-96938453 GCATGCATGCCTGCCCCCACAGG + Intronic
937379145 2:121360759-121360781 GCAGGAAGGCCTGCCAATGCAGG + Intronic
941002305 2:160214731-160214753 GCAGTCACGCCTGGCAGTACAGG + Intronic
1173615691 20:44401517-44401539 CCAGGCACACCTGCCCCCACTGG - Intronic
1175225395 20:57441335-57441357 ACAGGCAGGCCTGCTACTGCTGG - Intergenic
1175529084 20:59661891-59661913 GCAAGCAGCCCTGCCACTAGCGG - Intronic
1180575208 22:16766891-16766913 GGAGGCCTGCCTGCCTCTACAGG + Intergenic
1182022343 22:27091425-27091447 GCTGGCAGGACTGCCTCTACTGG - Intergenic
1184978695 22:48081102-48081124 TCAGGCACGCCTGCGTCTCCTGG + Intergenic
951500129 3:23376673-23376695 GAAGCCTTGCCTGCCACTACTGG - Intronic
953241705 3:41155395-41155417 GCAGGCAGGGCTGCCTCTGCAGG - Intergenic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
961376502 3:126469628-126469650 GCACTCAAGCCTGCCACTCCTGG + Intronic
964286576 3:155124903-155124925 GGAGGCCTGCCTGCCACTATAGG - Intronic
968505654 4:970187-970209 GCAGGCACACCTGCCACTGGCGG - Intronic
974697555 4:65396091-65396113 GCAGGCACGTCTGAGCCTACAGG - Intronic
985493222 5:191174-191196 GCACGAACGCCTGCCAAGACTGG + Intergenic
986891991 5:12320453-12320475 TCAGGCACGTCTGCCAGTATAGG + Intergenic
987453898 5:18119714-18119736 GCAGCCACCCCTCCCACTAGGGG - Intergenic
1002921697 6:1577497-1577519 GCAGGCACAGCTGCCCCGACGGG - Intergenic
1003054715 6:2807750-2807772 GCAGGCACCCCAGCCAGAACAGG + Intergenic
1019587164 7:1811854-1811876 GCATGCACCACTGCCACTCCTGG - Intergenic
1029425923 7:100493945-100493967 GCGGGCACGCCTGGCTCTCCCGG + Exonic
1034780076 7:153871255-153871277 GGAGGCCTGCCTGCCTCTACAGG - Intergenic
1035587342 8:786157-786179 GCAAGGACGCCTGCCAGGACGGG - Intergenic
1035619838 8:1028569-1028591 GCAGCCACGCCTGGCACATCTGG - Intergenic
1036915542 8:12800093-12800115 GCAGACACCCCTGAGACTACAGG + Intergenic
1037729771 8:21514647-21514669 GGAGCCACTCCTGCCTCTACAGG + Intergenic
1044750081 8:95407417-95407439 TAAGGCACGCATGCCACTTCTGG - Intergenic
1047373377 8:124274452-124274474 CAAGGCACACCTGCCACTCCAGG - Intergenic
1052209053 9:25879367-25879389 TCAGGCTAGCCTGCCACCACTGG + Intergenic
1190059638 X:47202531-47202553 GCAGACATGCCTGGCACTGCAGG + Intronic
1194945763 X:100065032-100065054 GCAGACTGGCCTGGCACTACAGG + Intergenic