ID: 917526889

View in Genome Browser
Species Human (GRCh38)
Location 1:175796151-175796173
Sequence GCTACTGTTTCTGAACCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917526889_917526895 8 Left 917526889 1:175796151-175796173 CCTCTTGGTTCAGAAACAGTAGC No data
Right 917526895 1:175796182-175796204 GGAAGGATTCATAGAAAGAAGGG No data
917526889_917526897 27 Left 917526889 1:175796151-175796173 CCTCTTGGTTCAGAAACAGTAGC No data
Right 917526897 1:175796201-175796223 AGGGCATATTCAAATCTTGAGGG No data
917526889_917526896 26 Left 917526889 1:175796151-175796173 CCTCTTGGTTCAGAAACAGTAGC No data
Right 917526896 1:175796200-175796222 AAGGGCATATTCAAATCTTGAGG No data
917526889_917526892 -9 Left 917526889 1:175796151-175796173 CCTCTTGGTTCAGAAACAGTAGC No data
Right 917526892 1:175796165-175796187 AACAGTAGCTCACCATGGGAAGG No data
917526889_917526894 7 Left 917526889 1:175796151-175796173 CCTCTTGGTTCAGAAACAGTAGC No data
Right 917526894 1:175796181-175796203 GGGAAGGATTCATAGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917526889 Original CRISPR GCTACTGTTTCTGAACCAAG AGG (reversed) Intergenic
No off target data available for this crispr