ID: 917526893

View in Genome Browser
Species Human (GRCh38)
Location 1:175796177-175796199
Sequence CTTTCTATGAATCCTTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917526893_917526896 0 Left 917526893 1:175796177-175796199 CCATGGGAAGGATTCATAGAAAG No data
Right 917526896 1:175796200-175796222 AAGGGCATATTCAAATCTTGAGG No data
917526893_917526897 1 Left 917526893 1:175796177-175796199 CCATGGGAAGGATTCATAGAAAG No data
Right 917526897 1:175796201-175796223 AGGGCATATTCAAATCTTGAGGG No data
917526893_917526898 12 Left 917526893 1:175796177-175796199 CCATGGGAAGGATTCATAGAAAG No data
Right 917526898 1:175796212-175796234 AAATCTTGAGGGCATATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917526893 Original CRISPR CTTTCTATGAATCCTTCCCA TGG (reversed) Intergenic
No off target data available for this crispr