ID: 917525644

View in Genome Browser
Species Human (GRCh38)
Location 1:175786030-175786052
Sequence CTGCCATGACAGCTGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917525637_917525644 25 Left 917525637 1:175785982-175786004 CCAAGATGTATCTACTGCAAATG No data
Right 917525644 1:175786030-175786052 CTGCCATGACAGCTGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917525644 Original CRISPR CTGCCATGACAGCTGGGCCA GGG Intergenic
No off target data available for this crispr