ID: 917520415

View in Genome Browser
Species Human (GRCh38)
Location 1:175743537-175743559
Sequence GGCTCAACACCCAGAGGAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917520415_917520421 23 Left 917520415 1:175743537-175743559 CCGTCTCCTCTGGGTGTTGAGCC 0: 1
1: 0
2: 0
3: 14
4: 213
Right 917520421 1:175743583-175743605 CTGCCTCTGACGTGAAAGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 124
917520415_917520423 26 Left 917520415 1:175743537-175743559 CCGTCTCCTCTGGGTGTTGAGCC 0: 1
1: 0
2: 0
3: 14
4: 213
Right 917520423 1:175743586-175743608 CCTCTGACGTGAAAGAGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 126
917520415_917520417 -3 Left 917520415 1:175743537-175743559 CCGTCTCCTCTGGGTGTTGAGCC 0: 1
1: 0
2: 0
3: 14
4: 213
Right 917520417 1:175743557-175743579 GCCAACAGCCTTAGCACAGTCGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917520415 Original CRISPR GGCTCAACACCCAGAGGAGA CGG (reversed) Exonic
900038815 1:439931-439953 GGCTGAACCCCCACAGGATAAGG + Intergenic
900060248 1:674907-674929 GGCTGAACCCCCACAGGATAAGG + Intergenic
900242864 1:1625227-1625249 GGCTGAAGTCCCAGAGGGGAGGG + Intronic
903733472 1:25515091-25515113 GGTTCCACACCCAAAGGACAGGG + Intergenic
904473417 1:30749639-30749661 GGGTCAACACCCAGAGCTCAGGG + Intronic
904938058 1:34145750-34145772 GTCTCAGCACACAGAGGAGAGGG + Intronic
905149270 1:35914351-35914373 GGCTCAAGAGCCAGAGCTGAGGG - Intronic
905300314 1:36982362-36982384 GGCGCACCATCCAGAGGAGCTGG + Intronic
906298530 1:44664035-44664057 GCCTCAGCACCCTGAGGAGCTGG - Intronic
907028228 1:51143775-51143797 GCCTCAACCCCCAGAGTAGCTGG + Intronic
907669410 1:56461605-56461627 GATTCAACCCCCAGAGGACAAGG + Intergenic
908464821 1:64383055-64383077 GGCTCTGAACCCAGATGAGAAGG + Intergenic
910515304 1:88053999-88054021 GGCTCACCACCCTGAAGGGATGG - Intergenic
915465878 1:156097684-156097706 GGTTCAGACCCCAGAGGAGATGG + Intronic
915473355 1:156138618-156138640 GGCAGAAGAGCCAGAGGAGATGG - Exonic
916581537 1:166113773-166113795 GGCTGAACAGGCATAGGAGATGG + Intronic
916833947 1:168522757-168522779 GGCACAGCACCCAGAGAAGCAGG + Intergenic
917520415 1:175743537-175743559 GGCTCAACACCCAGAGGAGACGG - Exonic
918072435 1:181142686-181142708 GCCTCCACACCCAGCGGAGCGGG - Intergenic
918093249 1:181315278-181315300 GGCTGAAAACCGAGAGGACAGGG + Intergenic
920396172 1:205647740-205647762 GGCTCTAGACCCAGAGAACACGG - Intergenic
922702338 1:227769206-227769228 GGCTCAACACCGGGAGGAACAGG + Intronic
1062789072 10:289923-289945 CACTCAACAGCCAGAGGAGATGG - Intronic
1063246441 10:4224494-4224516 GCCTCAACCTCCAGAGGAGCTGG - Intergenic
1066046188 10:31597622-31597644 GGCAGAACAGCCAGAGTAGAAGG + Intergenic
1066506328 10:36048633-36048655 GGCTTCACACTCAGAGAAGAAGG - Intergenic
1066559325 10:36651987-36652009 GCCTCAACCCCCAGAGTAGCTGG - Intergenic
1068016163 10:51518440-51518462 GACTCTAGACCCAGAAGAGAAGG - Intronic
1068234964 10:54221715-54221737 GCCTCAACCCCCAGAGTAGCTGG + Intronic
1070022447 10:72600175-72600197 GCCTCAACCCCCAGAGTAGCTGG - Intronic
1073538757 10:104301020-104301042 GGCTCCACATCCGGAGCAGATGG - Intronic
1075835835 10:125452050-125452072 GGCTCCGTACCCAGAGGGGAAGG + Intergenic
1076013579 10:127009874-127009896 CACTCAAGACCCAGAGGAGTCGG - Intronic
1076499911 10:130929224-130929246 AGCACAGCACACAGAGGAGACGG - Intergenic
1076965023 11:75842-75864 GGCTGAACCCCCACAGGATAAGG + Intergenic
1077643281 11:3901074-3901096 GCCTCAACCTCCAGAGCAGATGG - Intronic
1079021489 11:16912767-16912789 GGCTAGAAGCCCAGAGGAGATGG - Intronic
1081537419 11:44005777-44005799 CTCTCAACAACTAGAGGAGATGG + Intergenic
1081972590 11:47210065-47210087 GCCTCAGCACCCAGAGTAGCTGG - Intergenic
1083163638 11:60870581-60870603 AGCCCAACTCCCAGAGCAGATGG + Intronic
1088807892 11:113368480-113368502 GGTTCAACAAGCAGAGGAGCTGG + Intronic
1089534914 11:119154948-119154970 GGCTCAGGGCCGAGAGGAGAGGG - Intronic
1089732097 11:120525507-120525529 GTCACAACACCCAGAGGACAGGG - Intronic
1095379899 12:41578239-41578261 GACTCAACACCCTGAGTAGTTGG + Intergenic
1099266667 12:80455056-80455078 GCCTCAACCCCCAGAGTAGCTGG - Intronic
1099498212 12:83378650-83378672 GGCTGGACACCCAGACCAGAAGG + Intergenic
1101116083 12:101532617-101532639 GCCTCAACCTCCAGAGCAGATGG - Intergenic
1101645599 12:106628230-106628252 TGCTCAAAGCCCAGAGGAAACGG - Intronic
1102054992 12:109889872-109889894 CTCTTAACACCCAGAGGAGTTGG - Intergenic
1104972261 12:132537181-132537203 GGCTTCACACCCACAGCAGAGGG - Intronic
1105455656 13:20538912-20538934 GGCTTAACCCCCAGTGGAGATGG - Intergenic
1106146818 13:27056569-27056591 AGCTCAACATACAAAGGAGAAGG + Intergenic
1108520294 13:51241028-51241050 GGCTAAAAACCTAGAGCAGAGGG - Intronic
1108795394 13:54024036-54024058 GGCTCAACAGTCACAGTAGAGGG - Intergenic
1111124439 13:83896175-83896197 GGCTCACCACCCAGTGGGAAAGG + Intergenic
1118743619 14:68758701-68758723 GGCTCATCTCCCTGAGCAGAGGG + Intergenic
1120565903 14:86056822-86056844 GGCTCAAAACCTAGATGTGACGG - Intergenic
1121506868 14:94484284-94484306 GACTCCCCTCCCAGAGGAGAGGG + Intergenic
1121738193 14:96233482-96233504 GACTCCACAGCCAGAGGAAAGGG - Intronic
1122033478 14:98930853-98930875 AGCTCCACACACAGAGGTGAGGG + Intergenic
1122081006 14:99267998-99268020 GGCTGACCACGCAGAGGAAAGGG - Intronic
1122895942 14:104757048-104757070 GGCTCAAAGACCAGAGGAGGAGG - Intronic
1127665643 15:61144184-61144206 GGATCAACACCCACAGAGGAAGG + Intronic
1128794053 15:70451969-70451991 GTCTCATCACCAAGAGGAGGTGG - Intergenic
1129452005 15:75656388-75656410 GGGCCAACTCCCAGAGGTGAGGG + Intronic
1130931577 15:88432182-88432204 GGCTAAACTCCTAGAGGACAGGG + Intergenic
1132086425 15:98911908-98911930 GGCTCATGACCTAGAGCAGAGGG - Intronic
1132443100 15:101887674-101887696 GGCTGAACCCCCACAGGATAAGG - Intergenic
1132785565 16:1655456-1655478 GGCTCCACACCCAGGGAATAAGG - Intronic
1133380066 16:5322408-5322430 GGCTCAGCACCCAGACCAAAAGG - Intergenic
1133435975 16:5780115-5780137 GCCTCAGCATCCAGAGTAGATGG + Intergenic
1135347098 16:21698406-21698428 GGGTCAACATCAAAAGGAGAGGG - Intronic
1135627526 16:24009201-24009223 GGGTAAATACCCAGAGGTGAGGG + Intronic
1136171657 16:28493622-28493644 GCCACCACACCCAGACGAGAGGG - Exonic
1141625439 16:85258955-85258977 AGCTCAGCCCCCAGAGAAGAAGG - Intergenic
1142125179 16:88406600-88406622 GGTTCAACAGGGAGAGGAGAGGG + Intergenic
1142532010 17:586005-586027 GGCTCAACACCCACATAGGAAGG + Intronic
1143767405 17:9146644-9146666 GTCTCAGCACCCAGAGGGCATGG - Intronic
1144183868 17:12777857-12777879 GCCTCAACCCCCAGAGTAGATGG + Intergenic
1145013697 17:19383751-19383773 CTCTCAACACCCAGAGGGTATGG + Exonic
1146255450 17:31389584-31389606 GGCTCAGCACAGAAAGGAGATGG - Intergenic
1146611501 17:34309518-34309540 GTCTCAACAGAGAGAGGAGATGG - Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147503883 17:40994194-40994216 GGACCAACTCCCAGTGGAGAGGG - Intergenic
1147549845 17:41432903-41432925 AGCTTAACACCCATAGGAAATGG - Intergenic
1147722646 17:42548346-42548368 GGCGCAGCACCCTGAGGAGGTGG + Intergenic
1148456127 17:47812456-47812478 GGCTCGACTTCCACAGGAGATGG - Intronic
1148769840 17:50060374-50060396 GGCTCACCTCAAAGAGGAGAAGG - Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149984295 17:61335563-61335585 CAGTCAGCACCCAGAGGAGAAGG - Intronic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151691504 17:75688966-75688988 GGCCCAACAACCAGAGCAGGAGG - Intronic
1152952381 17:83246342-83246364 CTCTCAACACCAAGAAGAGAAGG - Intergenic
1153761437 18:8335905-8335927 GGCTCAACCTCCAGAGTAGCTGG - Intronic
1155416496 18:25605040-25605062 GGCTCAGCACCCAGGGAAGGTGG - Intergenic
1159785856 18:72713468-72713490 GGGTCACCACCCAGAGACGACGG + Intergenic
1160641828 19:145472-145494 GGCTGAACCCCCACAGGATAAGG + Intergenic
1161482156 19:4516655-4516677 GGCTGCCCACCCAGAGCAGACGG - Exonic
1163141024 19:15348713-15348735 GCCTCAACCCCCAGAGTAGCTGG - Intergenic
1164534135 19:29072253-29072275 AGCTCAACACTCAGAGCAAAGGG + Intergenic
1165102395 19:33446708-33446730 TGCTCACCACCCAGAGGGGAGGG + Intronic
1165409454 19:35650116-35650138 GCCTCAACATCCAGAGTAGCTGG + Intronic
1165846189 19:38819235-38819257 GAGTAAAGACCCAGAGGAGAGGG + Intronic
1167592239 19:50410294-50410316 GACTCAAGTCCCAGGGGAGAAGG - Intronic
925024893 2:599870-599892 ACCTCTTCACCCAGAGGAGAGGG + Intergenic
926728697 2:16018307-16018329 GCCTCAGCACCCTGAGGAGCTGG + Intergenic
927054399 2:19356067-19356089 GGCCAAGCACCCAGAGGAGCAGG - Intronic
929784274 2:44977866-44977888 GTCTCAACACACACAGGAGAGGG + Intergenic
930060816 2:47286947-47286969 GGCTCTACAGCCAGGAGAGAGGG - Intergenic
932798976 2:74722694-74722716 GGGTAAACCCCCAGAGGAGAAGG - Intergenic
933239662 2:79905953-79905975 GGCTCAAGAGCTAGAGGAAAAGG - Intronic
936252068 2:110874670-110874692 CTCGCAACACCCAGAGGAGGTGG - Intronic
937574396 2:123401579-123401601 GGCTCATCACACAGAGGGGCTGG - Intergenic
938097663 2:128474115-128474137 GGCTCAAACCCCTGAGGAGCAGG - Intergenic
938097859 2:128475197-128475219 GGCTCAACCCCATGAGGAGTGGG + Intergenic
940073863 2:149719231-149719253 AACTCAAAACCCAGAGAAGACGG - Intergenic
943789427 2:191915725-191915747 TTCTAAACAGCCAGAGGAGAAGG + Intergenic
945857031 2:215081361-215081383 GCCTCAGCACCCAGAGTAGCTGG - Intronic
945865453 2:215169437-215169459 GGCTCACCAGCCAGAGGCCAGGG + Intergenic
948912607 2:241011934-241011956 GGCTCAGCCCCCAGCGGGGAGGG + Intronic
1169210207 20:3761857-3761879 TGCTAAAAACACAGAGGAGAGGG + Intronic
1169461386 20:5798730-5798752 GGCTCAACCTCCAGAGTAGCTGG + Intronic
1170371563 20:15654394-15654416 GGCATAAGGCCCAGAGGAGATGG + Intronic
1170444323 20:16409699-16409721 GGCTAGACACAAAGAGGAGACGG + Intronic
1170810476 20:19670184-19670206 GGCTCACCACACTGAGGAGAGGG + Intronic
1171723887 20:28596648-28596670 GGCTCAGCCTCCAGAGGAGCTGG - Intergenic
1172480940 20:35271054-35271076 GGCTGAATACTGAGAGGAGAAGG + Intronic
1172933566 20:38602391-38602413 GACTCTACACCCAGAGGAAGAGG - Intronic
1173111089 20:40191304-40191326 GGGCCATCACCCAGAAGAGAAGG + Intergenic
1174443943 20:50577870-50577892 GGCTCAACACCCAGCTGAAGAGG - Intronic
1175353590 20:58344440-58344462 GTCTCAGTACCCAGAGGAAAGGG - Intronic
1177141867 21:17366315-17366337 GCCTCAACCCCCAGAGTAGCTGG - Intergenic
1178136732 21:29636092-29636114 GGCACAACAGCCACAGGAGTTGG + Intronic
1178834988 21:36089350-36089372 ATCTCAGCACCCAGAGTAGATGG + Intergenic
1180029600 21:45197061-45197083 GCCTCAACCTCCAGAGTAGACGG - Intronic
1183371566 22:37435521-37435543 CTCCCCACACCCAGAGGAGAAGG + Intergenic
1185239329 22:49734306-49734328 AGCTCAACACCCAGAGATGGTGG - Intergenic
1185364885 22:50432916-50432938 GGCTCAGCACCCCAAGGGGAGGG - Intronic
954020089 3:47732727-47732749 AGCACAACACCCATAGAAGATGG - Intronic
954678356 3:52327721-52327743 GGGTCAGCCCCCAGTGGAGAGGG + Intronic
956276715 3:67510021-67510043 GGAGCAACAGCCAGAGGAGGAGG - Intronic
960299362 3:115983295-115983317 TGCTCAACACCCAGAGTTCAGGG + Intronic
964509758 3:157437796-157437818 GGCGCAGCGCCCAGAGGAGGCGG + Exonic
965604327 3:170484227-170484249 GGGTCCACCCCCAGAGAAGAGGG + Intronic
966879397 3:184341459-184341481 TTCCCAGCACCCAGAGGAGATGG - Intronic
969476686 4:7426143-7426165 GGCTGTAGACCCAGAGGAGAAGG + Intronic
969495134 4:7522220-7522242 GGCTCCTCACCCTGAGGAGGAGG + Intronic
970132085 4:12883462-12883484 TGCTCAACTCACAGAGTAGAGGG - Intergenic
971144985 4:23966841-23966863 GGTTCAACATTCAGAGGAGAGGG + Intergenic
980844845 4:138312302-138312324 TGCTCCACAACAAGAGGAGAAGG - Intergenic
981777682 4:148388805-148388827 TGCAGAAGACCCAGAGGAGAAGG + Intronic
984696619 4:182785877-182785899 TTCACAACACCCAAAGGAGAAGG + Intronic
985284199 4:188318369-188318391 GGCTCAGAACCCAGTTGAGAAGG + Intergenic
987447505 5:18038497-18038519 GTCCAACCACCCAGAGGAGAGGG - Intergenic
988091449 5:26545464-26545486 GGCTCTAAACACAGAGGATAGGG - Intergenic
992345272 5:75869578-75869600 GACTCACCACCCTGAAGAGAAGG + Intergenic
998064901 5:139150225-139150247 GGCATATCACCCAGAAGAGATGG - Intronic
998411448 5:141914449-141914471 GGCTCAACTGCCTGCGGAGACGG - Intergenic
998671317 5:144357368-144357390 GGAGCAACACCCAGATGAGCAGG - Intronic
1001068132 5:168556512-168556534 GGCTCAACAACCAGAGGGAATGG - Exonic
1001579717 5:172790298-172790320 GACTCAGAACCCAGAGGGGAAGG + Intergenic
1002735032 5:181379012-181379034 GGCTGAACCCCCACAGGATAAGG - Intergenic
1002749494 6:95110-95132 GGCTGAACCCCCACAGGATAAGG + Intergenic
1002755041 6:150672-150694 CTCTCAACACCAAGAAGAGAAGG + Intergenic
1003540200 6:7011792-7011814 GGCTCAGCACCAAGAGCAGGAGG + Intergenic
1006145595 6:31957559-31957581 TGCACAACACAGAGAGGAGAAGG + Intronic
1006593961 6:35179251-35179273 GCCTAAACACCCTGGGGAGAGGG + Intergenic
1006615135 6:35321101-35321123 GCCTCAGCCCTCAGAGGAGAGGG - Intronic
1006641994 6:35494442-35494464 GGCACAACACCAGGAGGGGAGGG + Intronic
1007189390 6:40000408-40000430 GAATCAATCCCCAGAGGAGAGGG + Intergenic
1007595805 6:43050612-43050634 GGCCCATCCCCCAAAGGAGAAGG - Intronic
1012831674 6:104211150-104211172 GCCTCAACCCCCAGAGTAGCTGG - Intergenic
1018795749 6:167184378-167184400 TCCTGAACACCCAGAGGAAAGGG - Intronic
1018820566 6:167370686-167370708 TCCTGAACACCCAGAGGAAAGGG + Intronic
1019239291 6:170651329-170651351 GGCTGAACCCCCACAGGATAAGG - Intergenic
1019689071 7:2399819-2399841 GGCTCAACTCCCTGAGTAGCTGG - Intergenic
1020524273 7:9238486-9238508 GCCTCAACCCCCAGAGTAGGTGG - Intergenic
1022514013 7:30964092-30964114 GGCTCAACACGCAGAAGACGTGG - Exonic
1022996030 7:35756459-35756481 GACTCAACCTCCAGAGGAGCTGG - Intergenic
1023631268 7:42166576-42166598 GGGACAACAAACAGAGGAGAAGG + Intronic
1023644834 7:42299902-42299924 GGCTAGCCTCCCAGAGGAGAAGG + Intergenic
1028791143 7:94854520-94854542 GATTAAAAACCCAGAGGAGAGGG - Intergenic
1029116149 7:98238299-98238321 GGCACAGCACCCAGAGGCCAGGG - Intronic
1030266615 7:107628540-107628562 GGCTGAACCCCCACAGGATAAGG + Intronic
1032246498 7:130218039-130218061 GGCGCAGATCCCAGAGGAGAGGG + Intergenic
1034512385 7:151546617-151546639 TGCTCAAGTCCCAAAGGAGACGG - Intergenic
1035508479 8:155279-155301 GGCTGAACCCCCAAAGGATAAGG + Intergenic
1036085916 8:5612680-5612702 GGCTCAGCAACTAGAGAAGAAGG - Intergenic
1041248977 8:55916653-55916675 GGCTCCACTCCCAGGGGAGGAGG - Intronic
1041427938 8:57743951-57743973 GACTCAACACACAGATAAGATGG - Intergenic
1041655742 8:60348595-60348617 GGCACAAAACTCAGAGGTGAAGG - Intergenic
1044886089 8:96779213-96779235 GGCTCAGCAGGCAGAGAAGAGGG - Intronic
1047718942 8:127620758-127620780 GGCACAAGCCTCAGAGGAGAAGG + Intergenic
1049452862 8:142671664-142671686 GCCTCAACCCCCAGAGTAGCTGG + Intronic
1049730467 8:144175096-144175118 AGATCAAGAACCAGAGGAGATGG + Intronic
1050633089 9:7581279-7581301 GACTCAACAGCAGGAGGAGAAGG + Intergenic
1052384354 9:27806833-27806855 GGCTCAACTGCCAGAGGTTAGGG + Intergenic
1056628333 9:88272698-88272720 GGCTCCCCACCCAGTGGAAAAGG + Intergenic
1057081322 9:92176608-92176630 GGTTCGACTCCCAGTGGAGACGG - Intergenic
1057139755 9:92719231-92719253 GGCCCAGCACGCCGAGGAGAAGG - Exonic
1057208897 9:93188926-93188948 AGCTCAACACCAAAAGGAGAAGG - Intronic
1061009596 9:127947045-127947067 GCCCCAACCCCCAGAGGAGATGG - Intronic
1061583570 9:131552754-131552776 TGCTCAAGCCCCAGAGGTGAAGG - Intergenic
1062308318 9:135921889-135921911 GGGTCACCACCCAGAGCAGGAGG - Intergenic
1062314655 9:135960881-135960903 GCCTCCACCCCCGGAGGAGAGGG + Intronic
1062393464 9:136343150-136343172 GGCCACACACCCAGAGGAGCTGG - Intronic
1062759499 9:138331620-138331642 GGCTGAACCCCCACAGGATAAGG - Intergenic
1203599946 Un_KI270748v1:2392-2414 GGCTGAACCCCCACAGGATAAGG - Intergenic
1185984914 X:4822164-4822186 GGCTCAACAGACAGAAGAAAAGG + Intergenic
1189369642 X:40417437-40417459 GCCTCAGCACCCTGAGTAGATGG + Intergenic
1190684259 X:52856434-52856456 GTCTCTATACCCAGAGGAAATGG + Intergenic
1190881315 X:54494869-54494891 GCCTCAGCAGACAGAGGAGAAGG + Intronic
1194179472 X:90694968-90694990 GGCTGAACACCCTGAGGACTAGG + Intergenic
1196806314 X:119590124-119590146 GGCTCTTCACCCAGAGGATCTGG - Exonic
1197750572 X:129961119-129961141 CGCTGAAGCCCCAGAGGAGAGGG - Intergenic
1199019986 X:142868151-142868173 TGCTCAAAACCCTGAGGAGTGGG + Intergenic
1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG + Intergenic
1201461467 Y:14230247-14230269 GGCTCAGCTCCCAGAGTAGCTGG - Intergenic