ID: 917518837

View in Genome Browser
Species Human (GRCh38)
Location 1:175731624-175731646
Sequence ATTTCATTAAGGAGGCACGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917518831_917518837 20 Left 917518831 1:175731581-175731603 CCATGTTAAAGACTAGAAAATGA 0: 1
1: 0
2: 1
3: 44
4: 552
Right 917518837 1:175731624-175731646 ATTTCATTAAGGAGGCACGGCGG 0: 1
1: 0
2: 1
3: 6
4: 150
917518830_917518837 21 Left 917518830 1:175731580-175731602 CCCATGTTAAAGACTAGAAAATG 0: 1
1: 0
2: 3
3: 68
4: 700
Right 917518837 1:175731624-175731646 ATTTCATTAAGGAGGCACGGCGG 0: 1
1: 0
2: 1
3: 6
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917518837 Original CRISPR ATTTCATTAAGGAGGCACGG CGG Intronic
904172998 1:28605057-28605079 ATTTCATTAAGGAGGTATGGTGG + Intronic
906580797 1:46934025-46934047 TGTGCATTAAGGAGGCACTGAGG - Exonic
906602927 1:47144869-47144891 TGTGCATTAAGGAGGCACTGAGG + Exonic
906802580 1:48750586-48750608 ACTTCTTTAAGGTGGCAAGGGGG + Intronic
906890598 1:49709011-49709033 CTCTCATGCAGGAGGCACGGTGG + Intronic
908338388 1:63150581-63150603 ATTTCAGTATGGAGGGATGGAGG + Intergenic
908921808 1:69203386-69203408 ATTTCATTCAGGAAGGACTGAGG + Intergenic
911102941 1:94108158-94108180 CTATCATTAAGGAGCCAGGGAGG - Intronic
916458909 1:165000746-165000768 ATATCATTAAGGATGCAGAGTGG + Intergenic
916573864 1:166050287-166050309 CTTTCATTCAGGAGGGAAGGAGG + Intergenic
916938616 1:169656949-169656971 CTCCCAGTAAGGAGGCACGGGGG - Intergenic
916986976 1:170202153-170202175 ATTTCATGTAAGAGGCAAGGGGG - Intergenic
917518837 1:175731624-175731646 ATTTCATTAAGGAGGCACGGCGG + Intronic
920514059 1:206571446-206571468 AGTTAATTAAGGATGGACGGTGG - Intronic
1067293449 10:44960599-44960621 TTTTCATTAACCTGGCACGGCGG + Intronic
1069292839 10:66804339-66804361 AGTTCACTAATGAGGCACTGGGG - Intronic
1071434558 10:85635231-85635253 ATTTAATAAGGGAGGCACAGTGG + Intronic
1073341050 10:102744563-102744585 ATTTCTTTAAGGATGGACTGGGG + Intronic
1074666802 10:115737136-115737158 ACTTCATTGGGTAGGCACGGTGG + Intronic
1074889964 10:117727528-117727550 ATTTCATTGAGGTCCCACGGAGG + Intergenic
1077374837 11:2200640-2200662 ACTTCACCAAGGAGACACGGAGG + Intergenic
1078409960 11:11106426-11106448 ATTTTTTTAAGAAGGCAGGGTGG - Intergenic
1079108708 11:17591267-17591289 ATTTCATGCAGGAGACACAGGGG - Intronic
1079197240 11:18340147-18340169 ATTTCATAGAGGTGGCAAGGAGG - Intronic
1079714968 11:23732585-23732607 CTTCCAGTCAGGAGGCACGGGGG - Intergenic
1080101717 11:28467134-28467156 ATCTCATCGAGGAGGCACTGCGG + Intergenic
1080982006 11:37419099-37419121 ATTTCAGTAATGAAGTACGGTGG + Intergenic
1086924940 11:92630133-92630155 ATTTCATTCAGCAGGTAGGGAGG - Intronic
1090018566 11:123107211-123107233 ATTTCATTAGCCAGGCATGGTGG - Intronic
1090725034 11:129517542-129517564 CTCTCAGTCAGGAGGCACGGGGG + Intergenic
1090732378 11:129583011-129583033 CTTTCAGTAAGGAAGCACTGTGG + Intergenic
1090902210 11:131043116-131043138 AATGCATTTAGGAGGCAAGGAGG + Intergenic
1098643785 12:72872293-72872315 ATTTCATTATGGAGTTAAGGAGG + Intergenic
1099901748 12:88719099-88719121 ATTTCCTTAAGGAAACACAGTGG - Intergenic
1100711170 12:97258430-97258452 ACTTCATTCAGTAGGCACTGGGG + Intergenic
1100783290 12:98052357-98052379 ATTTCATTAAGGATGAAAGAAGG + Intergenic
1100962548 12:99979197-99979219 ATTTCTTTAAGGATGAAAGGGGG + Intronic
1100969674 12:100054585-100054607 AAATCATAAAGGGGGCACGGGGG + Intronic
1104651402 12:130537077-130537099 CTCTCATTAAGGAGGCATGAGGG + Intronic
1106360432 13:29026050-29026072 ATGTCATTGAGGAGGAAAGGCGG + Exonic
1106687657 13:32078189-32078211 ATTTTATAAAGGAAGCACAGAGG + Intronic
1107325304 13:39235550-39235572 ATTTCATTATGTAGGCATGATGG + Intergenic
1107648235 13:42516973-42516995 CTCTCAGTCAGGAGGCACGGGGG - Intergenic
1110268645 13:73568396-73568418 ATTTCAGTAAGAAGACAGGGAGG - Intergenic
1112231672 13:97593905-97593927 TTTTCAGTCAGGAGGCACAGGGG - Intergenic
1112427456 13:99316182-99316204 ATTTTATCAAGGAGGCAATGAGG - Intronic
1113675746 13:112206141-112206163 CTTTCAGTAAGGAAGCTCGGCGG - Intergenic
1116456356 14:45124723-45124745 ATATTATTAAGCAGGCACAGTGG - Intronic
1117162447 14:53002563-53002585 ACTACATGAAGGAGGCACTGTGG - Intergenic
1118926939 14:70199731-70199753 CTCTCAGTCAGGAGGCACGGGGG + Intergenic
1119564231 14:75615103-75615125 AGTTCTTTAAGCAGGGACGGTGG + Intronic
1120271725 14:82321541-82321563 CTTTCAGCCAGGAGGCACGGGGG + Intergenic
1122650508 14:103223821-103223843 ATTTCCTTCAGGAGACAAGGTGG + Intergenic
1125437056 15:39657610-39657632 ATTTCAAGAAGGAGGAATGGTGG - Intronic
1126745777 15:51825005-51825027 ATTTCATTATGGAAGCTTGGAGG - Intergenic
1128857443 15:71031450-71031472 CTCCCATTCAGGAGGCACGGGGG + Intronic
1133232836 16:4374513-4374535 ATTTAATTAAGGAGGGAGGAGGG + Intronic
1135088783 16:19495684-19495706 ATTTTAATAATTAGGCACGGTGG + Intronic
1138017839 16:53446631-53446653 ATATCTTTAAGGAGGGAGGGAGG + Intronic
1138448672 16:57079952-57079974 GTTTCATCAAGCAGGCAAGGTGG - Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1141938274 16:87256273-87256295 ATTTAATTAGGCAGGCATGGTGG + Intronic
1142657803 17:1405776-1405798 ATATCATTAACCAGGCTCGGTGG + Intergenic
1145967410 17:28929701-28929723 ATTTCACTAAGGAAACAGGGAGG - Intronic
1149365521 17:55939663-55939685 CTCTCATTCAGGAGGCACGGGGG - Intergenic
1155288774 18:24319999-24320021 ATTTAATTAGCCAGGCACGGTGG + Intronic
1159114031 18:64092839-64092861 ATTTCATTAAGGATGTACTTGGG + Intergenic
1161860213 19:6792299-6792321 TTTTCATTGAGGAGGAAGGGTGG + Intronic
1162766135 19:12920801-12920823 TTTTCATTAATCAGGCATGGTGG + Intergenic
1164206332 19:23061946-23061968 ATTCCACTAAGGAGGCACAGTGG - Intergenic
925394916 2:3526595-3526617 ATTTCATCCTGGGGGCACGGAGG - Intergenic
925612972 2:5718631-5718653 ATATCATTCAGGAGACACGGAGG - Intergenic
926797728 2:16632626-16632648 CTTTCACAAAGCAGGCACGGGGG + Intronic
930743894 2:54861278-54861300 AGTTCATTAAGGAGACAGGTGGG - Intronic
931964248 2:67515949-67515971 ATATAATCAAGGATGCACGGAGG + Intergenic
933788591 2:85864949-85864971 ATTTCAGTCAGGAGGCAGAGGGG - Intronic
934698840 2:96422381-96422403 CTCTCAGTCAGGAGGCACGGGGG + Intergenic
936409286 2:112240385-112240407 ATTTTATTTAGTAGGCATGGGGG + Intronic
940408023 2:153328257-153328279 CTTTCAGTCAGGAGGCATGGGGG + Intergenic
944517931 2:200531101-200531123 ATGTCTTTAAGGAGGCAGGAAGG + Intronic
946929845 2:224660710-224660732 ATTTCATTAGCCAGGCATGGTGG - Intergenic
947075800 2:226344274-226344296 ATGTCATTAGGGAGGCAGTGAGG + Intergenic
948036844 2:234864603-234864625 AGTTCATTATGCAGGGACGGAGG + Intergenic
1172407350 20:34699667-34699689 ATCACTTTAAGGGGGCACGGAGG + Intronic
1172968350 20:38855422-38855444 ATTTTGTCAAGGAGGCATGGTGG + Intronic
1172985367 20:38983204-38983226 ATTTGATTGAACAGGCACGGCGG - Intronic
1173116639 20:40249609-40249631 AGTTCATGGAGGAGGCAAGGTGG - Intergenic
1174947047 20:54999022-54999044 CTTTCATGAAGGAGGAAAGGAGG - Intergenic
1178360596 21:31946216-31946238 ATTTCATAAGGAAGGCACGGTGG - Intronic
1179816812 21:43911594-43911616 AGTTCATAAAGGTGGCAAGGAGG + Intronic
1179961845 21:44772038-44772060 ACTGCAGTTAGGAGGCACGGAGG + Intronic
1182311291 22:29409683-29409705 ATTTCATTAATAAGGCAAGAGGG - Intronic
1182713919 22:32340145-32340167 ATTTTATGAAGGAGACACCGAGG - Intergenic
950569165 3:13789358-13789380 ACAGCATTAAGGAGGCAGGGAGG - Intergenic
953268539 3:41416894-41416916 ATTTCATGAAGGAGAGTCGGGGG + Intronic
953555174 3:43939898-43939920 CTCTCAGTCAGGAGGCACGGGGG + Intergenic
956438744 3:69259942-69259964 ATTTCATTAGCCAGGCATGGTGG - Intronic
960823035 3:121754654-121754676 ATTTTTTTAAGTAGACACGGGGG - Intergenic
961817095 3:129556688-129556710 ATTTCTATAAGGAGGCAGGATGG + Exonic
962422978 3:135244229-135244251 ATCTAATTAAAGAGGCAGGGAGG - Intronic
968652913 4:1767187-1767209 ATTTAATTAAGGAGCCGCCGGGG - Intergenic
969469738 4:7380635-7380657 ACTTTATTAAGGAGGAACGAGGG - Intronic
969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG + Intronic
969998716 4:11342165-11342187 TTTTCATTAAGGGGTCAAGGAGG + Intergenic
973760106 4:54107846-54107868 AATTAATTAAGGAGGAAAGGAGG - Intronic
981917484 4:150050843-150050865 ATTTCATTAAGGTGGCAATTTGG - Intergenic
982283596 4:153711707-153711729 ATCTCATTCAGGAAGCAGGGTGG - Intronic
984147637 4:176083106-176083128 ATTTTATTCATGAGGCACTGTGG + Intronic
991022152 5:61990673-61990695 ATTTAATAAAGGAGGCTTGGAGG + Intergenic
991638064 5:68726041-68726063 ATATCATTAAGGAGTTAGGGAGG - Intergenic
992295544 5:75323212-75323234 GTTTCATTAAGTAGGCACAATGG + Intergenic
995998257 5:118326492-118326514 ATTACATTAATGATGCACAGAGG + Intergenic
996987433 5:129584350-129584372 CTCCCATTCAGGAGGCACGGGGG + Intronic
1002720688 5:181259859-181259881 ATTTGATGAGGGAGACACGGTGG - Intronic
1003564265 6:7209062-7209084 TTTTCATAAAGGAGGGACTGGGG - Intronic
1003794412 6:9584103-9584125 ATTTCATTAAGCAAGCACCATGG - Intergenic
1005378345 6:25207923-25207945 CTCTCAGTCAGGAGGCACGGGGG - Intergenic
1005386559 6:25290951-25290973 ATTTAATTAGGCAGGCATGGTGG - Intronic
1005785783 6:29244425-29244447 TTTTCAGTCAGGAGGCATGGGGG + Intergenic
1006749363 6:36366892-36366914 ATATCATTAAGAAGGAACCGGGG - Exonic
1008588060 6:52966806-52966828 ATTCCTTTAAAGAGGCATGGAGG - Intergenic
1011796793 6:90963052-90963074 AATTCATTAACCAGGCATGGTGG - Intergenic
1015067418 6:129048037-129048059 ATTTTATTAAGAAGGCAGAGAGG - Intronic
1015500832 6:133931375-133931397 CTTCCAGTCAGGAGGCACGGGGG - Intergenic
1017317111 6:153044118-153044140 ATTTCACTAAGGAAGGAGGGAGG + Intronic
1017890601 6:158635537-158635559 ATTTCAGCAGGCAGGCACGGAGG + Intergenic
1024495514 7:50041344-50041366 CTTTCAGTCAGGAGGCATGGGGG - Intronic
1025090589 7:56059987-56060009 ACTTCATGAACCAGGCACGGTGG - Intronic
1027720056 7:81729388-81729410 ATTTCATTAAGGACCCTAGGTGG - Intronic
1029982849 7:104895470-104895492 ATTGCATTCAGGAGGCAGTGAGG + Intronic
1030399012 7:109025522-109025544 ATTTCATAAAGTAGGCACACAGG - Intergenic
1033304999 7:140218746-140218768 ATTTCATGTAGGAAGCAAGGCGG + Intergenic
1033773382 7:144579087-144579109 ATTTCATAAATCATGCACGGCGG + Intronic
1035865578 8:3077789-3077811 CTTTCATTGAAGAGGCACAGCGG - Intronic
1037190142 8:16114621-16114643 GTTTAATTAAGGAAGCACTGAGG - Intronic
1038051676 8:23819938-23819960 ATTTGATAAAGAAGGCATGGTGG + Intergenic
1041150210 8:54924638-54924660 TTTTCATTAACGAGGCATGGTGG - Intergenic
1041341959 8:56855607-56855629 ATTTCTTTAAGGAGGCTCTAGGG + Intergenic
1042215239 8:66424650-66424672 ATTTCATTAAGGAGAAAGGAGGG + Intergenic
1042496209 8:69457481-69457503 ATTTCATTCAGCTGGCACAGTGG + Intergenic
1045839409 8:106561661-106561683 CTCCCATTCAGGAGGCACGGGGG - Intronic
1046926406 8:119794075-119794097 TTTTAATTAACCAGGCACGGTGG - Intronic
1047750287 8:127875461-127875483 ATTTCATAGATGAGGAACGGAGG - Intergenic
1051249632 9:15146328-15146350 ATGTCATTAAAAAGGCAGGGAGG + Intergenic
1051539287 9:18196475-18196497 ATTTCATCAAGGAATCCCGGAGG - Intergenic
1055361138 9:75491626-75491648 ATTTCATTTTGGAGGCAGTGAGG + Intergenic
1058971526 9:110087670-110087692 ATTTCATCAAGGAAGCACCCCGG + Intronic
1059534885 9:115071372-115071394 ATGGCATTAAGGAGGCGTGGTGG + Intronic
1061502571 9:131012506-131012528 ATGTCTTTGAGGAGGCAGGGCGG - Intronic
1185541632 X:907104-907126 TTTTAATTAATGAGGCACGGTGG - Intergenic
1186230483 X:7448574-7448596 ATTTGATAAAGGAGGAACAGGGG - Intergenic
1186766042 X:12771566-12771588 ATTTCCTTAAAGCGGCACAGCGG + Intergenic
1190687453 X:52887711-52887733 AGTGCACTCAGGAGGCACGGCGG - Intergenic
1190698529 X:52968081-52968103 AGTGCACTCAGGAGGCACGGCGG + Intronic
1191237950 X:58151301-58151323 CTTTCAGTCAGGAGGCATGGGGG - Intergenic
1192598619 X:72438028-72438050 CTTCCATTCAGGAGGCACAGGGG - Intronic
1194229117 X:91300018-91300040 CTGTCAGTCAGGAGGCACGGGGG + Intergenic
1198146727 X:133864749-133864771 ATTTCATTCATGATGCAAGGAGG + Intronic